|
||
© The Rockefeller University Press,
0021-9525/2001/8/525 $5.00
The Journal of Cell Biology, Volume 154, Number 3, August 6, 2001 525-534
Article |
Head-to-tail oligomerization of calsequestrin
: a novel mechanism for heterogeneous distribution of endoplasmic reticulum luminal proteins
2 DIBIT, Department of Neuroscience, Vita-Salute University and Scientific Institute San Raffaele, 20132 Milan, Italy
3 Canadian Institutes of Health, Research Group in Molecular Biology of Membrane Proteins, and Department of Biochemistry, University of Alberta, Edmonton, Canada T6G 2H
Address correspondence to Jacopo Meldolesi, DIBIT, Department of Neuroscience, Vita-Salute University and Scientific Institute San Raffaele, Via Olgettina 58, 20132 Milan, Italy. Tel.: 39-02-2643-2770. Fax: 39-02-2643-4813. E-mail: meldolesi.jacopo{at}hsr.it
| Abstract |
|---|
|
|
|---|
Many proteins retained within the endo/sarcoplasmic reticulum (ER/SR) lumen express the COOH-terminal tetrapeptide KDEL, by which they continuously recycle from the Golgi complex; however, others do not express the KDEL retrieval signal. Among the latter is calsequestrin (CSQ), the major Ca2+-binding protein condensed within both the terminal cisternae of striated muscle SR and the ER vacuolar domains of some neurons and smooth muscles. To reveal the mechanisms of condensation and establish whether it also accounts for ER/SR retention of CSQ, we generated a variety of constructs: chimeras with another similar protein, calreticulin (CRT); mutants truncated of COOH- or NH2-terminal domains; and other mutants deleted or point mutated at strategic sites. By transfection in L6 myoblasts and HeLa cells we show here that CSQ condensation in ER-derived vacuoles requires two amino acid sequences, one at the NH2 terminus, the other near the COOH terminus. Experiments with a green fluorescent protein GFP/CSQ chimera demonstrate that the CSQ-rich vacuoles are long-lived organelles, unaffected by Ca2+ depletion, whose almost complete lack of movement may depend on a direct interaction with the ER. CSQ retention within the ER can be dissociated from condensation, the first identified process by which ER luminal proteins assume a heterogeneous distribution. A model is proposed to explain this new process, that might also be valid for other luminal proteins.
Key Words: calsequestrin; condensation; endo/sarcoplasmic reticulum; calsequestrin mutants; L6 and HeLa cells
| Introduction |
|---|
|
|
|---|
However, several proteins that reside in the ER lumen do not terminate with the KDEL retrieval signal. The best known example of a luminal protein without a KDEL signal is calsequestrin (CSQ),* a low affinityhigh capacity Ca2+-binding protein (MacLennan and Wong, 1971). CSQ is found in dense, highly concentrated (up to 12 mmol/liter) filamentous matrices segregated within the terminal cisternae of the sarcoplasmic reticulum (SR). The SR is the ER subcompartment highly developed in striated muscle fibers, and characterized by a precisely defined architecture because of its intimate interaction with the plasmalemma T-tubule membrane. In contrast, the SR longitudinal cisternal network distributed around muscle myofibrils is almost completely devoid of CSQ (Cala et al., 1990; Jorgensen et al., 1993; Franzini-Armstrong and Jorgensen, 1994; Meldolesi and Pozzan, 1998). The unique distribution of CSQ is of key physiological importance. Due to their proximity to ryanodine receptors (the SR Ca2+ channels), the condensed CSQ matrices contribute to the regulation of Ca2+ fluxes (Ohkura et al., 1998; Szegedi et al., 1999) and provide the pool of Ca2+ necessary to trigger and sustain muscle contraction (Franzini-Armstrong and Jorgensen, 1994).
Condensation of CSQ to yield dense organelle cores does not take place in the terminal cisternae only, but also exists within the discrete corbular vacuoles of the heart SR, and within ER cisternae and vacuoles in some smooth muscle and neurons (Wuytack et al., 1987; Villa et al., 1991, 1993; Volpe et al., 1991). Moreover, the same process of condensation occurs in other cells (L6 myoblasts, PC12 pheochromocytoma, and HeLa epithelial cells) when transfected with a CSQ expression vector (Papazafiri et al., 1994; Raichman et al., 1995; Gatti et al., 1997). This indicates that intraluminal condensation of CSQ is a physiological property that exists in any cell in which the protein is expressed. The condensed organelle cores, which also contain trace amounts of other ER proteins, remain in equilibrium with a soluble pool of protein (Gatti et al., 1997). The molecular mechanisms responsible for condensation and specific redistribution of CSQ in the lumen of ER/SR are not known.
Here we demonstrate that condensation of CSQ is due to oligomerization. As a result the protein, retained within the ER/SR lumen by an independent mechanism, does assume its typical heterogeneous distribution. We also identify two amino acid sequences that are essential for condensation of the protein, one at the NH2 terminus (residues 115, hereafter referred to as site A) and one near the COOH terminus (residues 337357, hereafter referred to as site B) of CSQ.
| Results |
|---|
|
|
|---|
|
No accumulation of either chimera was observed at the level of the Golgi complex. We conclude that both the 67 COOH-terminal amino acid sequence residues and another sequence (so far unidentified) contained in the rest of the CSQ molecule are needed to induce condensation.
Truncation and site-directed mutants
To identify the specific amino acid sequences important for CSQ condensation, we prepared a panel of expression vectors including full-length CSQ and various NH2- and COOH-terminal truncations (Fig. 2
A). L6 myoblasts and HeLa cells were transfected, each with a single expression vector, and the intracellular distribution of the expressed protein was examined by immunocytochemistry. In all cell types investigated, only the full-length CSQ1391 (Fig. 2, B and F) and the longest COOH terminus deletion mutant, i.e., CSQ1350 truncated by removal of 41 amino acids (Fig. 2, C and G), exhibited condensation into puncta (i.e., into vacuoles delimited by a single membrane). However, a careful analysis of the puncta obtained with the two CSQ forms revealed differences between them. In particular, in both L6 and HeLa cells transfected with full-length CSQ1391, the puncta appeared most often compact (Fig. 1 B' and Fig. 2, B and F) and only a few exhibited an irregular honeycomb or ring structure surrounding clear areas. In contrast, the puncta containing the truncated CSQ1350 mutant appeared frequently irregular, especially in L6 cells (Fig. 2, C and G). Ultrastructural immunocytochemistry confirmed that irregular puncta are also vacuoles containing CSQ-positive masses, though alternated to clear areas (Fig. 2 R).
|
The punctate CSQ1350 mutant and the diffuse CSQ1324 mutant differ only by the number of amino acids deleted from the COOH-terminal region (41 and 67, respectively; Fig. 2 A). This indicated to us that some information essential for CSQ condensation must reside in residues 325350. In addition, the results with NH2-terminaltruncated mutants indicated that there was another localization in the NH2-terminal region of CSQ essential for its condensation. This conclusion was confirmed by results obtained with the shortest COOH-terminaltruncated mutant, CSQ1100, built with an HA sequence at its COOH terminus in order to distinguish it from the other forms used. When the HA-CSQ1100 cDNA was transfected not alone (as shown in the legend to Fig. 2 J), but together with a hybrid protein composed of the full-length CSQ1391 attached at its COOH-terminus to the green fluorescent protein (GFP) (GFP/CSQ), the distribution of the two proteins varied depending on their transfection ratio. When the truncated form predominated over GFP/CSQ (5:1), the two immunolabelings codistributed diffusely through the ER, with no appearance of distinct puncta (Fig. 2, L and M); at lower ratios (1:5) puncta were evident and clearly positive, not only for GFP but also for HA (Fig. 2, N and O). Codistribution was also observed in irregular vacuoles present in the cells transfected with HA-CSQ1100 together with CSQ1350 (Fig. 2, P and Q). In contrast, when HA-CSQ1100 was cotransfected together with CSQ228391 (the COOH-terminal 163 amino acids, including the 324350 sequence), the distribution of both mutants remained diffuse (unpublished data). Taken as a whole, these results confirm that in order to proceed, condensation requires the presence of full-length CSQ1391 or CSQ1350 mutant molecules expressing at least two binding sites, and that it is inhibited when the CSQ1100 mutant, which contains one site only, competes for the binding.
To identify the two binding sites at higher resolution, experiments were set up in which the full-length protein was deleted of short amino acid sequences, or point mutated at strategically located sites. When either site A or site B was deleted, the distribution of the mutants was diffuse (Fig. 3, B and C) , coinciding largely with that of CRT (Fig. 3, B' and C'). Largely diffuse distribution was also obtained after site-specific mutation of full-length CSQ (Fig. 4 A) at three acidic amino acids in site B, D341A, E344A, and D345A (Fig. 4 C). In contrast, site-specific mutation of three, more proximal glutamic acid residues (E337A, E338A, and E340A) failed to affect the punctate distribution, which remained unchanged with respect to intact CSQ (Fig. 4 B).
|
|
|
ER retention of CSQ
To investigate whether and to what extent retention of CSQ within the ER and ER-derived vacuoles depends on its condensation competence or a different mechanism(s), batches of L6 and HeLa cells (some stably expressing, others not expressing the full-length CSQ) were transfected with either one of the COOH-terminaltruncated mutants, CSQ1350 and CSQ1324, characterized by punctate and diffuse ER distribution, respectively. 46 h after transfection the cells were pulse labeled with [35S]methionine (30 min) and then chased for up to 5 h. Part of the results obtained in HeLa cells can be seen in Fig. 6
; similar results from L6 cells are not shown. The labeled, stably transfected full-length CSQ discharged to the medium was only a tiny fraction of that recovered within the cells. Moreover, its rate of discharge during the first hour was <1/50 of that of a typical secretory protein, chromogranin B, transfected to parallel batches of cells and investigated in parallel (unpublished data). The CSQ result was expected because it is consistent with our previous data documenting only minimal transport of the protein to the Golgi complex and the extracellular space (Gatti et al., 1997). The results obtained with the truncated mutant CSQ1350 documented only a slightly higher release to the medium, which remained very low, irrespective of the coexpression of full-length CSQ. Unexpectedly, the diffusely distributed CSQ1324 mutant was released at a rate similar to full-length CSQ, i.e., not more, but even less efficiently than CSQ1350 (Fig. 6). Similar results were obtained by additional experiments carried out in parallel with batches of unlabeled cells, in which release of full-length and truncated CSQ forms was revealed by Western blotting of cells and media, collected at the same time points of the pulsechase experiments.
|
| Discussion |
|---|
|
|
|---|
CSQ-filled vacuoles as specialized ER domains
The main task of this work was the identification of the molecular mechanisms responsible for condensation and retention of CSQ within the ER and ER-derived organelles. In striated muscle fibers such a retention was often attributed to the direct binding of the CSQ acidic tail to triadins and junctins, two families of transmembrane proteins that protrude into the cisternal lumen with their long, highly basic COOH-terminal tails (Guo and Campbell, 1995; Jones et al., 1995; Kobayashi et al., 2000; Shin et al., 2000). However, although expression of triadins and junctins is considerable in muscle fibers, their levels are distinctly lower than those of CSQ (Knudson et al., 1993; Jones et al., 1995; Zhang et al., 2001). Therefore, a single retention/condensation mechanism based on a molecule-to-molecule binding between CSQ and these basic proteins appears unlikely. Moreover, in the other cells that express CSQ, the two basic SR proteins are not expressed at all, yet CSQ does condense within discrete vacuoles to levels comparable with those observed in SR terminal cisternae (Villa et al., 1991, 1993; Volpe et al., 1991; Papazafiri et al., 1994; Raichman et al., 1995; Gatti et al., 1997). Most likely, therefore, the interaction with triadins and junctins is not important for condensation but is instrumental to a subsequent process taking place only in muscle fibers, the docking of the condensed CSQ matrices to the junctional face of SR terminal cisternae.
Another mechanism that has been considered to explain condensation is dependence on the high Ca2+ concentration typical of the ER/SR lumen (He et al., 1993). Indeed, the triadin/junctin interaction with CSQ is released in vitro by Ca2+ withdrawal (Shin et al., 2000). However, in intact L6 or HeLa cells transfected with CSQ, vacuoles remained apparently unchanged after long treatment with the Ca2+ ionophore ionomycin applied in Ca2+-free medium, a condition known to largely deplete ER stores of their segregated Ca2+ (Gatti et al., 1997). Thus, Ca2+ appears unnecessary for the in vivo maintenance of CSQ in its condensed state.
From the structural point of view, the CSQ-containing vacuoles appeared heterogeneous. In fact, some were regularly spherical, dense, and compact, whereas others (especially those containing the truncated CSQ1350 mutant) were irregular, with a content alternating dense and clear areas. Content heterogeneity is not unique to CSQ-containing vacuoles, but has been observed in the content of various hormone secretion granules (see for example Orci, 1982), possibly due to peculiar aspects of their condensation processes. The ultimate significance of content heterogeneity remains undefined.
Our previous studies (Gatti et al., 1997) had excluded the CSQ-containing vacuoles to be lysosomes, endosomes, and part of the Golgi complex. In contrast, vacuoles were identified as discrete, specialized domains of the ER, similar in a few aspects to the SR terminal cisternae and resembling more closely the CSQ-rich vacuoles that appear within myocytes of transgenic mice overexpressing the protein (Jones et al., 1998; Sato et al., 1998). An additional property of the CSQ vacuoles revealed in the present work, low mobility throughout the cytoplasm, was not due to their interaction with microtubules, because it was unaffected by depolymerization induced by nocodazol. An alternative possibility is the direct interaction with the ER network, a system in continuous protein exchange with the vacuoles (Gatti et al., 1997) that as a whole undergoes only slow oscillations and retractions within the cells (Terasaki and Jaffe, 1993).
The CSQ condensation process
The molecular mechanisms of CSQ condensation were investigated in a large spectrum of mutants expressed in both L6 and HeLa cells. The first series of experiments was carried out by using chimeras of CSQ with another ER luminal Ca2+-binding protein, CRT. In spite of their low degree of homology, luminal distribution, and function (CRT is a chaperone diffuse throughout the whole ER) (Michalak et al., 1999; Molinari and Helenius, 2000), CSQ and CRT share similarities in structure and low-affinity Ca2+-binding properties. These similarities are particularly evident at their highly acidic COOH-terminal tail (7080 amino acids), a region considered of importance also for the non-KDEL mechanism of retention in the ER (Sonnichsen et al., 1994). However, in both cell types investigated the results clearly excluded CSQ condensation to depend on the acidic tail alone. In fact, both the CRT/CSQ and the CSQ/CRT chimeras remained diffusely distributed throughout the ER lumen. These data strongly suggest the existence of not one but at least two condensation sites, one located in the COOH-terminal tail, the other elsewhere in the CSQ molecule. The existence of an NH2-terminal site was confirmed by coexpression results with the GFP/CSQ chimera and the COOH-terminaltruncated mutant CSQ1100. In fact, depending on their expression ratio, the two forms were seen colocalized within either the ER cisternae or the vacuoles, strongly suggesting their direct binding. Finally, the existence of two binding sites was confirmed by the results with truncated and point-mutated constructs that lead to the identification of site A, corresponding to the short NH2-terminal 15amino acid sequence, and site B, located COOH-terminal of residue 337, with critical involvement of the CSQ acidic residues 341, 344, and 345.
The CSQ condensation model
Based on the specific information reported so far, on previous biochemical results (Cala and Jones, 1983; Maguire et al., 1997; Zhang et al., 1997) and the known crystal structure (Wang et al., 1998), we have developed a model for CSQ condensation using the Biopolymer option in InsightII software (Fig. 7)
. The x-ray results had revealed that the protein may form "front-to-front" and "back-to-back" dimers (Fig. 7, F-F and B-B, respectively; Wang et al., 1998) in which the NH2 terminus and the COOH terminus could either fit into a groove between domains 1 and 3 or face away from the dimer interface, thereby enabling them to interact with other CSQ molecules. From these data, models of possible higher oligomers were developed. Only two regularly repeating structures showing the expected NH2- and COOH-terminal alignment were identified. The first is the front-to front and back-to-back oligomer revealed also by x-ray (Wang et al., 1998), the other is a "front-to-back" structure (Fig. 7, potential) that emerged from the analysis of the present data. The localization near the COOH terminus of the
-helical region including the critical residues, D341, D344, and D345, far away from the NH2-terminal sequence, appears compatible with its direct involvement in the CSQCSQ intermolecular binding. The polymers established according to the above models most likely correspond to the CSQ filaments revealed by electron microscopy within deep-etched SR terminal cisternae (Franzini-Armstrong et al., 1987).
|
In conclusion, intraluminal retention, condensation, and specific distribution of CSQ are shown here to be sustained by multiple and independent mechanisms. The first mechanism is a molecular retention step, apparently similar to the KDEL-independent process of other luminal proteins (Sonnichsen et al., 1994; Monnat et al., 2000). The second is condensation, which depends on specific, molecularly identified A and B sites. The third (in striated muscle fibers but not in the other cells where CSQ is expressed) is the specific docking of condensed matrices, most likely by the membrane proteins associated to ryanodine receptors, i.e., triadins and junctins (Guo and Campbell, 1995; Jones et al., 1995; Zhang et al., 2001).
Condensation is not an exclusive property of CSQ, but appears to also take place with other ER proteins, single or as mixtures, in both animal and vegetal cells (see, for example, Titorenko and Rachubinski, 1998; Choi et al., 2000; Chrispeels and Herman, 2000). Moreover, condensation does occur in other intracellular compartments, for example at the trans-Golgi network of secretory cells (Chanat and Huttner, 1991; Colomer et al., 1994). Therefore, our results on CSQ, with the first identification of at least two specific amino acid sequences necessary for condensation to take place, might be seminal for further studies concerning not only proteins of the ER lumen but also proteins of other organelles.
| Materials and methods |
|---|
|
|
|---|
Generation of the CSQ/CRT and CRT/CSQ chimeras
pcDNA CSQ/CRT and pcDNA CRT/CSQ were generated by PCR-driven amplification. pcDX-CRT was used as a template for CRT and the CRT tail, and pSVL-CCS was used to amplify CSQ and the CSQ tail. For CRT NH2-terminal sequence the following primers were used: 5'-ATCGGCTAGCATGCTGCTCCC-3' and 5'-ATCGGGTACCGTTGGTGATG-3'. To create the CRT COOH-terminal tail we used 5'-ATCGGGTACCGATGAGGCGTAC-3' and 5'-ATCGGGGCCCCTACAGCTCGTC-3'. The nucleotide sequence encoding the NH2-terminal part of CSQ was amplified using the following primers: 5'-ATGGGCTAGCATGAAGAGAACAC-3' and 5'-ATCGGGTACCCAGACACTG-3'. For generation of the CSQ COOH-terminal tail we used 5'-ATCGGGTACCATGGAGATTCC-3' and 5'-ATCGGGGCCCC- TACTCATC-3'. PCR products were cloned into pcDNA3 expression vectors. All sequences were confirmed by nucleotide sequencing.
Generation of NH2- and COOH-terminaltruncated CSQ
The NH2 and COOH terminus deletions of CSQ were generated by PCR-driven amplification of pSVL-CCS vector. For COOH-terminal truncation, the 5' primer for all the constructs was 5'-GGGGTACCATGAAGAGAACACACCTGTTCA-3' and the 3' primers were 5'-AATTGGATCCACCCTTAAGAACATACAGGC-3' (for CSQ1100), 5'-AATTGGATCCCAATTTCTTTGCAACCCCTT-3' (for CSQ1188), 5'-AATTGGATCCAACAAGCAGAGGAACGTCAT-3' (for CSQ1297), 5'-ATCGGGTACCCAGACACTG-3' (for CSQ1324), 5'-AATTGGATCCCTTTCCAGAAAGCACATCCT-3' (for CSQ1350), and 5'-AATTGGATCCCTCATCATCATCATCACTGT-3' (for full-length CSQ1391). The PCR products were cloned into the pcDNA3 expression vector. The CSQ signal sequence was inserted upstream of the NH2-terminal deletions by annealing the two following synthetic oligodeoxynucleotides with flanking HindIII and KpnI restriction sites: 5' CTAGCAAGCTTATGAAGAGAACACACCTGTTCATCGC- GGGGCTCTACCTGCTGGCCTCCTGCCGGGCAGGTAC-3' and 5'-CTA- CCCGGCAGGAGGCCAGCAGGTAGAGCCCCGCGATGAACAGGTGTGTTCTCTTCATAAGCTTG-3'. The 5' primers for the NH2-deletions were 5'-GGGGTACCGAGTTTGATGGCGAGTTTGCAG-3' (for CSQ124391), 5'-GGG-GTACCCCTGACAAACCTTACACAGAAG-3' (for CSQ228391), and 5'-AATTGGATCCCTCATCATCATCATCACTGT-3' (for CSQ325391), and the 3' primer was the same as that used for full-length CSQ1391. The PCR products were cloned in the pcDNA3 expression vector. The 3' primer was the same as that used for full-length CSQ1391. The HA epitope was introduced as the following synthetic oligodeoxynucleotides flanked by BamHI and ApaI restriction sites: 5'-GAQTCCTACCCATATGATGTTCCTGACTATGCGTAGGGC-3' and 5'-CTACGCATAGTCAGGAACATCATATGGGTAG-3'.
Generation of CSQ mutants
Deletions or point mutations in the CSQ cDNA region were created using the Quick-Change Mutagenesis kit (Stratagene), as recommended by the manufacturer. 5' and 3' primers covering the NH2- and COOH-terminal region of CSQ were generated and used for PCR-driven amplification. To generate the site A deletion mutant (Fig. 2) we used the 5' oligodeoxynucleotide 5'-TCCTGCCGGGCAGTCAGTCTCACT-3' and the 3' oligodeoxynucleotide 5'-AGTGAGACTGAGTGCCCGGCAGGA-3', and for the site B deletion mutant (Fig. 2) the 5' oligodeoxynecleotide was 5'-CCCACAGCTGAGAATGAAGAGGGG-3' and the 3' oligodeoxynucleotide was 5'-CCCCTCTTCATTCTCAGCTGTGGG-3'. For site-specific mutation (site B) of E337A, E338A, and E340A, the 5' oligodeoxynucleotide was 5'-CCTGCCCACAGCTGCGGCGCTGGCGGACTGGATCG-3' and the 3' oligodeoxynucleotide was 5'-CGATCCAGTCCGCCAGCGCCGCAGCTGTGGGCAGG-3'. For site specific mutation (site B) of D341A, E344A, and E345A, the 5' oligodeoxynucleotide was 5'-GGAGCTGGAGGCCTGGATCGCGGCTGTGCTTTCTG-3' and the 3' oligodeoxynucleotide was 5'-CAGAAAGCACAGCCGCGATCCAGGCCTCCAGCTCC-3'. All sequences were confirmed by nucleotide sequencing.
Generation of GFP/CSQ chimeras
The plasmid pS65T-C1 containing cDNA encoding GFP was purchased from CLONTECH Laboratories, Inc. To create expression plasmid encoding GFP/CSQ chimera the signal sequence of CSQ was first inserted at the 5' end of GFP cDNA; this was followed by cloning CSQ cDNA at the 3' end of GFP cDNA. CSQ cDNA was generated by PCR-driven amplification using as 5' oligodeoxynucleotide 5'-AATTGACAGAAGAGGGGCTCAAC-3' and the 3' oligodeoxynucleotide 5'-TTAAGCGGCCGCCTCATCATCATC-3'; or the CSQ sequence including at its COOH-terminal a KDEL signal using as 3' oligodeoxynucleotide 5'-TAAGAATTCATAATTCATCCTTCTCATCATCATCATCATT-3'.
Cell culture, transient transfections, immunofluorescence, electron microscopy, and immunoelectron microscopy
L6 myoblast and HeLa cells were transfected as described previously (Gatti et al., 1997). Expression vectors for HA-tagged CRT and CSQ were described previously (Bastianutto et al., 1995; Nori et al., 1997). SDS-PAGE, Western blot analysis, immunofluorescence, electron microscopy of Epon-embedded sections, immunogold labeling of ultrathin cryosections, and LR Whiteembedded samples were carried out as described in our previous studies (Gatti et al., 1997).
Release of CSQ and CSQ mutants to the incubation medium
Multiple (two per time point) monolayers of L6 and HeLa cells stably transfected with full-length CSQ (Gatti et al., 1997) were transiently transfected with either CSQ1350 or CSQ1324. 46 h after transfection the monolayers were washed twice and covered with fresh DMEM without serum and methionine, and supplemented with 140 µCi/ml of [35S]methionine. After 30 min labeling at 37°C (pulse), monolayers were washed again and incubations were continued in a nonradioactive DMEM with serum (chase) for 0, 60, 120, 180, and 300 min. Media and detached cells were collected separately at the time points indicated above, and the various CSQ forms were immunoprecipitated with anti-CSQ antibody (Ab). The immunoprecipitates were run on SDS-PAGE gels. Additional experiments were carried out with cell preparations stably transfected with either full-length CSQ or CSQ1350. After staining (Coomassie blue) and soaking in the amplifier, the gels were autoradiographed and the radioactivity of CSQ bands was assayed by microdensitometry. Additional batches of cells, transfected with the same CSQ forms as above, were incubated according to the same protocol, although without [35S]methionine. At each time point, cells and media were collected and the release of full-length CSQ and mutants was established by Western blotting.
In vivo analysis of CSQ vacuoles
Fluorescent vacuoles were generated by transient transfection of GFP/CSQ with or without KDEL constructs. 2644 h after transfection, washed monolayers were covered with Krebs-Ringer medium (no serum) and transferred to the fluorescence microscope (30°C). Analyses for GFP distribution were carried out for the times indicated in the legend to Fig. 5. In parallel experiments, monolayers covered with Krebs-Ringer medium without Ca2+ and containing 1 mM EGTA and 1 µM of the Ca2+ ionophore, ionomycin, were examined in the fluorescent microscope up to 120 min.
| Footnotes |
|---|
* Abbreviations used in this paper: Ab, antibody; CRT, calreticulin; CSQ, calsequestrin; GFP, green fluorescent protein; HA, hemagglutinin; SR, sarcoplasmic reticulum.
| Acknowledgments |
|---|
This work was supported by grants from Telethon of Italy (project 1118), the Armenise-Harvard Foundation, and the Canadian Institutes of Health Research, the Heart and Stroke Foundation of Alberta.
Submitted: 1 March 2001
Revised: 29 June 2001
Accepted: 2 July 2001
| References |
|---|
|
|
|---|
Bastianutto, C., E. Clementi, F. Codazzi, P. Podini, F. De Giorgi, R. Rizzuto, J. Meldolesi, and T. Pozzan. 1995. Overexpression of calreticulin increases the Ca2+ capacity of rapidly exchanging Ca2+ stores and reveals aspects of their lumenal microenvironment and function. J. Cell Biol. 130:847855.
Cala, S.E., and L.R. Jones. 1983. Rapid purification of calsequestrin from cardiac and skeletal muscle sarcoplasmic reticulum vesicles by Ca2+-dependent elution from phenyl-Sepharose. J. Biol. Chem. 258:1193211936.
Cala, S.E., B.T. Scott, and L.R. Jones. 1990. Intralumenal sarcoplasmic reticulum Ca2+-binding proteins. Semin. Cell Biol. 1:265275.[Medline]
Chanat, E., and W.B. Huttner. 1991. Milieu-induced, selective aggregation of regulated secretory proteins in the trans-Golgi network. J. Cell Biol. 115:15051519.
Choi, S.B., C. Wang, D.G. Muench, K. Ozawa, V.R. Franceschi, Y. Wu, and T.W. Okita. 2000. Messenger RNA targeting of rice seed storage proteins to specific ER subdomains. Nature. 407:765767.[Medline]
Chrispeels, M.J., and E.M. Herman. 2000. Endoplasmic reticulum-derived compartments function in storage and as mediators of vacuolar remodeling via a new type of organelle, precursor protease vesicles. Plant Physiol. 123:12271234.
Clegg, D.O., J.C. Helder, B.C. Hann, D.E. Hall, and L.F. Reichardt. 1988. Amino acid sequence and distribution of mRNA encoding a major skeletal muscle laminin-binding protein: an extracellular matrixassociated protein with an unusual COOH-terminal polyaspartate domain. J. Cell Biol. 107:699705.
Colomer, V., K. Lal, T.C. Hoops, and M.J. Rindler. 1994. Exocrine granule specific packaging signals are present in the polypeptide moiety of the pancreatic granule membrane protein GP2 and in amylase: implications for protein targeting to secretory granules. EMBO J. 13:37113719.[Medline]
Corbett, E.F., and M. Michalak. 2000. Calcium, a signaling molecule in the endoplasmic reticulum? Trends Biochem. Sci. 25:307311.[Medline]
Ellgaard, L., M. Molinari, and A. Helenius. 1999. Setting the standards: quality control in the secretory pathway. Science. 286:18821888.
Franzini-Armstrong, C., and A.O. Jorgensen. 1994. Structure and development of E-C coupling units in skeletal muscle. Annu. Rev. Physiol. 56:509534.[Medline]
Franzini-Armstrong, C., L.J. Kenney, and E. Varriano-Marston. 1987. The structure of calsequestrin in triads of vertebrate skeletal muscle: a deep-etch study. J. Cell Biol. 105:4956.
Gatti, G., P. Podini, and J. Meldolesi. 1997. Overexpression of calsequestrin in L6 myoblasts: formation of endoplasmic reticulum subdomains and their evolution into discrete vacuoles where aggregates of the protein are specifically accumulated. Mol. Biol. Cell. 8:17891803.[Abstract]
Guo, W., and K.P. Campbell. 1995. Association of triadin with the ryanodine receptor and calsequestrin in the lumen of the sarcoplasmic reticulum. J. Biol. Chem. 270:90279030.
He, Z., A.K. Dunker, C.R. Wesson, and W.R. Trumble. 1993. Ca2+-induced folding and aggregation of skeletal muscle sarcoplasmic reticulum calsequestrin. The involvement of the trifluoperazine-binding site. J. Biol. Chem. 268:2463524641.
Jones, L.R., L. Zhang, K. Sanborn, A.O. Jorgensen, and J. Kelley. 1995. Purification, primary structure, and immunological characterization of the 26-kDa calsequestrin binding protein (junctin) from cardiac junctional sarcoplasmic reticulum. J. Biol. Chem. 270:3078730796.
Jones, L.R., Y.J. Suzuki, W. Wang, Y.M. Kobayashi, V. Ramesh, C. Franzini-Armstrong, L. Cleemann, and M. Morad. 1998. Regulation of Ca2+ signaling in transgenic mouse cardiac myocytes overexpressing calsequestrin. J. Clin. Invest. 101:13851393.[Medline]
Jorgensen, A.O., A.C. Shen, W. Arnold, P.S. McPherson, and K.P. Campbell. 1993. The Ca2+-release channel/ryanodine receptor is localized in junctional and corbular sarcoplasmic reticulum in cardiac muscle. J. Cell Biol. 120:969980.
Knudson, C.M., K.K. Stang, C.R. Moomaw, C.A. Slaughter, and K.P. Campbell. 1993. Primary structure and topological analysis of a skeletal muscle-specific junctional sarcoplasmic reticulum glycoprotein (triadin). J. Biol. Chem. 268:1264612654.
Kobayashi, Y.M., B.A. Alseikhan, and L.R. Jones. 2000. Localization and characterization of the calsequestrin-binding domain of triadin 1. Evidence for a charged beta-strand in mediating the protein-protein interaction. J. Biol. Chem. 275:1763917646.
Kopito, R.R., and R. Sitia. 2000. Aggresomes and Russell bodies. Symptoms of cellular indigestion? EMBO Rep. 1:225231.[Medline]
Lewis, M.J., and H.R. Pelham. 1990. A human homologue of the yeast HDEL receptor. Nature. 348:162163.[Medline]
Lewis, M.J., and H.R. Pelham. 1996. SNARE-mediated retrograde traffic from the Golgi complex to the endoplasmic reticulum. Cell. 85:205215.[Medline]
MacLennan, D.H., and P.T. Wong. 1971. Isolation of a calcium-sequestering protein from sarcoplasmic reticulum. Proc. Natl. Acad. Sci. USA. 68:12311235.
Maguire, P.B., FN. Briggs, N.J. Lennon, and K. Ohlendieck. 1997. Oligomerization is an intrinsic property of calsequestrin in normal and transformed skeletal muscle. Biochem. Biophys. Res. Commun. 240:721727.[Medline]
Meldolesi, J., and T. Pozzan. 1998. The endoplasmic reticulum Ca2+ store: a view from the lumen. Trends Biochem. Sci. 23:1014.[Medline]
Michalak, M., E.F. Corbett, N. Mesaeli, K. Nakamura, and M. Opas. 1999. Calreticulin: one protein, one gene, many functions. Biochem. J. 344:281292.
Molinari, M., and A. Helenius. 2000. Chaperone selection during glycoprotein translocation into the endoplasmic reticulum. Science. 288:331333.
Monnat, J., E.M. Neuhaus, M.S. Pop, D.M. Ferrari, B. Kramer, and T. Soldati. 2000. Identification of a novel saturable endoplasmic reticulum localization mechanism mediated by the C-terminus of a dictyostelium protein disulfide isomerase. Mol. Biol. Cell. 11:34693484.
Nori, A., K.A. Nadalini, A. Martini, R. Rizzuto, A. Villa, and P. Volpe. 1997. Chimeric calsequestrin and its targeting to the junctional sarcoplasmic reticulum of skeletal muscle. Am. J. Physiol. 272:C1420C1428.
Ohkura, M., K. Furukawa, H. Fujimori, A. Kuruma, S. Kawano, M. Hiraoka, A. Kuniyasu, H. Nakayama, and Y. Ohizumi. 1998. Dual regulation of the skeletal muscle ryanodine receptor by triadin and calsequestrin. Biochemistry. 37:1298712993.[Medline]
Orci, L. 1982. Macro- and micro-domains in the endocrine pancreas. Diabetes. 31:538565.[Medline]
Papazafiri, P., M. Bossi, and J. Meldolesi. 1994. Expression of muscle calsequestrin in epithelial HeLa cells: distribution and functional role. Biochim. Biophys. Acta. 1223:333340.[Medline]
Pelham, H.R., K.G. Hardwick, and M.J. Lewis. 1988. Sorting of soluble ER proteins in yeast. EMBO J. 7:17571762.[Medline]
Perrin, D., B. Sonnichsen, H.D. Soling, and P. Nguyen-Van. 1991. Purkinje cells of rat and chicken cerebellum contain calreticulin (CaBP3). FEBS Lett. 294:4751.[Medline]
Raichman, M., M.C. Panzeri, E. Clementi, P. Papazafiri, M. Eckley, D.E. Clegg, A. Villa, and J. Meldolesi. 1995. Differential localization and functional role of calsequestrin in growing and differentiated myoblast. J. Cell Biol. 128:341354.
Sato, Y., D.G. Ferguson, H. Sako, G.W. Dorn II, V.J. Kadambi, A. Yatani, B.D. Hoit, R.A. Walsh, and E.G. Kranias. 1998. Cardiac-specific overexpression of mouse cardiac calsequestrin is associated with depressed cardiovascular function and hypertrophy in transgenic mice. J. Biol. Chem. 273:2847028477.
Shin, D.W., J. Ma, and D.H. Kim. 2000. The asp-rich region at the carboxy-terminus of calsequestrin binds to Ca2+ and interacts with triadin. FEBS Lett. 486:178182.[Medline]
Sonnichsen, B., J. Fullekrug, P. Nguyen-Van, W. Diekmann, D.G. Robinson, and G. Mieskes. 1994. Retention and retrieval: both mechanisms cooperate to maintain calreticulin in the endoplasmic reticulum. J. Cell Sci. 107:27052717.[Abstract]
Szegedi, C., S. Sarkoz, A. Herzog, I. Jona, and M. Varsanyi. 1999. Calsequestrin: more than "only" a luminal Ca2+ buffer inside the sarcoplasmic reticulum. Biochem. J. 337:1922.
Terasaki, M., and L.A. Jaffe. 1993. Imaging endoplasmic reticulum in living sea urchin eggs. Methods Cell Biol. 38:211220.[Medline]
Titorenko, V.I., and R.A. Rachubinski. 1998. The endoplasmic reticulum plays an essential role in peroxisome biogenesis. Trends Biochem. Sci. 23:231233.[Medline]
Villa, A., P. Podini, D.O. Clegg, T. Pozzan, and J. Meldolesi. 1991. Intracellular Ca2+ stores in chicken Purkinje neurons: differential distribution of the low affinityhigh capacity Ca2+ binding protein, calsequestrin, of Ca2+ ATPase and of the ER lumenal protein, Bip. J. Cell Biol. 113:779791.
Villa, A., P. Podini, M.C. Panzeri, H.D. Soling, P. Volpe, and J. Meldolesi. 1993. The endoplasmic-sarcoplasmic reticulum of smooth muscle: immunocytochemistry of vas deferens fibers reveals specialized subcompartments differently equipped for the control of Ca2+ homeostasis. J. Cell Biol. 121:10411051.
Volpe, P., A. Villa, E. Damiani, A.H. Sharp, P. Podini, S.H. Snyder, and J. Meldolesi. 1991. Heterogeneity of microsomal Ca2+ stores in chicken Purkinje neurons. EMBO J. 10:31833189.[Medline]
Wang, S., W.R. Trumble, H. Liao, C.R. Wesson, A.K. Dunker, and C. Kang. 1998. Crystal structure of calsequestrin from rabbit skeletal muscle sarcoplasmic reticulum. Nat. Struct. Biol. 5:476483.[Medline]
Wuytack, F., L. Raeymaekers, J. Verbist, L.R. Jones, and R. Casteels. 1987. Smooth-muscle endoplasmic reticulum contains a cardiac-like form of calsequestrin. Biochim. Biophys. Acta. 899:151158.[Medline]
Yaffe, D. 1973. Rat skeletal muscle cells. In Tissue Culture Methods and Application II. Preparation of Primary Cultures. Academic Press, New York. 106114.
Zhang, L., J. Kelley, G. Schmeisser, YM. Kobayashi, and LR. Jones. 1997. Complex formation between junctin, triadin, calsequestrin, and the ryanodine receptor. Proteins of the cardiac junctional sarcoplasmic reticulum membrane. J. Biol. Chem. 272:2338923397.
Zhang, L., C. Franzini-Armstrong, V. Ramesh, and L.R. Jones. 2001. Structural alteration in cardiac calcium release units resulting from overexpression of junctin. J. Mol. Cell. Cardiol. 33:233247.[Medline]
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|