|
||
© The Rockefeller University Press,
0021-9525/2001/7/25 $5.00
The Journal of Cell Biology, Volume 154, Number 1, July 9, 2001 25-32
Report |
ZNF265a novel spliceosomal protein able to induce alternative splicing
Address correspondence to Brian J. Morris, D.Sc., Basic & Clinical Genomics Laboratory, Department of Physiology and Institute for Biomedical Research, Bldg F13, The University of Sydney, NSW 2006, Australia. Tel.: 61-2-9351-3688. Fax: 61-2-9351-2227. E-mail: brianm{at}physiol.usyd.edu.au
| Abstract |
|---|
|
|
|---|
The formation of the active spliceosome, its recruitment to active areas of transcription, and its role in pre-mRNA splicing depends on the association of a number of multifunctional serine/arginine-rich (SR) proteins. ZNF265 is an arginine/serine-rich (RS) domain containing zinc finger protein with conserved pre-mRNA splicing protein motifs. Here we show that ZNF265 immunoprecipitates from splicing extracts in association with mRNA, and that it is able to alter splicing patterns of Tra2-ß1 transcripts in a dose-dependent manner in HEK 293 cells. Yeast two-hybrid analysis and immunoprecipitation indicated interaction of ZNF265 with the essential splicing factor proteins U1-70K and U2AF35. Confocal microscopy demonstrated colocalization of ZNF265 with the motor neuron gene product SMN, the snRNP protein U1-70K, the SR protein SC35, and with the transcriptosomal components p300 and YY1. Transfection of HT-1080 cells with ZNF265EGFP fusion constructs showed that nuclear localization of ZNF265 required the RS domain. Alignment with other RS domaincontaining proteins revealed a high degree of SR dipeptide conservation. These data show that ZNF265 functions as a novel component of the mRNA processing machinery.
Key Words: zinc finger protein; RS domain; SR proteins; RNA processing; nuclear localization; renin
| Introduction |
|---|
|
|
|---|
RS domains mediate proteinprotein interactions with other general splicing factors during the formation of the spliceosome. By yeast two-hybrid for example, interactions of the SR proteins SC35 and SF2/ASF with both U1-70K and U2AF35 have been documented, the latter two proteins functionally binding to the 5' and 3' splice sites, respectively, in early splicing complexes (Wu and Maniatis, 1993; Cao and Garcia-Blanco, 1998). Binding of SR proteins to exonic splicing enhancers generally stimulates splicing (Sun et al., 1993; Dirksen et al., 1994; Liu et al., 1998, 2000; reviewed in Blencowe, 2000), but antagonism of splice site recognition has also been observed (Labourier et al., 1999; Barnard and Patton, 2000). Many of the functions of SR proteins are facilitated by a meshwork of interacting factors that promote the passage of the splicing reaction and participate in postsplicing processes such as mRNA transport, which appears to be coupled to splicing (Cáceres et al., 1998; Belshan et al., 2000).
ZNF265 (formally termed "Zis") is a zinc finger and RS domaincontaining protein (Karginova et al., 1997; Adams et al., 2000) that was first identified, along with renin, because of its modulated expression in differentiating renal juxtaglomerular cells (Karginova et al., 1997); it is now known to be expressed by most tissues, especially early in development (Adams et al., 2000). We have also found that the nuclear magnetic resonance solution structure of the zinc fingers accords with RNA binding (Plambeck, C.A., D.J. Adams., L. van der Weyden., J.P. Mackay, and B.J. Morris. 22nd Ann. Conf. Org. Express. Genome. 2001. Abstr. 228). Therefore, we explored the function of ZNF265 by demonstrating its localization within cells, identifying the other proteins that it binds to in splicing complexes, and showing its potential to modulate alternative splicing in cells.
| Results and discussion |
|---|
|
|
|---|
|
|
|
Alignment of the RS domain of ZNF265 with that of other RS domaincontaining spliceosomal proteins (Fig. 4) showed strong SR dipeptide conservation; this was particularly evident between ZNF265, SC35, and SRp40. The aligned region of SC35 contains the putative RS domain NLS, RRRRRSRSRSRSRSRSRSRSRYSRSKSRSR-TRSRSRSTSKSRS (Hedley et al., 1995).
|
In vitro splicing reactions showed that ZNF265 is immunoprecipitated in a complex that includes spliced mRNA (Fig. 5 A). This result indicates that ZNF265 binds directly or indirectly to mRNA, but much less to pre-mRNA. This property is shared with other splicing factors, such as SF2/ASF and RNPS1 (Hanamura et al., 1998; Mayeda et al., 1999), both of which synergistically stimulate general splicing. Here we show in splicing assays in cultured cells that ZNF265 can regulate alternative splicing in a concentration-dependent manner (Fig. 5 B). Namely, overexpression of ZNF265 resulted in exclusion of exons 2 and 3 from the Tra2-ß1 pre-mRNA, which led to an increase in the production of the ß3 alternatively spliced isoform. Our in vivo splicing result suggests that ZNF265 may have the ability to antagonize the alternative splicing activity of SR proteins on Tra2-ß1 pre-mRNA. Splicing factor SR protein-mediated antagonism of alternative 5' splice site selection has been reported for human hnRNP A1 protein in that hnRNP A1 causes activation of distal alternative 5' splice site and exon exclusion in vitro and in vivo (Mayeda and Krainer, 1992; Mayeda et al., 1993; Cáceres et al., 1994; Yang et al., 1994). In contrast to hnRNP A1 that does not cause inhibition of general constitutive splicing, we have shown that addition of recombinant ZNF265 to SR protein-deficient HeLa cell S100 extracts supplemented with recombinant SF2/ASF may antagonize constitutive splicing of a ß-globin pre-mRNA substrate and repress its splicing (our unpublished data). In Drosophila, RSF1 protein antagonizes and represses splicing by binding to SF2/ASF and preventing it from interacting with U1-70K (Labourier et al., 1999). It is possible that ZNF265 may also interfere with SF2/ASF-mediated constitutive splicing by binding directly to U1-70K.
|
In conclusion, we have shown that ZNF265 colocalizes with the spliceosome, associates with mRNA and essential splicing factors U1-70K and U2AF35, and can regulate alternative splicing of the Tra2-ß1 pre-mRNA. Therefore, ZNF265 is a functional component of the RNA processing machinery.
| Materials and methods |
|---|
|
|
|---|
Antibodies
ZNF265 polyclonal antibodies (produced for us by Alpha Diagnostics) were generated by inoculating New Zealand white rabbits with a keyhole limpet hemocyanintagged peptide (CEDEDLSKYKLDEDED) corresponding to amino acids 160174 of ZNF265 (GenBank/EMBL/DDBJ accession no. NP005446). Antiserum was affinity purified by column chromatography using antigen peptide immobilized on Sepharose-4B beads. Monoclonal SC35, p300, and YY1 antibodies were from PharMingen, Calbiochem, and Santa Cruz Biotechnology, Inc., respectively. Monoclonal SMN antibody (clone 11F3) was provided by Dr. G.E. Morris (MIRC Biotechnology Group, North East Wales Institute, Wrexham, UK), monoclonal Sm antibody (Lerner et al., 1981) was provided by Dr. A.I. Lammond (University of Dundee, Dundee, UK), monoclonal hnRNP-AI antibody (mAb9H10) was provided by Dr. G. Dreyfuss (Howard Hughes Medical Institute, University of Pennsylvania, Philadelphia, PA), and polyclonal U2AF35 (Zuo and Maniatis, 1996) and monoclonal U1-70K (Wu and Maniatis, 1993) were provided by Dr. T. Maniatis (Harvard University, Boston, MA). The SF2/ASF (mAb96) antibody used has been described previously (Hanamura et al., 1998). Secondary antibodies used were: Alexa Fluor 488conjugated goat antimouse IgG (Molecular Probes), Alexa Fluor 594conjugated goat antirabbit IgG (Molecular Probes), alkaline phosphataseconjugated rabbit antimouse IgG (Sigma-Aldrich), and alkaline phosphataseconjugated goat antirabbit IgG (Sigma-Aldrich).
Fluorescence, indirect immunofluorescence, and imaging
In preparation for visualization of fluorescence, cells were cultured on Lab-Tek chamber slides (Nunc) and fixed with 2% paraformaldehyde in situ. The cells were then permeablized with 0.5% (vol/vol) Triton X-100 in PBS for 1 h before being blocked overnight with 5% (vol/vol) goat serum in PBS. After sequential 45 min incubations at 37°C with the primary and secondary antibodies, the cells were stained with 300 nM DAPI (Molecular Probes) before being mounted with DABCO in PBS (Johnson et al., 1982). For localization studies using the ZNF265enhanced green fluorescent protein (EGFP) fusion constructs, HT-1080 cells were transfected using SuperFect (QIAGEN) on Lab-Tek chamber slides and then fixed, DAPI stained, and mounted (as described above). Two-channel fluorescent images of the cells were acquired using a 12-bit cooled CCD camera (Sensicam) attached to an epifluorescent microscope (model E800; Nikon). For ZNF265 colocalization studies, three-channel fluorescent images were acquired on a Two Photon Imaging System (TCS MP; Leica) combined with a confocal microscope (TCS SP; Spectral). Both Alexa 488 and Alexa 594 were excited using the 488 line of an argon laser, whereas DAPI was excited in two-photon mode. Sequential scan Z-sections were obtained at 0.2 µm intervals, and projections through the Z-stack were created using confocal software (Leica). Colocalization scatter diagrams were created to confirm and quantify visual interpretation of single Z-sections and digitally projected images. All immunofluorescent images shown are representative of three independent experiments in which >95% of at least 500 cells assessed exhibited the same morphological pattern.
Plasmid constructs and subcloning
Full-length ZNF265 cDNA was amplified by RT-PCR and subcloned into pGEM T-Easy (Promega) to create the plasmid pZNFA (Adams et al., 2000). pZNFA was used as a template for PCR using primers ZNF-5'A (ctcgagtatgtcgaccaagaatttccgactc), which incorporates a 5' XhoI site, and ZNF-3'A (cgcgttcgaagctctcccatatg). The resulting fragment was subcloned into pEGFP-C2 vector (CLONTECH Laboratories, Inc.) to generate C2-ZNF265, an in-frame fusion protein between ZNF265 and EGFP. PCR was used to obtain various domains of ZNF265 as EGFP fusion clones using C2-EGFPpEGFP-C2. Plasmid constructs and PCR primers used were: C2-Mut2 (first 96 amino acids of ZNF265), primers ZNF-5'A and ZNF-3'B (ttatttagcatactttggagtatta); C2-Mut3 (zinc finger domains and NLS), primers ZNF-5'A and ZNF-3'C (gatcttcatccttcatccctc); C2-Mut4 (NLS and RS domains), primers ZNF-5'B (ctcgagagaatctgatggtgaatatgatg) and ZNF-3'A; C2-Mut5 (RS domain alone), primers ZNF-5'C, and ZNF-3'B (ctcgagagaatcagagggagaagaagagg). PCR (PCR Supermix High Fidelity; GIBCO BRL) consisted of 35 cycles of 95, 60, and 68°C for 1 min each, followed by 10 min at 68°C. C2-Mut6 (residues, RKKKK
AAAAA) was generated from C2-ZNF265 using primers NLS5' (gatggtgaatatgatgagtttggagctgcagcggcagcatacagagggaaagcagttgg) and NLS3' (ccaactgctttccctctgtatgctgccgctgcagctcca-aactcatcatattcaccatc), which destroyed the core sequence of this putative NLS. PCR was as above except that annealing was at 50°C, followed by digestion with 30 U of DpnI for 3 h. Clones were sequenced to confirm that the mutation had been introduced correctly. The ZNF265 yeast two-hybrid construct (pGBKT7-ZNF265) was generated by subcloning a BamHI-PstI fragment of the 1-kb PCR product amplified using the primers ZNF-3'A and ZNF-5'D (ggatccttatgtcgaccaagaatttccgagt), with clone ZNFA as template, into pGBKT7 vector (CLONTECH Laboratories, Inc.). DNA binding domain (pAct-BD) plasmids were provided by Drs. N. Hastie, R. Davies (MRC, Edinburgh, UK), and D. Elliot (University of Newcastle, Newcastle, UK) (Davies et al., 1998; Elliott et al., 2000).
Western blot analyses and immunoprecipitation
Calu-6, HT-1080, and HepG2 cells (4 x 105) were washed with PBS before being scraped off the flask and electrophoresed through a 12% SDS-PAGE gel (Laemmli, 1970). Proteins were then electroblotted onto polyvinylfluoride membrane (Gelman), blocked overnight in 5% skim milk, and incubated with ZNF265 antibody (1:250) for 2.5 h at 22°C, followed by goat antirabbit IgG (1:30,000) for another 2.5 h. Immunocomplexes were visualized by incubation of membrane in BCIP-NBT solution (FAST tablets; Sigma-Aldrich) for 5 min. For immunoprecipitations, HeLa cell nuclear extracts (100 µg/ml) (Dignam et al., 1983) were incubated with ZNF265 antibody in 1 ml TNE buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 0.15 M NaCl, 0.05% Nonidet P-40) for 2 h at 22°C. Protein G agarose (50% vol/vol in PBS; Roche) was added and the samples were rocked for 2 h at 22°C before being washed in TNE buffer. The samples were then analysed by Western blotting (as described above) using a rabbit anti-U2AF35 antibody (1:350) or mouse antiU1-70K antibody (1:250).
Yeast culture and two-hybrid assay
Budding Saccharomyces cerevisiae strain AH109 (James et al., 1996) were cultured in YPAD (1% wt/vol yeast extract, 2% wt/vol peptone, 0.003% adenine, 2% wt/vol dextrose) and transformed sequentially (Gietz and Schiestl, 1991), first with pGBKT7ZNF265, then with the appropriate activation domain plasmid. The yeast were then plated onto synthetic defined medium deficient in leucine, tryptophan, histidine, and adenine (SD-L-W-H-A), supplemented with kanamycin (30 µg/ml), and incubated at 30°C for 1 wk. The transformants were then analyzed for ß-galactosidase (ß-gal) expression by both filter assay (Turner and Crossley, 1998) and liquid assay (Galacton-Light Plus Kit; Tropix) (Asoh et al., 1998). Screening of the fetal brain cDNA library with ZNF265 as "bait" used S. cerevisiae strain AH109 (James et al., 1996) and Y187 (Harper et al., 1993). The bait ZNF265 plasmid was transformed into AH109, and the library plasmids were supplied pretransformed into Y187 (MATCHMAKER System 3; CLONTECH Laboratories, Inc.). At least 3.5 x 106 individual library plasmids were screened based on the ability of the transformed yeast to grow on SD-L-W-A-H plates and express ß-gal. Library plasmids from 40 positive interactions were rescued from the yeast and sequenced.
In vitro and in vivo splicing and immunoprecipitation of splicing complexes
m7GpppG-capped 32P-labeled pre-mRNA substrates were made by runoff transcription of linearized template DNA with SP6 RNA polymerase (Mayeda et al., 1999). ß-Globin plasmid pSP64-Hß
6, used for in vitro transcription, has been described previously (Krainer et al., 1984). HeLa cell nuclear extracts were made as reported previously (Mayeda and Krainer, 1999). Immunoprecipitation of the products of in vitro splicing reactions was performed according to Hanamura et al.'s method (1998). The RNA products of the immunoprecipitates were analyzed by electrophoresis on a 5.5% polyacrylamide/7 M urea gel, followed by autoradiography.
Additional splicing assays were performed essentially as described in Stoss et al. (1999). Human transformer-2-ß1 (Tra2-ß1) minigene (Nayler et al., 1998) and C2-ZNF265 expression plasmids were transfected into HEK293 cells. After RNA isolation and reverse transcription (Hartmann et al., 1999), PCR to amplify minigene products was performed thus: 35 cycles of 94°C for 15 s, 65°C for 20 s, and 72°C for 40 s (Daoud et al., 1999). The resulting splicing pattern was quantified using the Herolab EASY system.
| Footnotes |
|---|
| Acknowledgments |
|---|
This work was funded by grants from the Australian Research Council (to B.J. Morris), the Lucille P. Markey Trust (to A. Mayeda), the Deutsche Forschungsgemeinschaft (to S. Stamm), and the National Health and Medical Research Council of Australia (to J.E.J. Rasko).
Submitted: 16 October 2000
Revised: 23 May 2001
Accepted: 30 May 2001
| References |
|---|
|
|
|---|
Adams, D.J., L. van der Weyden, A. Kovacic, F.J. Lovicu, N.G. Copeland, D.J. Gilbert, N.A. Jenkins, P.A. Ioannou, and B.J. Morris. 2000. Chromosomal localization and characterization of the mouse and human zinc finger protein 265 gene. Cytogenet. Cell Genet. 88:6873.[Medline]
Asoh, S., K. Nishimaki, R. Nanbu-Wakao, and S. Ohta. 1998. A trace amount of the human pro-apoptotic factor Bax induces bacterial death accompanied by damage of DNA. J. Biol. Chem. 273:1138411391.
Bannister, A.J., and T. Kouzarides. 1996. The CBP co-activator is a histone acetyltransferase. Nature. 384:641643.[Medline]
Belshan, M., G.S. Park, P. Bilodeau, C.M. Stoltzfus, and S. Carpenter. 2000. Binding of equine infectious anemia virus rev to an exon splicing enhancer mediates alternative splicing and nuclear export of viral mRNAs. Mol. Cell. Biol. 20:35503557.
Barnard, D.C., and J.G. Patton. 2000. Identification and characterization of a novel serinearginine-rich splicing regulatory protein. Mol. Cell. Biol. 20:30493057.
Blencowe, B.J. 2000. Exonic splicing enhancers: mechanism of action, diversity and role in human genetic diseases. Trends Biochem. Sci. 25:106110.[Medline]
Cáceres, J.F., S. Stamm, D.M. Helfman, and A.R. Krainer. 1994. Regulation of alternative splicing in vivo by overexpression of antagonistic splicing factors. Science. 265:17061709.
Cáceres, J.F., T. Misteli, G.R. Screaton, D.L. Spector, and A.R. Krainer. 1997. Role of the modular domains of SR proteins in subnuclear localization and alternative splicing specificity. J. Cell Biol. 138:225238.
Cáceres, J.F., G.R. Screaton, and A.R. Krainer. 1998. A specific subset of SR proteins shuttles continuously between the nucleus and the cytoplasm. Genes Dev. 12:5566.
Cao, W., and M.A. Garcia-Blanco. 1998. A serine/arginine-rich domain in the human U1 70k protein is necessary and sufficient for ASF/SF2 binding. J. Biol. Chem. 273:2062920635.
Colwill, K., T. Pawson, B. Andrews, J. Prasad, J.L. Manley, J.C. Bell, and P.I. Duncan. 1996. The Clk/Sty protein kinase phosphorylates SR splicing factors and regulates their intranuclear distribution. EMBO (Eur. Mol. Biol. Organ.) J. 15:265275.[Medline]
Corden, J.L., and M. Patturajan. 1997. A CTD function linking transcription to splicing. Trends Biochem. Sci. 22:413416.[Medline]
Daoud, R., M. Berzaghi, F. Siedler, M. Hübener, and S. Stamm. 1999. Activity-dependent regulation of alternative splicing patterns in the rat brain. Eur. J. Neurosci. 11:788802.[Medline]
Davies, R.C., C. Calvio, E. Bratt, S.H. Larsson, A.I. Lamond, and N.D. Hastie. 1998. WT1 interacts with the splicing factor U2AF65 in an isoform-dependent manner and can be incorporated into spliceosomes. Genes Dev. 12:32173225.
Dignam, J.D., R.M. Lebovitz, and R.G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:14751489.
Dirksen, W.P., R.K. Hampson, Q. Sun, and F.M. Rottman. 1994. A purine-rich exon sequence enhances alternative splicing of bovine growth hormone pre-mRNA. J. Biol. Chem. 269:64316436.
Du, L., and S.L. Warren. 1997. A functional interaction between the COOH-terminal domain of RNA polymerase II and pre-mRNA splicing. J. Cell Biol. 136:518.
Elliott, D.J., C.F. Bourgeois, A. Klink, J. Stevenin, and H.J. Cooke. 2000. A mammalian germ cell-specific RNA-binding protein interacts with ubiquitously expressed proteins involved in splice site selection. Proc. Natl. Acad. Sci. USA. 97:57175722.
Fu, X.D. 1995. The superfamily of arginine/serine-rich splicing factors. RNA. 1:663680.[Medline]
Gietz, R.D., and R.H. Schiestl. 1991. Applications of high efficiency lithium acetate transformation of intact yeast cells using single-stranded nucleic acids as carrier. Yeast. 7:253263.[Medline]
Harper, J.W., G.R. Adami, N. Wei, K. Keyomarsi, and S.J. Elledge. 1993. The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell. 75:805816.[Medline]
Hartmann, A.M., O. Nayler, F.W. Schwaiger, A. Obermeier, and S. Stamm. 1999. The interaction and colocalisation of SAM68 with the splicing associated factor YT521-B in nuclear dots is regulated by the Src family kinase p59fyn. Mol. Biol. Cell. 10:39093926.
Hanamura, A., J.F. Cáceres, A. Mayeda, B.R. Franza, and A.R. Krainer. 1998. Regulated tissue-specific expression of antagonistic pre-mRNA splicing factors. RNA. 4:430444.[Abstract]
Hedley, M.L., H. Amrein, and T. Maniatis. 1995. An amino acid sequence motif sufficient for subnuclear localization of an arginine/serine-rich splicing factor. Proc. Natl. Acad. Sci. USA. 92:1152411528.
James, P., J. Halladay, and E.A. Craig. 1996. Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics. 144:14251436.[Abstract]
Johnson, G.D., R.S. Davidson, K.C. McNamee, G. Russell, D. Goodwin, and E.J. Holborow. 1982. Fading of immunofluorescence during microscopy: a study of the phenomenon and its remedy. J. Immunol. Methods. 55:231242.[Medline]
Karginova, E.A., E.S. Pentz, I.G. Kazakova, V.F. Norwood, R.M. Carey, and R.A. Gomez. 1997. Zis: a developmentally regulated gene expressed in juxtaglomerular cells. Am. J. Physiol. 273:F731F738.
Kim, E., L. Du, D.B. Bregman, and S.L. Warren. 1997. Splicing factors associate with hyperphosphorylated RNA polymerase II in the absence of pre-mRNA. J. Cell Biol. 136:1928.
Krainer, A.R., T. Maniatis, B. Ruskin, and M.R. Green. 1984. Normal and mutant human ß-globin pre-mRNAs are faithfully and efficiently spliced in vitro. Cell. 36:9931005.[Medline]
Labourier, E., H.M. Bourbon, I.E. Gallouzi, M. Fostier, E. Allemand, and J. Tazi. 1999. Antagonism between RSF1 and SR proteins for both splice-site recognition in vitro and Drosophila development. Genes Dev. 13:740753.
Ladomery, M., R. Marshall, L. Arif, and J. Sommerville. 2000. C4SR, a novel zinc-finger protein with SR-repeats, is expressed during early development of Xenopus. Gene. 256:293302.[Medline]
Laemmli, U.K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227:680685.[Medline]
Lerner, E.A., M.R. Lerner, C.A. Janeway, Jr., and J.A. Steitz. 1981. Monoclonal antibodies to nucleic acid-containing cellular constituents: probes for molecular biology and autoimmune disease. Proc. Natl. Acad. Sci. USA. 78:27372741.
Liu, H.X., M. Zhang, and A.R. Krainer. 1998. Identification of functional exonic splicing enhancer motifs recognized by individual SR proteins. Genes Dev. 12:19982012.
Liu, H.X., S.L. Chew, L. Cartegni, M.Q. Zhang, and A.R. Krainer. 2000. Exonic splicing enhancer motif recognized by human SC35 under splicing conditions. Mol. Cell. Biol. 20:10631071.
Manley, J.L., and R. Tacke. 1996. SR proteins and splicing control. Genes Dev. 10:15691579.
Mayeda, A., and A.R. Krainer. 1992. Regulation of alternative pre-mRNA splicing by hnRNP A1 and splicing factor SF2. Cell. 68:365375.[Medline]
Mayeda, A., and A.R. Krainer. 1999. Mammalian in vitro splicing assays. Meth. Mol. Biol. 118:315321.[Medline]
Mayeda, A., D.M. Helfman, and A.R. Krainer. 1993. Modulation of exon skipping and inclusion by heterogeneous nuclear ribonucleoprotein A1 and pre-mRNA splicing factor SF2/ASF. Mol. Cell. Biol. 13:29933001.
Mayeda, A., J. Badolato, R. Kobayashi, M.Q. Zhang, E.M. Gardiner, and A.R. Krainer. 1999. Purification and characterization of human RNPS1: a general activator of pre-mRNA splicing. EMBO (Eur. Mol. Biol. Organ.) J. 18:45604570.[Medline]
Michaud, S., and R. Reed. 1993. A functional association between the 5' and 3' splice site is established in the earliest prespliceosome complex (E) in mammals. Genes Dev. 7:10081020.
Misteli, T., and D.L. Spector. 1999. RNA polymerase II targets pre-mRNA splicing factors to transcription sites in vivo. Mol. Cell. 3:697705.[Medline]
Moeslein, F.M., M.P. Myers, and G.E. Landreth. 1999. The CLK family kinases, CLK1 and CLK2, phosphorylate and activate the tyrosine phosphatase, PTP-1B. J. Biol Chem. 274:2669726704.
Nayler, O., C. Cap, and S. Stamm. 1998. Human transformer-2-ß gene: complete nucleotide sequence, chromosomal localization and generation of a tissue specific isoform. Genomics. 53:191202.[Medline]
Ogryzko, V.V., R.L. Schiltz, V. Russanova, B.H. Howard, and Y. Nakatani. 1996. The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell. 87:953959.[Medline]
Pagliardini, S., A. Giavazzi, V. Setola, C. Lizier, M. Di Luca, S. DeBiasi, and G. Battaglia. 2000. Subcellular localization and axonal transport of the survival motor neuron (SMN) protein in the developing rat spinal cord. Hum. Mol. Genet. 9:4756.
Singer, R.H., and M.R. Green. 1997. Compartmentalization of eukaryotic gene expression: causes and effects. Cell. 91:291294.[Medline]
Stoss, O., P. Stoilov, A.M. Hartmann, O. Nayler, and S. Stamm. 1999. The in vivo minigene approach to analyze tissue-specific splicing. Brain Res. Brain Res. Protoc. 4:383394.[Medline]
Sun, Q., A. Mayeda, R.K. Hampson, A.R. Krainer, and F.M. Rottman. 1993. General splicing factor SF2/ASF promotes alternative splicing by binding to an exonic splicing enhancer. Genes Dev. 7:25982608.
Turner, J., and M. Crossley. 1998. Cloning and characterization of mCtBP2, a co-repressor that associates with basic Kruppel-like factor and other mammalian transcriptional regulators. EMBO (Eur. Mol. Biol. Organ.) J. 17:51295140.[Medline]
van der Weyden, L., D.J. Adams, and B.J. Morris. 2000. Capacity for purinergic control of renin promoter via P2Y11 receptor and cAMP pathways. Hypertension. 36:10931098.
von Mikecz, A., S.S. Zhang, M. Montminy, E.M. Tan, and P. Hemmerich. 2000. CREB-binding protein (CBP)/p300 and RNA polymerase II colocalize in transcriptionally active domains in the nucleus. J. Cell Biol. 150:265273.
Wu, J.Y., and T. Maniatis. 1993. Specific interactions between proteins implicated in splice site selection and regulated alternative splicing. Cell. 75:10611070.[Medline]
Xiao, S.H., and J.L. Manley. 1998. Phosphorylation-dephosphorylation differentially affects activities of splicing factor ASF/SF2. EMBO (Eur. Mol. Biol. Organ.) J. 17:63596367.[Medline]
Yang, X., M.R. Bani, S.J. Lu, S. Rowan, Y. Ben-David, and B. Chabot. 1994. The A1 and A1B proteins of heterogeneous nuclear ribonucleoparticles modulate 5' splice site selection in vivo. Proc. Natl. Acad. Sci. USA. 91:69246928.
Yang, X.J., V.V. Ogryzko, J. Nishikawa, B.H. Howard, and Y. Nakatani. 1996. A p300/CBP-associated factor that competes with the adenoviral oncoprotein E1a. Nature. 382:319324.[Medline]
Yuryev, A., M. Patturajan, Y. Litingtung, R.V. Joshi, C. Gentile, M. Gebara, and J.L. Corden. 1996. The C-terminal domain of the largest subunit of RNA polymerase II interacts with a novel set of serine/arginine-rich proteins. Proc. Natl. Acad. Sci. USA. 93:69756980.
Zuo, P., and T. Maniatis. 1996. The splicing factor U2AF35 mediates critical protein-protein interactions in constitutive and enhancer-dependent splicing. Genes Dev. 10:13561368.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|