|
|
|
|
|
|
|
||
© The Rockefeller University Press,
0021-9525/2001//745 $5.00
The Journal of Cell Biology, Volume 153, Number 4,
, 2001 745-762
Original Article |
Biogenesis of the Signal Recognition Particle (Srp) Involves Import of Srp Proteins into the Nucleolus, Assembly with the Srp-Rna, and Xpo1p-Mediated Export
simos{at}med.uth.gr
The signal recognition particle (SRP) targets nascent secretory proteins to the ER, but how and where the SRP assembles is largely unknown. Here we analyze the biogenesis of yeast SRP, which consists of an RNA molecule (scR1) and six proteins, by localizing all its components. Although scR1 is cytoplasmic in wild-type cells, nuclear localization was observed in cells lacking any one of the four SRP "core proteins" Srp14p, Srp21p, Srp68p, or Srp72p. Consistently, a major nucleolar pool was detected for these proteins. Sec65p, on the other hand, was found in both the nucleoplasm and the nucleolus, whereas Srp54p was predominantly cytoplasmic. Import of the core proteins into the nucleolus requires the ribosomal protein import receptors Pse1p and Kap123p/Yrb4p, which might, thus, constitute a nucleolar import pathway. Nuclear export of scR1 is mediated by the nuclear export signal receptor Xpo1p, is distinct from mRNA transport, and requires, as evidenced by the nucleolar accumulation of scR1 in a dis3/rrp44 exosome component mutant, an intact scR1 3' end. A subset of nucleoporins, including Nsp1p and Nup159p (Rat7p), are also necessary for efficient translocation of scR1 from the nucleus to the cytoplasm. We propose that assembly of the SRP requires import of all SRP core proteins into the nucleolus, where they assemble into a pre-SRP with scR1. This particle can then be targeted to the nuclear pores and is subsequently exported to the cytoplasm in an Xpo1p-dependent way.
Key Words: SRP • XPO1 • nuclear pore complex • nucleocytoplasmic transport • nucleolus
© 2001 The Rockefeller University Press
 |
Introduction |
|---|
 TopAbstract Introduction Materials and MethodsResultsDiscussionReferences |
|---|
Here we study the biogenesis and nuclear export of another conserved ribonucleoprotein complex, the signal recognition particle (SRP). In eukaryotes, SRP mediates the cotranslational targeting of secretory and membrane proteins to the ER membrane (for review see Brodsky 1998; Kalies and Hartmann 1998; Bui and Strub 1999; Stroud and Walter 1999). The SRP binds to the hydrophobic ER–targeting (signal) sequences of nascent proteins and targets the ribosome–nascent chain complex to the SRP receptor, which is anchored in the ER. Subsequently, the SRP is released and the ribosome–nascent chain complex is delivered to the ER translocation machinery. Translation then resumes with concomitant translocation of the nascent chain through the lipid bilayer of the ER membrane. Mammalian SRP is composed of a 7S RNA (SRP-RNA) and six proteins which associate with the RNA as monomers (SRP19 and SRP54) or heterodimers (SRP9/14 and SRP68/72). The best characterized component is SRP54, a GTPase which recognizes the signal sequence and also mediates the interaction with the SRP receptor. SRP19 is thought to facilitate the association of SRP54 with the SRP-RNA. These two proteins, together with the SRP68/72 dimer and the core sequence of the SRP-RNA, constitute the S domain of the SRP. SRP9 and SRP14 bind to the 5' and 3' sequences of the RNA to form the Alu domain, which is involved in elongation arrest. Yeast SRP resembles its mammalian counterpart in that it also consists of six proteins (Srp72p, Srp68p, Srp54p, Sec65p, Srp21, and Srp14p) and a single RNA molecule called scR1 (Hann and Walter 1991; Brown et al. 1994; Mason et al. 2000). All the proteins are homologous to those of mammalian SRP (Sec65p being the homologue of SRP19) except Srp21p which is yeast specific. No yeast homologue of SRP9 exists, but the function of this protein is most likely carried out by a second copy of Srp14p, which binds to an Alu-like sequence as a homodimer (Strub et al. 1999; Mason et al. 2000). Four of the protein subunits of yeast (Srp14p, Srp21p, Srp68p, and Srp72p) were shown to be required for the stable expression of the SRP (Brown et al. 1994), suggesting that together with scR1, they build up a stable "core" particle to which Sec65p and Srp54p can subsequently bind.
In contrast to the wealth of functional and structural data on SRP (Stroud and Walter 1999), relatively little is known about its biogenesis and assembly in vivo. The SRP-RNA is transcribed by RNA polymerase III and, in the case of mammalian SRP-RNA, undergoes limited processing at the 3' end: three uridylates are removed and a single adenylate is added (Chen et al. 1998; Sinha et al. 1998, Sinha et al. 1999). This processing is thought to require an intact Alu domain, i.e., binding of the SRP9/14 heterodimer. SRP-RNA microinjected into the nuclei of mammalian cells localizes transiently in the nucleolus before it appears in the cytoplasm, suggesting a nucleolar phase in the biogenesis of the SRP (Jacobson and Pederson 1998). In agreement with this observation, endogenous SRP-RNA has been detected in the nucleoli of rat fibroblasts together with three green fluorescent protein (GFP)-tagged transfected SRP proteins, SRP19, SRP68, and SRP72 (Politz et al. 2000). Microinjection studies in Xenopus oocytes further showed that nuclear export of SRP-RNA is a carrier-mediated and -facilitated process that also depends on the presence of the Alu domain (He et al. 1994).
To analyze the biogenesis of the SRP in yeast, we localized both its protein components (as GFP fusion proteins) and scR1 (by FISH) in wild-type and mutant yeast cells. Our results suggest that assembly of a nuclear export–competent SRP takes place in the nucleolus and requires the four "core" SRP proteins, which are actively imported into the nucleus by the ribosomal import pathway, as well as an intact scR1 3' end. Subsequent transport into the cytoplasm involves the nuclear export factor Xpo1p and the nucleoporin Nsp1p (provided by O. Gadal, BZH, Heidelberg, Germany).
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
FISH
The yeast SRP-RNA (scR1) was localized by FISH essentially as described for tRNA, except that Escherichia coli 5S rRNA in the hybridization buffer was replaced with the same concentration of tRNA (Grosshans et al. 2000a). Hybridizations were performed in hybridization buffer containing 50% formamide (for further details see Amberg et al. 1992) with a mixture of three Cy3-labeled oligonucleotide probes (SRP1, 5'-AATTCTCAACGTATCCCATCCCACC-3'; SRP2, 5'-CACTTCAGAACGGACTCTCCCGCCT-3'; and SRP3, 5'-TGCCTTAACCAACTGGGCCAAGAG-3') at 4 pmol/µl each at 37°C overnight. DNA was stained with 50 ng/ml DAPI and the slides were mounted with Mowiol. Poly(A)+ RNA was localized using an FITC- or Cy3-labeled oligo(dT)50 probe and tRNA was localized using a mixture of 5 pmol/µl each of the previously described probes against tRNAGlu(UUC) and tRNAGly(GCC) (Grosshans et al. 2000a).
RNA Extraction and Northern Blot Analysis
Total RNA was extracted from yeast cells as described (Sharma et al. 1996), separated on a 6% urea-polyacrylamide denaturing gel and transferred to a Hybond XL membrane. Hybridization with radioactively labeled oligonucleotides with identical sequences to the probes used for FISH was performed at 37°C in 6x SSPE (900 mM NaCl, 60 mM NaH2PO4, 0.3 mM EDTA) overnight.
Leptomycin B Treatment of Leptomycin B–sensitive Yeast
Yeast cells expressing the XPO1 wild-type allele or the leptomycin B (LMB)-sensitive xpo1-T539C point mutant allele (Neville and Rosbash 1999) were grown in minimal medium to an OD600 of 0.6, 10 ml was spun down and resuspended in 1 ml medium, and 10 µl of 10 µg/ml LMB in ethanol was added. As a control, 10 µl of ethanol alone was added. Cells were incubated for 20 min at 30°C before fixation. The LMB-sensitive XPO1 mutant strain and LMB were gifts from M. Rosbach (Brandeis University, Waltham, MA) and M. Yoshida (University of Tokyo, Tokyo, Japan), respectively.
Screen for SRP-RNA Export Mutants
A collection of yeast ts mutant cells used previously to identify mRNA export mutants (Amberg et al. 1992) was screened for temperature-dependent intranuclear accumulation of SRP-RNA. Cells were grown at 23°C and shifted to 37°C for 4 h. The complementing gene for srx1 mutant cells (SRP-RNA export), which accumulated SRP-RNA inside the nucleus at 37°C, but not at 23°C, was cloned by complementation of the ts phenotype through transformation with a yeast genomic DNA library on a centromeric vector (Bergès et al. 1994). Sequencing of two of the complementing plasmids, which showed similar but not identical restriction patterns, revealed NSP1 as the only complete ORF present on both plasmids. Complementation by NSP1 was confirmed using plasmids pSB32-NSP1 containing full-length NSP1 (Wimmer et al. 1992) and pNOP::ProtA-NSP1-C, respectively, containing the essential COOH terminus of NSP1 under control of the NOP1-promoter (provided by S. Bailer, BZH, Heidelberg, Germany).
scR1 3' End Determination
The 3' ends of scR1 from wild-type and rrp44-1 mutant cells, respectively, were determined by a modified 3' rapid amplification of cDNA ends (RACE) approach (Li et al. 1998). In brief, 100 pmol of a 3' end-blocked DNA oligonucleotide (sequence: GATTGACAGGATCCTAAGTTCC*, C* being cordycepin, i.e., 3' deoxyoadenosine, from NAPS) was annealed to the 3' ends of 5 µg of total RNA by incubation with 15 U of T4 RNA ligase at 0°C on ice overnight in 50 mM Hepes, pH 8.0, 10 mM MgCl2, 10 mM DTT, 0.01 mg/ml BSA, and 1 mM ATP. The annealed RNA was reverse transcribed and a 282-bp fragment of the scR1 3' end was amplified using the Titan One Tube reverse transcription PCR kit (Roche Diagnostics) according to the manufacturer's instructions and oligos scR1-3'-complement (GAACTTAGGATCCTGTCAATC) and scR1-For(261) (TTTCTCGAGGCGTGAGGAATCCGT), the latter introducing an XhoI site at the 5' end of the fragment. Resulting amplification products were cloned into pCR2.1-TOPO vector (Invitrogen) according to the manufacturer's instructions. Sequencing of several randomly selected, positive clones was performed by TopLab (Martinsried). The sequences obtained were, with the exceptions mentioned in Results, identical to the previously predicted 3' end of scR1 (Felici et al. 1989). However, in contrast to the sequence published previously (Felici et al. 1989), and in agreement with the sequence in the Saccharomyces Genome Database (http://genome-www.stanford.edu/Saccharomyces/), we found an additional two nucleotides, C and A, at positions +363/4, whereas G at position +404 was absent.
Sequence Analysis
Comparison of the SRP core protein sequences to the nuclear localization signals (NLSs) of yeast ribosomal protein L25 characterized previously (amino acids 1–41; Schaap et al. 1991) and mammalian ribosomal protein L23a [beta-like import receptor binding (BIB)] domain, amino acids 32–74; Jäkel and Görlich, 1998) was performed by pairwise sequence alignments using the Baylor College of Medicine search launcher (http://searchlauncher.bcm.tmc.edu). BLOSUM 62 was used as comparison matrix, gap open penalty was set at 12, and gap extension penalty was set at 4.
Miscellaneous
Cells were examined using a fluorescence microscope (Axioskop; ZEISS) equipped with a CCD camera (Microimager; Xillix). Data were processed using the Improvision Openlab and Adobe Photoshop® softwares. All experiments were performed on exponentially growing cells. All shifts to 37°C were performed in glucose-containing rich medium (YPD). DNA manipulations such as restriction analysis, PCR amplification, and ligation were performed according to standard protocols (Sambrook et al. 1989). The anti-SRP antibodies were a gift from P. Walter (University of California at San Francisco, San Francisco, CA).
Online Supplemental Material
The expression level and functionality of the GFP-tagged SRP proteins were analyzed by Western blot and complementation of the srp null strains, respectively. Yeast GFP-tagged SRP proteins were localized in the mtr10-7, sxm1, srp14, and srp68 mutant yeast strains. Two-hybrid analysis was performed using Xpo1p as bait and the individual SRP proteins as preys. The two hybrid plasmids with XPO1 were a gift from F. Stutz (Microbiology Institute, Lausanne, Switzerland). These results and the relevant experimental details are available at http://www.jcb.org/cgi/content/full/153/4/745/DC1.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
|
|
The Core SRP Proteins Use the Same Nuclear Import Receptors as the Ribosomal Proteins
To investigate the nuclear import route of the SRP proteins, their localization was examined in different nucleocytoplasmic transport mutants. A classical nuclear transport mutant is rna1-1, which affects the yeast Ran cycle (Corbett et al. 1995). When these cells were grown at 23°C (the permissive temperature) GFP-tagged SRP proteins exhibited a wild-type localization (i.e., nuclear and cytoplasmic for Sec65p and predominantly nucleolar for the core SRP proteins), but when shifted for 2 h to 37°C the nuclear or nucleolar accumulation was largely abolished with a concominant increase in the cytoplasmic labeling (Fig. 4 A and data not shown). Similarly, nuclear accumulation of SRP proteins was inhibited in the prp20-1 mutant, which is defective in the yeast RanGEF (data not shown). This shows that nuclear import of the SRP proteins requires a functional Ran cycle.
|
), the nucleolar localization of Srp14p, Srp21p, Srp68p, and Srp72p was not affected, showing that the SRP core proteins are not imported by the classical NLS-mediated pathway (Fig. 4 B and data not shown). To identify the potential import receptors, we analyzed the SRP core protein distribution in several importin mutants. Interestingly, nuclear uptake of the core SRP proteins was strongly impaired only in the double mutant strain pse1-1 kap123– (Fig. 4 C and data not shown), which is also defective in the nuclear import of ribosomal proteins (Rout et al. 1997; Schlenstedt et al. 1997). To find out which of the two proteins, Kap123p or Pse1p, is more important for this import route, we also tested SRP protein localization in the single mutant strains pse1-1 or kap123– (Fig. 4D and Fig. E, and data not shown). Except for Srp68p, which was mislocalized in both the pse1-1 or kap123 single mutants, only weak effects were seen for the SRP core proteins in the single mutants, suggesting that both Kap123 and Pse1p are required for efficient nucleolar import of SRP proteins. Normal nucleolar accumulation was observed in other importin mutants, such as the sxm1– (Rosenblum et al. 1997) and mtr10-7 (Senger et al. 1998) strains (data not shown). Nuclear accumulation of Sec65p was also affected in the pse1-1 kap123– mutant and, to a lesser degree, in the sxm1– and mtr10-7 mutants (Fig. 4 C and data not shown). These results suggest that all the core SRP proteins, Srp14p, Srp21p, Srp68, and Srp72p, follow the same transport route as the ribosomal proteins (Rout et al. 1997; Schlenstedt et al. 1997), which is mediated by the importins/karyopherins Pse1p and Kap123p.
The Nuclear Export of the SRP-RNA Is Distinct from mRNA Export and Mediated by Xpo1p
To identify the nuclear export route of scR1, we localized SRP-RNA in strains with an impaired Ran cycle, i.e., the above mentioned rna1-1 and prp20-1 mutant cells (Aebi et al. 1990; Corbett et al. 1995). At permissive temperature, scR1 is exported normally in these cells. In contrast, incubation at the restrictive temperature leads to a nuclear export defect which is only weak in rna1-1 cells, but extensive in prp20-1 cells (Fig. 5 A). These data show that an intact Ran cycle is required for scR1 nuclear export. This might be due to the impairment of SRP core protein nuclear import under these conditions. Alternatively, (an) exportin(s) might be involved in scR1 nuclear export. To address this question, we analyzed mutants in which one of the four yeast exportins, Xpo1p (Stade et al. 1997), Cse1p (Hood and Silver 1998; Künzler and Hurt 1998; Solsbacher et al. 1998), Msn5p (Kaffman et al. 1998), or Los1p, the tRNA exportin (Hellmuth et al. 1998), was absent or mutated. In the los1–, cse1-1, and msn5– mutant cells, the localization of scR1 was normal and indistinguishable from that in wild-type cells, suggesting that the corresponding proteins are not involved in the nuclear export of scR1 (data not shown). However, when scR1 distribution was analyzed in cells expressing the xpo1-1 ts mutant allele, nuclear accumulation of scR1 could be observed in few cells already at the permissive temperature (Fig. 5 B). This defect was dramatically enhanced after shift to 37°C for 5 min, and after 30 min virtually all cells accumulated scR1 inside their nuclei. No mislocalization of scR1 could be detected when an isogenic strain expressing the wild-type XPO1 gene was incubated at 37°C (Fig. 5 B).
|
Recently, a Saccharomyces cerevisiae strain has been constructed, which contains an XPO1 allele sensitive to the drug LMB due to a single amino acid substitution (Neville and Rosbash 1999). In this strain, nuclear export of an NES-containing reporter protein is rapidly inhibited upon LMB addition, whereas nuclear accumulation of poly(A)+ RNA occurs with a delay. This, together with other findings, was taken as evidence to suggest that Xpo1p is not directly involved in the nuclear export of mRNA and that the nuclear accumulation of poly(A)+ RNA in xpo1 mutants is an indirect consequence of impaired nuclear protein export (Hodge et al. 1999; Neville and Rosbash 1999). Therefore, we analyzed nuclear export of scR1 in the LMB-sensitive strain. Strikingly, these cells displayed a prominent nuclear accumulation of scR1 20 min after addition of LMB, whereas under these conditions only weak and infrequent nuclear accumulation of poly(A)+ RNA was observed (Fig. 6). No significant nuclear accumulation could be observed in mock-treated or wild-type cells (Fig. 6). We conclude that nuclear export of scR1 directly involves the NES-export receptor Xpo1p and does not overlap with the mRNA export pathway.
|
, rrp4-1, and rrp44-1. No aberrant localization could be detected in either rrp6 or rrp4-1 mutants (data not shown). However, incubation of the rrp44-1 cells at the restrictive temperature yielded a strong intranuclear accumulation of scR1 in most cells (Fig. 7 A). Strikingly, the site of accumulation did not coincide with the DNA signal but rather appeared to be located directly adjacent to it, suggesting that scR1 might accumulate in the nucleolus. This notion was confirmed when scR1 was localized in rrp44-1 cells expressing GFP-Nop1p: the two signals largely overlapped (Fig. 7 B). Combined with the preferential nucleolar localization of the SRP core proteins, the nucleolar accumulation of scR1 in rrp44-1 cells is suggestive of a role of the nucleolus in SRP biogenesis.
|
|
The Essential Nucleoporin Nsp1p Is Required for SRP-RNA Nuclear Export
To find other factors involved in scR1 nuclear export, we started screening a collection of random yeast ts mutants using the scR1 FISH assay. We identified a ts mutant strain (called srx1-1 for SRP-RNA export), which strongly accumulated scR1 inside the nucleus after the shift to the nonpermissive temperature (Fig. 8 A). The mutated gene in this ts strain which causes inhibiton of scR1 nuclear export was cloned by complementation and found to correspond to the essential nucleoporin Nsp1p (Fig. 8 A and data not shown).
|
/β–dependent SV-40–NLS (pGAD-GFP; Shulga et al. 1996) or full-length Srp1p (yeast importin , Fig. 8 C; Künzler and Hurt 1998). Thus, Nsp1p is required for the nuclear export of scR1. To analyze additional export pathways in this mutant, we localized polyadenylated RNA and tRNA by FISH. Only weak nuclear accumulation of polyadenylated RNA was observed in a subset of srx1-1 mutant cells upon shift to the restrictive temperature, whereas tRNAGlu and tRNAGly did not accumulate (Fig. 8 D). Similarly, no accumulation of GFP-tagged ribosomal protein L25 (Gadal et al. 2001) was observed at the restrictive temperature, suggesting that ribosomal export proceeds unaffected in this mutant (Fig. 8 E).
To find out whether export of other Xpo1p cargoes is also affected in the srx1-1 mutant strain, we analyzed the distribution of two other Xpo1p transport substrates, Yap1p (Yan et al. 1998), a transcription factor for antioxidative genes, and Yrb1p (Künzler et al. 2000), the yeast homologue of mammalian RanBP1. GFP-Yap1p continued to be cytoplasmic and excluded from the nucleus upon shift to the restrictive temperature (Fig. 8 E). GFP-Yrb1p, in contrast, was found to accumulate in the nuclei of a subset of cells after 4 h at the restrictive temperature, a defect that was increased after prolonged incubation at the nonpermissive temperature (Fig. 8 E and data not shown).
In summary, our data suggest that the srx1-1 mutant cells are defective in several nuclear export pathways, including two Xpo1p substrates, whereas nuclear import proceeds normally.
A Subset of Nucleoporins Is Involved in scR1 Nuclear Export
The finding that Nsp1p is required for scR1 nuclear export prompted us to investigate the requirement of NPC components in this process. To confirm our initial finding, we first analyzed two previously described mutant alleles of NSP1, nsp1-L640S, and nsp1-ala6-rep (Wimmer et al. 1992, Wimmer et al. 1993). Although nsp1-L640S accumulated scR1 in a subset of cells at the permissive temperature, this accumulation was lost upon shift to the restrictive temperature (Fig. 9 A and data not shown). The nsp1-ala6-rep mutant strain did not accumulate scR1 at either temperature. As these mutations in nsp1 are known to affect nuclear protein import (Doye and Hurt 1997; Fabre and Hurt 1997), we reasoned that a shift to the restrictive temperature might cause termination of scR1 production, thus accounting for the lack of observable RNA accumulation under these conditions. Therefore, we decided to analyze scR1 distribution in this and the other nucleoporin mutant strains after a shift to the semipermissive temperature of 30°C. Under these conditions, we could see strong nuclear accumulation of scR1 in srx1-1 mutant cells (Fig. 9 A). A similar defect was observed in nsp1-L640S and, less pronounced, in nsp1-ala6-rep mutant cells (Fig. 9 A and data not shown).
|
Another major NPC subcomplex in the cell is the Nup84p complex, consisting of the nucleoporins Nup85p, Nup120p, Sec13p, Seh1p, and Nup145Cp (Siniossoglou et al. 1996, Siniossoglou et al. 2000). We chose nup85-N mutant cells to analyze scR1 distribution upon mutation of a representative member of this complex. No accumulation of scR1 was observed in these cells at the permissive, semi-, or nonpermissive temperatures, although polyadenylated RNA was found to accumulate under the latter two conditions (Fig. 9 B and data not shown).
Taken together, these data provide evidence that a subset of nucleoporins, consisting of Nsp1p and Nup159p, is important for scR1 nuclear export, whereas other nucleoporins, such as Nup85p, seem to be less important. Moreover, different mutant alleles of the nucleoporin Nsp1p show preferential effects on nuclear export and import, respectively.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
The nucleolar localization of the four yeast core SRP proteins, together with the fact that disruption of any of these proteins causes destabilization as well as nuclear accumulation of scR1, strongly suggest that an SRP subparticle (pre-SRP) containing these proteins and scR1 is assembled in the nucleolus, although direct evidence supporting this hypothesis based on localization data is currently lacking. In fact, it is also likely that the core SRP proteins act as RNA chaperones that aid correct folding and stabilization of scR1. The subparticle can only be exported from the nucleus if assembly of scR1 in the pre-SRP is successful.
It is not clear whether Sec65p is a component of the pre-SRP. Although Sec65p is found in both the nucleus and the cytoplasm, its absence affects neither scR1 stability nor export. Thus, the nuclear role of Sec65p in the assembly of an export-competent pre-SRP may only be auxiliary.
An interesting question is how the pre-SRP proteins reach the nucleolus. The protein components of the pre-SRP resemble the ribosomal proteins not only in their overall basic charge and their function in the assembly of a ribonucleoprotein particle, but also in the fact that they use the same nuclear import receptors, Pse1p and Kap123p. Pse1p and Kap123p might, thus, be components of a nucleolar, rather than merely a nuclear, import pathway. Nucleolar factors, or even scR1 or the rRNA nascent transcripts themselves, respectively, may facilitate the release of cargo destined for this compartment, similar to the stimulated release of the yeast protein Npl3p from its nuclear import receptor Mtr10p through RNA binding (Senger et al. 1998).
To identify similarities between the SRP proteins and the NLSs of ribosomal import cargoes characterized previously, we compared the SRP protein sequences to the bipartite NLS of the yeast ribosomal protein L25 (Schaap et al. 1991) and the BIB domain, i.e., NLS, of mammalian ribosomal protein L23a (Jäkel and Görlich 1998) by pairwise sequence alignments. Short, lysine-rich stretches of 
20 residues were found for each of the core proteins that exhibited between 24 and 32% identity to the NLSL25 (data not shown). Although comparison to the BIB domain yielded generally lower homologies, a slightly better match was found when amino acids 22–60 of L25 were used, a sequence stretch that itself displays the highest homology to the BIB domain (59% identity over 39 residues).
The import route for Sec65p is less obvious. Mislocalization of this protein to the cytoplasm in multiple importin mutants suggests that this protein requires the concerted action of several nuclear import pathways for efficient transport. However, it is likewise possible that at least some of the defects are indirect, e.g., in the case of the pse1-1 kap123– mutant due to impaired SRP core protein import.
If the nucleolus is the site of pre-SRP assembly, it should also contain scR1. The fact that we could not detect scR1 in the nucleoli of wild-type cells suggests that the assembly of scR1 into pre-SRP and its subsequent exit from the nucleolus is a rapid event facilitated by the presence of an excess of pre-SRP proteins. In agreement with this idea, certain mutations, e.g., a mutation in an exosome component, can indeed cause accumulation of scR1 in the nucleolus (see also below). Transient nucleolar localization was also observed for mammalian SRP-RNA that had been microinjected into rat kidney cells (Jacobson and Pederson 1998), suggesting that the SRP-RNA found in the nucleolus is not a dead-end product but an intermediate along the SRP-biogenesis pathway. The SRP-RNA is not the only RNA polymerase III transcript found in the nucleolus. Pre-tRNAs as well as components of the tRNA-processing machinery have also been shown to localize within the nucleolus (Bertrand et al. 1998), which also coincided with the site of mature tRNA accumulation upon inhibition of nuclear tRNA export (Grosshans et al. 2000a). It is thus possible that the nucleolus is not only the site of ribosomal biogenesisl, but also presents a stage for Pol III transcript maturation as well as other important biological activities (for review see Lewis and Tollervey 2000; Olson et al. 2000; Pederson and Politz 2000).
Rrp44p (also called Dis3p) is a component of the exosome, a large protein complex that is involved in RNA processing and consists of 10 or 11 proteins in its cytoplasmic and nuclear form, respectively (Noguchi et al. 1996; Mitchell et al. 1997; Allmang et al. 1999b). Most of these proteins have predicted 3'
5' exonuclease activity, and for some of them, including Rrp44p, this has also been experimentally proven. Interestingly, Rrp44p has also been localized in the nucleolus of exponentially growing yeast cells (Shiomi et al. 1998). Rrp44p might thus account for or contribute to the end-trimming of scR1. Indeed, our data are consistent with the hypothesis that mutation of Rrp44p leads to aberrant processing of scR1, i.e., 3' end truncation, possibly due to a deregulation of the exosome, an intriguing observation that we will continue to study.
The correlation between this 3' end shortening and nucleolar accumulation of scR1 in the rrp44-1 mutant cells suggests that an intact 3' end is required for scR1 nuclear export. In both Schizosaccharomyces pombe and mammalian cells, the 3' end of the SRP-RNA is part of the Alu domain, which is required for binding of the SRP9/14 heterodimer. Although it is not clear at present whether the 3' end of scR1 is likewise part of the Alu-like domain to which an Srp14p homodimer was shown to bind (Strub et al. 1999; Mason et al. 2000), the excessive 3' end-trimming we observed in the rrp44-1 mutant might prevent Srp14 from binding. This would ultimately lead to a defect in pre-SRP assembly and nuclear export. In agreement with this idea, the Alu domain of vertebrate SRP-RNA was shown by microinjection experiments to be required for the nuclear export of SRP-RNA (He et al. 1994).
After the nucleolar phase of maturation and assembly into the pre-SRP particle, scR1 has to be exported into the cytoplasm. Our data indicate that Xpo1p is the receptor responsible for this transport step. CRM1, the vertebrate homologue of Xpo1p, mediates export of viral HIV RNA and U snRNAs using NES-containing, RNA-binding proteins as adapters (for review see Görlich and Kutay 1999). Therefore, the SRP-RNA would represent another cellular RNA (the first one in yeast) that can be exported via Xpo1p/CRM1. To mediate SRP nuclear export Xpo1p would have to bind to one of the proteins of the pre-SRP in a Ran-GTP–dependent way. All SRP proteins are quite leucine rich and Srp68p in particular contains two sequences that match perfectly the NES consensus motif L(X)2-3L(X)2-3LXL (Mattaj and Englmeier 1998): 177LEHLKNLSL185 and 409LCKLYFQLFL418 (one letter code, leucines shown in bold). Therefore, these areas could be targets for Xpo1p. However, the fact that absence of any one of the pre-SRP proteins leads to nuclear accumulation of scR1 suggests that SRP export is more complex than simple NES export. Using two-hybrid analysis with Xpo1p as bait and SRP proteins as prey or vice versa, we were unable to detect an interaction between Xpo1p and any individual SRP protein (our unpublished data), suggesting that, indeed, assembly of the core particle is required to expose an active NES. This would efficiently safe-guard against futile rounds of export of SRP proteins not bound to the RNA. Alternatively, an adapter protein, similar to the recently identified PHAX, which is required for CRM1-mediated U snRNA nuclear export (Ohno et al. 2000), might be necessary for scR1 nuclear export.
The involvement of Xpo1p in scR1 nuclear export was also suggested in another report that appeared shortly before this manuscript was submitted (Ciufo and Brown 2000). In agreement with the data presented here, these authors also observed similar localizations for the SRP proteins which they localized by immunofluorescence. In contrast to our observations, these authors, however, reported lack of scR1 mislocalization in rna1-1, prp20-1, or rat7-1 mutant cells. This might be due to the different incubation conditions and/or the detection method for scR1 which these authors used.
As a last step on its way to the cytoplasm, the pre-SRP associated with its export receptor must be translocated through the NPCs. This translocation step requires interactions between the transport factors and nucleoporins (Nups), most often with those that contain FG (Phe-Gly) repeats (Ryan and Wente 2000). Our results suggest that Nsp1p, an phe-x-phe-Gly repeat–containing nucleoporin, might be one of the nucleoporins that mediate the translocation of pre-SRP. Most other known mutant alleles of NSP1 cause only a defect in nuclear protein import (Doye and Hurt 1997; Fabre and Hurt 1997). However, Nsp1p is known to be part of at least two different complexes in yeast, the Nup82p–Nup159p and the Nup49p–Nup57p complexes (Grandi et al. 1995a,Grandi et al. 1995b; Belgareh et al. 1998; Bailer et al. 2000). Although the latter seems to be more important for protein import, mutations in the Nup82p complex components Nup82p, Nup159p, or Nup116p lead to strong nuclear mRNA export, but not protein import, defects. Thus, it is possible that the mutation in the srx1-1 strain is more detrimental to the function of the Nsp1p–Nup82p–Nup159–Nup116p complex. This idea is supported by our observation of a weak intranuclear accumulation of poly(A)+ RNA in the srx1-1 cells at the restrictive temperature, as well as the strong scR1 nuclear export defect present in nup159 (rat7) mutant cells. Interestingly, Nup159p localizes, unlike most other FG repeat nucleoporins, exclusively to the cytoplasmic side of the NPC (Rout et al. 2000). Nup159p might, thus, provide the terminal interaction site between the export receptor and the NPC before release of the export complex into the cytoplasm.
In summary, our data show that biogenesis of the yeast SRP is a complex process that necessitates crossings of the nuclear membrane in both directions. Using the methodology described in this work and in particular our FISH-based assay, we should be able to identify further components of these transport steps. In combination with biochemical analysis, which should address processing of scR1 as well as composition of an export-competent pre-SRP, this should help to fill in the details of the picture outlined here.
|
Acknowledgments |
|---|
Submitted: 27 October 2000
Revised: 27 February 2001
Accepted: 29 March 2001
The online version of this article contains supplemental material.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Aebi M., Clark M.W., Vijayraghavan U. & Abelson J.. A yeast mutant, PRP20, altered in mRNA metabolism and maintenance of the nuclear structure, is defective in a gene homologous to the human gene RCC1, which is involved in the control of chromosome condensation, Mol. Gen. Genet, 224, 1990, 72–80.[Medline]
Allmang C., Kufel J., Chanfreau G., Mitchell P., Petfalski E. & Tollervey D.. Functions of the exosome in rRNA, snoRNA and snRNA synthesis, EMBO (Eur. Mol. Biol. Organ.) J, 18, 1999, 5399–5410a.[Medline]
Allmang C., Petfalski E., Podtelejnikov A., Mann M., Tollervey D. & Mitchell P.. The yeast exosome and human PM-Scl are related complexes of 3' 5' exonucleases, Genes Dev, 13, 1999, 2148–2158b.
Amberg D.C., Goldstein A.L. & Cole C.N.. Isolation and characterization of RAT1an essential gene of Saccharomyces cerevisiae required for the efficient nucleocytoplasmic trafficking of mRNA, Genes Dev., 6, 1992, 1173–1189.
Azuma Y. & Dasso M.. The role of Ran in nuclear function, Curr. Opin. Cell Biol., 12, 2000, 302–307.[Medline]
Bailer S.M., Balduf C., Katahira J., Podtelejnikov A., Rollenhagen C., Mann M., Pante N. & Hurt E.. Nup116p associates with the Nup82p-Nsp1p-Nup159p nucleoporin complex, J. Biol. Chem, 275, 2000, 23540–23548.
Belgareh N., Snay-Hodge C., Pasteau F., Dagher S., Cole C.N. & Doye V.. Functional characterization of a Nup159p-containing nuclear pore subcomplex, Mol. Biol. Cell, 9, 1998, 3475–3492.
Bergès T., Petfalski E., Tollervey D. & Hurt E.C.. Synthetic lethality with fibrillarin identifies NOP77p, a nucleolar protein required for pre-rRNA processing and modification, EMBO (Eur. Mol. Biol. Organ.) J., 13, 1994, 3136–3148.[Medline]
Bertrand E., Houser-Scott F., Kendall A., Singer R.H. & Engelke D.R.. Nucleolar localization of early tRNA processing, Genes Dev., 12, 1998, 2463–2468.
Bousquet-Antonelli C., Presutti C. & Tollervey D.. Identification of a regulated pathway for nuclear pre-mRNA turnover, Cell, 102, 2000, 765–775.[Medline]
Brodsky J.L.. Translocation of proteins across the endoplasmic reticulum membrane, Int. Rev. Cytol., 178, 1998, 277–328.[Medline]
Brown J.D., Hann B.C., Medzihradszky K.F., Niwa M., Burlingame A.L. & Walter P.. Subunits of the Saccharomyces cerevisiae signal recognition particle required for its functional expression, EMBO (Eur. Mol. Biol. Organ.) J., 13, 1994, 4390–4400.[Medline]
Bui N. & Strub K.. New insights into signal recognition and elongation arrest activities of the signal recognition particle, Biol. Chem., 380, 1999, 135–145.[Medline]
Chen Y., Sinha K., Perumal K., Gu J. & Reddy R.. Accurate 3' end processing and adenylation of human signal recognition particle RNA and Alu RNA in vitro, J. Biol. Chem., 273, 1998, 35023–35031.
Ciufo L.F. & Brown J.D.. Nuclear export of yeast signal recognition particle lacking Srp54p by the Xpo1p/Crm1p NES-dependent pathway, Curr. Biol, 10, 2000, 1256–1264.[Medline]
Cole C.N.. mRNA exportthe long and winding road, Nat. Cell Biol, 2, 2000, E55–E58.[Medline]
Corbett A.H., Koepp D.M., Schlenstedt G., Lee M.S., Hopper A.K. & Silver P.A.. Rna1p, a Ran/TC4 GTPase activating protein, is required for nuclear import, J. Cell Biol., 130, 1995, 1017–1026.
Doye V. & Hurt E.C.. From nucleoporins to nuclear pore complexes, Curr. Opin. Cell Biol., 9, 1997, 401–411.[Medline]
Doye V., Wepf R. & Hurt E.C.. A novel nuclear pore protein Nup133p with distinct roles in poly (A)+ RNA transport and nuclear pore distribution, EMBO (Eur. Mol. Biol. Organ.) J., 13, 1994, 6062–6075.[Medline]
Elledge S.J. & Davis R.W.. A family of versatile centromeric vectors designed for use in the sectoring-shuffle mutagenesis assay in Saccharomyces cerevisiae, Gene J., 70, 1988, 303–312.
Fabre E. & Hurt E.. Yeast genetics to dissect the nuclear pore complex and nucleocytoplasmic trafficking, Annu. Rev. Genet., 31, 1997, 277–313.[Medline]
Felici F., Cesareni G. & Hughes J.M.X.. The most abundant small cytoplasmic RNA of Saccharomyces cerevisiae has an important function required for normal cell growth, Mol. Cell. Biol., 9, 1989, 3260–3268.
Gadal O., Strauss D., Kessl J., Trumpower B., Tollervey D. & Hurt E.. Nuclear export of 60S ribosomal subunits depends on Xpo1p and requires a NES-containing factor Nmd3p that associates with the large subunit protein Rpl10p, Mol. Cell. Biol., 21, 2001, 3405–3415.
Görlich D. & Kutay U.. Transport between the cell nucleus and the cytoplasm, Annu. Rev. Cell Dev. Biol., 15, 1999, 607–660.[Medline]
Gorsch L.C., Dockendorff T.C. & Cole C.N.. A conditional allele of the novel repeat-containing yeast nucleoporin RAT7/NUP159 causes both rapid cessation of mRNA export and reversible clustering of nuclear pore complexes, J. Cell Biol., 129, 1995, 939–955.
Grandi P., Emig S., Weise C., Hucho F., Pohl T. & Hurt E.C.. A novel nuclear pore protein Nup82p which specifically binds to a fraction of Nsp1p, J. Cell Biol, 130, 1995, 1263–1273a.
Grandi P., Schlaich N., Tekotte H. & Hurt E.C.. Functional interaction of Nic96p with a core nucleoporin complex consisting of Nsp1p, Nup49p and a novel protein Nup57p, EMBO (Eur. Mol. Biol. Organ.) J., 14, 1995, 76–87b.[Medline]
Grosshans H., Hurt E. & Simos G.. An aminoacylation-dependent nuclear tRNA export pathway in yeast, Genes Dev., 14, 2000, 830–840a.
Grosshans H., Simos G. & Hurt E.. Reviewtransport of tRNA out of the nucleus - direct channeling to the ribosome?, J. Struct. Biol., 129, 2000, 288–294b.[Medline]
Hann B.C. & Walter P.. The signal recognition particle in S. cerevisiae, Cell, 67, 1991, 131–144.[Medline]
He X.-P., Bataillé N. & Fried H.M.. Nuclear export of signal recognition particle RNA is a facilitated process that involves the Alu sequence domain, J. Cell Sci., 107, 1994, 903–912.[Abstract]
Hellmuth K., Lau D.M., Bischoff F.R., Künzler M., Hurt E.C. & Simos G.. Yeast Los1p has properties of an exportin-like nucleocytoplasmic transport factor for tRNA, Mol. Cell. Biol., 18, 1998, 6374–6386.
Hodge C.A., Colot H.V., Stafford P. & Cole C.N.. Rat8p/Dbp5p is a shuttling transport factor that interacts with Rat7p/Nup159p and Gle1p and suppresses the mRNA export defect of xpo1-1 cells, EMBO (Eur. Mol. Biol. Organ.) J., 18, 1999, 5778–5788.[Medline]
Hood J.K. & Silver P.A.. Cse1p is required for export of Srp1p/importin-alpha from the nucleus in Saccharomyces cerevisiae, J. Biol. Chem, 273, 1998, 35142–35146.
Hurt E., Hannus S., Schmelzl B., Lau D., Tollervey D. & Simos G.. A novel in vivo assay reveals inhibition of ribosomal nuclear export in Ran-cycle and nucleoporin mutants, J. Cell Biol., 144, 1999, 389–401.
Jacobson M.R. & Pederson T.. Localization of signal recognition particle RNA in the nucleolus of mammalian cells, Proc. Natl. Acad. Sci. USA, 95, 1998, 7981–7986.
Jäkel S. & Görlich D.. Importin β, transportin, RanBP5 and RanBP7 mediate nuclear import of ribosomal proteins in mammalian cells, EMBO (Eur. Mol. Biol. Organ.) J., 17, 1998, 4491–4502.[Medline]
Kaffman A., Rank N.M., O'Neill E.M., Huang L.S. & O'Shea E.K.. The receptor Msn5 exports the phosphorylated transcription factor Pho4 out of the nucleus, Nature, 396, 1998, 482–486.[Medline]
Kalies K.U. & Hartmann E.. Protein translocation into the endoplasmic reticulum (ER)--two similar routes with different modes, Eur. J. Biochem., 254, 1998, 1–5.[Medline]
Künzler M. & Hurt E.C.. Cse1p functions as the nuclear export receptor for importin in yeast, FEBS Lett., 433, 1998, 185–190.[Medline]
Künzler M., Gerstberger T., Stutz F., Bischoff F.R. & Hurt E.. Yeast Ran-binding protein 1 (Yrb1) shuttles between the nucleus and cytoplasm and is exported from the nucleus via a CRM1 (XPO1)-dependent pathway, Mol. Cell. Biol., 20, 2000, 4295–4308.
Lewis J.D. & Tollervey D.. Like attracts likegetting RNA processing together in the nucleus, Science, 288, 2000, 1385–1389.
Li Z., Pandit S. & Deutscher M.P.. Polyadenylation of stable RNA precursors in vivo, Proc. Natl Acad. Sci. USA, 95, 1998, 12158–12162.
Loeb J.D., Schlenstedt G., Pellman D., Kornitzer D., Silver P.A. & Fink G.R.. The yeast nuclear import receptor is required for mitosis, Proc. Natl. Acad. Sci. USA, 92, 1995, 7647–7651.
Mason N., Ciufo L.F. & Brown J.D.. Elongation arrest is a physiologically important function of signal recognition particle, EMBO (Eur. Mol. Biol. Organ.) J., 19, 2000, 4164–4174.[Medline]
Mattaj I.W. & Englmeier L.. Nucleocytoplasmic transportthe soluble phase, Annu. Rev. Biochem., 67, 1998, 265–306.[Medline]
Mitchell P. & Tollervey D.. Musing on the structural organization of the exosome complex, Nat. Struct. Biol, 7, 2000, 843–846.[Medline]
Mitchell P., Petfalski E. & Tollervey D.. The 3' end of yeast 5.8S rRNA is generated by an exonuclease processing mechanism, Genes Dev., 10, 1996, 502–513.
Mitchell P., Petfalski E., Shevchenko A., Mann M. & Tollervey D.. The exosomea conserved eukaryotic RNA processing complex containing multiple 3' 5' exoribonucleases, Cell, 91, 1997, 457–466.[Medline]
Nakielny S. & Dreyfuss G.. Transport of proteins and RNAs in and out of the nucleus, Cell, 99, 1999, 677–690.[Medline]
Nehrbass U., Fabre E., Dihlmann S., Herth W. & Hurt E.C.. Analysis of nucleo-cytoplasmic transport in a thermosensitive mutant of the nuclear pore protein NSP1, Eur. J. Cell Biol., 62, 1993, 1–12.[Medline]
Neville M. & Rosbash M.. The NES-Crm1p export pathway is not a major mRNA export route in Saccharomyces cerevisiae, EMBO (Eur. Mol. Biol. Organ.) J., 18, 1999, 3746–3756.[Medline]
Ng D.T., Brown J.D. & Walter P.. Signal sequences specify the targeting route to the endoplasmic reticulum membrane, J. Cell Biol., 134, 1996, 269–278.
Noguchi E., Hayashi N., Azuma Y., Seki T., Nakamura M., Nakashima N., Yanagida M., He X., Mueller U., Sazer S. & Nishimoto T.. Dis3, implicated in mitotic control, binds directly to Ran and enhances the GEF activity of RCC1, EMBO (Eur. Mol. Biol. Organ.) J, 15, 1996, 5595–5605.[Medline]
Ogg S.C. & Walter P.. SRP samples nascent chains for the presence of signal sequences by interacting with ribosomes at a discrete step during translation elongation, Cell, 81, 1995, 1075–1084.[Medline]
Ohno M., Segref A., Bachi A., Wilm M. & Mattaj I.W.. PHAX, a mediator of U snRNA nuclear export whose activity is regulated by phosphorylation, Cell, 101, 2000, 187–198.[Medline]
Olson M.O., Dundr M. & Szebeni A.. The nucleolusan old factory with unexpected capabilities, Trends Cell Biol, 10, 2000, 189–196.[Medline]
Pederson T. & Politz J.C.. The nucleolus and the four ribonucleoproteins of translation, J. Cell Biol, 148, 2000, 1091–1095.
Politz J.C., Yarovoi S., Kilroy S.M., Gowda K., Zwieb C. & Pederson T.. Signal recognition particle components in the nucleolus, Proc. Natl. Acad. Sci. USA, 97, 2000, 55–60.
Rosenblum J.S., Pemberton L.F. & Blobel G.. A nuclear import pathway for a protein involved in tRNA maturation, J. Cell Biol., 139, 1997, 1655–1661.
Rout M.P., Blobel G. & Aitchison J.D.. A distinct nuclear import pathway used by ribosomal proteins, Cell, 89, 1997, 715–725.[Medline]
Rout M.P., Aitchison J.D., Suprapto A., Hjertaas K., Zhao Y. & Chait B.T.. The yeast nuclear pore complexcomposition, architecture, and transport mechanism, J. Cell Biol., 148, 2000, 635–651.
Ryan K.J. & Wente S.R.. The nuclear pore complexa protein machine bridging the nucleus and cytoplasm, Curr. Opin. Cell Biol., 12, 2000, 361–371.[Medline]
Sambrook J., Fritsch E.T. & Maniatis T., Molecular Cloning, 1989, Cold Spring Harbor Laboratory Press, , Cold Spring Harbor, NY.
Schaap P.J., Van't Riet J., Woldringh C.L. & Raué H.A.. Identification and functional analysis of the nuclear localization signals of ribosomal protein L25 from Saccharomyces cerevisiae, J. Mol. Biol, 221, 1991, 225–237.[Medline]
Schlenstedt G., Smirnova E., Deane R., Solsbacher J., Kutay U., Görlich D., Ponstingl H. & Bischoff F.R.. Yrb4p, a yeast Ran-GTP-binding protein involved in import of ribosomal protein L25 into the nucleus, EMBO (Eur. Mol. Biol. Organ.) J., 16, 1997, 6237–6249.[Medline]
Seedorf M. & Silver P.A.. Importin/karyopherin protein family members required for mRNA export from the nucleus, Proc. Natl. Acad. Sci. USA, 94, 1997, 8590–8595.
Segref A., Sharma K., Doye V., Hellwig A., Huber J. & Hurt E.C.. Mex67p which is an essential factor for nuclear mRNA export binds to both poly(A)+ RNA and nuclear pores, EMBO (Eur. Mol. Biol. Organ.) J., 16, 1997, 3256–3271.[Medline]
Senger B., Simos G., Bischoff F.R., Podtelejnikov A.V., Mann M. & Hurt E.C.. Mtr10p functions as a nuclear import receptor for the mRNA binding protein Npl3p, EMBO (Eur. Mol. Biol. Organ.) J., 17, 1998, 2196–2207.[Medline]
Sharma K., Fabre E., Tekotte H., Hurt E.C. & Tollervey D.. Yeast nucleoporin mutants are defective in pre-tRNA splicing, Mol. Cell. Biol., 16, 1996, 294–301.[Abstract]
Shiomi T., Fukushima K., Suzuki N., Nakashima N., Noguchi E. & Nishimoto T.. Human dis3p, which binds to either GTP- or GDP-Ran, complements Saccharomyces cerevisiae dis3, J. Biochem. (Tokyo), 123, 1998, 883–890[published erratum at 124:250].
Shulga N., Roberts P., Gu Z., Spitz L., Tabb M.M., Nomura M. & Goldfarb D.S.. In vivo nuclear transport kinetics in Saccharomyces cerevisiaea role for Hsp70 during targeting and translocation, J. Cell Biol, 135, 1996, 329–339.
Sikorski R.S. & Hieter R.. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae, Genetics, 122, 1989, 19–27.
Sinha K.M., Gu J., Chen Y. & Reddy R.. Adenylation of small RNAs in human cells. Development of a cell-free system for accurate adenylation on the 3'-end of human signal recognition particle RNA, J. Biol. Chem., 273, 1998, 6853–6859.
Sinha K., Perumal K., Chen Y. & Reddy R.. Post-transcriptional adenylation of signal recognition particle RNA is carried out by an enzyme different from mRNA Poly(A) polymerase, J. Biol. Chem., 274, 1999, 30826–30831.
Siniossoglou S., Wimmer C., Rieger M., Doye V., Tekotte H., Weise C., Emig S., Segref A. & Hurt E.C.. A novel complex of nucleoporins, which includes Sec13p and a Sec13p homolog, is essential for normal nuclear pores, Cell, 84, 1996, 265–275.[Medline]
Siniossoglou S., Lutzmann M., Santos-Rosa H., Leonard K., Mueller S., Aebi U. & Hurt E.. Structure and assembly of the Nup84p complex, J. Cell Biol, 149, 2000, 41–54.
Solsbacher J., Maurer P., Bischoff F.R. & Schlenstedt G.. Cse1p is involved in export of yeast importin alpha from the nucleus, Mol. Cell. Biol, 18, 1998, 6805–6815.
Stade K., Ford C.S., Guthrie C. & Weis K.. Exportin 1 (Crm1p) is an essential nuclear export factor, Cell, 90, 1997, 1041–1050.[Medline]
Stirling C.J. & Hewitt E.W.. The S. cerevisiae SEC65 gene encodes a component of yeast signal recognition particle with homology to human SRP19, Nature, 356, 1992, 534–537.[Medline]
Strässer K. & Hurt E.. Nuclear RNA export in yeast, FEBS Lett., 452, 1999, 77–81.[Medline]
Strässer K., Bassler J. & Hurt E.. Binding of the Mex67p/Mtr2p heterodimer to FXFG, GLFG, and FG repeat nucleoporins is essential for nuclear mRNA export, J. Cell Biol., 150, 2000, 695–706.
Stroud R.M. & Walter P.. Signal sequence recognition and protein targeting, Curr. Opin. Struct. Biol., 9, 1999, 754–759.[Medline]
Strub K., Fornallaz M. & Bui N.. The Alu domain homolog of the yeast signal recognition particle consists of an Srp14p homodimer and a yeast-specific RNA structure, RNA, 5, 1999, 1333–1347.[Abstract]
van Hoof A., Lennertz P. & Parker R.. Yeast exosome mutants accumulate 3'-extended polyadenylated forms of U4 small nuclear RNA and small nucleolar RNAs, Mol. Cell. Biol., 20, 2000, 441–452.
Wimmer C., Doye V., Grandi P., Nehrbass U. & Hurt E.. A new subclass of nucleoporins that functionally interacts with nuclear pore protein NSP1, EMBO (Eur. Mol. Biol. Organ.) J., 11, 1992, 5051–5061.[Medline]
Wimmer C., Doye V., Nehrbass U., Schlaich N. & Hurt E.C.. Approaches towards a genetic analysis of the nuclear pore complex in yeast, Brown A.J.P., Tuite M.F. & McCarthy J.E.G., Protein Synthesis and Targeting in Yeast. Vol. H 71, 1993, 269–281, Springer-Verlag, Berlin/Heidelberg, Germany.
Yan C., Lee L.H. & Davis L.I.. Crm1p mediates regulated nuclear export of a yeast AP-1-like transcription factor, EMBO (Eur. Mol. Biol. Organ.) J, 17, 1998, 7416–7429.[Medline]
Zhou Z., Luo M., Strässer K., Katahira J., Hurt E. & Reed R.. The protein Aly links pre-messenger-RNA splicing to nuclear export in metazoans, Nature, 407, 2000, 401–405.[Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Facebook 
Reddit 
Technorati 
Twitter What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|
