|
||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
© The Rockefeller University Press,
0021-9525/2001/10/439 $5.00
The Journal of Cell Biology, Volume 155, Number 3, October 29, 2001 439-446
Article |
Mutations in the cytoplasmic domain of P0 reveal a role for PKC-mediated phosphorylation in adhesion and myelination
Address correspondence to Jack Lilien, Dept. of Biological Sciences, The University of Iowa, 138 Biology Bldg., Iowa City, IA 52242-1324. Tel.: (319) 353-2969. Fax: (319) 335-0081. E-mail: jack-lilien{at}uiowa.edu
| Abstract |
|---|
|
|
|---|
Mutations in P0 (MPZ), the major myelin protein of the peripheral nervous system, cause the inherited demyelinating neuropathy Charcot-Marie-Tooth disease type 1B. P0 is a member of the immunoglobulin superfamily and functions as a homophilic adhesion molecule. We now show that point mutations in the cytoplasmic domain that modify a PKC target motif (RSTK) or an adjacent serine residue abolish P0 adhesion function and can cause peripheral neuropathy in humans. Consistent with these data, PKC
along with the PKC binding protein RACK1 are immunoprecipitated with wild-type P0, and inhibition of PKC activity abolishes P0-mediated adhesion. Point mutations in the RSTK target site that abolish adhesion do not alter the association of PKC with P0; however, deletion of a 14 amino acid region, which includes the RSTK motif, does abolish the association. Thus, the interaction of PKC
with the cytoplasmic domain of P0 is independent of specific target residues but is dependent on a nearby sequence. We conclude that PKC-mediated phosphorylation of specific residues within the cytoplasmic domain of P0 is necessary for P0-mediated adhesion, and alteration of this process can cause demyelinating neuropathy in humans.
Key Words: P0; adhesion; myelination; PKC; RACK1
| Introduction |
|---|
|
|
|---|
P0 functions as a homophilic adhesion molecule in vitro (Filbin et al., 1990; Filbin and Tennekoon, 1993), and this activity may mediate compaction of adjacent leaflets in peripheral nerve myelin. Analysis of the crystal structure of the P0 extracellular domain indicates that P0 molecules have the potential to interact in cis to form homotetramers, and these interact in trans to mediate homophilic adhesion (Shapiro et al., 1996). Consistent with this model, mutation of several of the amino acid residues critical for these putative cis and trans interactions can cause the inherited demyelinating peripheral neuropathy, CMT1B (Warner et al., 1996; Nelis et al., 1999).
The cytoplasmic domain of P0 is also important for its function, and mutations in this region result in loss of P0-mediated homophilic adhesion in vitro (Wong and Filbin, 1994). Coexpression of both wild-type and cytoplasmically truncated P0 causes loss of wild-type function, presumably due to a dominant negative effect of the truncated molecule (Wong and Filbin, 1996). Mutations within the P0 cytoplasmic domain are also found in patients with inherited demyelinating neuropathies, some of which have very severe clinical phenotypes (Nelis et al., 1999; Shy et al., 2001). These data demonstrate a critical role for the cytoplasmic domain of P0 in mediating homophilic adhesion and in the molecular pathogenesis of inherited demyelinating neuropathies.
We now demonstrate that deletion of a 14 amino acid sequence in the cytoplasmic domain of P0 abolishes adhesive function. Point mutations in this region that alter a PKC substrate motif (RSTK) and mutation of an adjacent serine residue (S204) are critical to P0 adhesive function. Moreover, PKC
and the receptor for activated C kinase (RACK1) are coimmunoprecipitated from cells expressing wild-type P0 but not P0 bearing a deletion of 14 amino acid sequence. In addition, inhibition of PKC activity results in loss of P0-mediated adhesion. We have also identified a mutation of the initial arginine of the PKC substrate motif to a serine residue (R198S) in a patient with CMT1B, and we find that cells expressing P0 bearing this mutation fail to form homophilic adhesions. These data indicate that PKC-mediated phosphorylation is an important component of the regulation of P0-mediated adhesion and demonstrate that alteration of this process can cause demyelinating neuropathy in humans. This is the first glimpse of the molecular machinery that regulates the function of P0 in myelination.
| Results |
|---|
|
|
|---|
13), 28 (
28), 43 (
43), or 59 amino acids (
59). Expression of the transfected P0 constructs was determined by reverse transcription (RT)-PCR using specific primers for each construct and by Western blotting. RT-PCR reveals that all constructs were expressed in relatively equal amounts in both cell types (Fig. 1 B shows L cells). To ensure that protein was expressed and inserted in the plasma membrane, we labeled live cells with a membrane impermeable biotinylation reagent followed by immunoprecipitation with anti-P0 antibody. The immunoprecipitated material was fractionated by SDS-PAGE, transferred to polyvinylene difluoride (PVDF) membranes, and probed with HRP-streptavidin. Each of the P0 constructs is expressed at the cell surface (Fig. 1 C shows L cells).
|
13 were comparable to the same cell types expressing wild-type P0 (Fig. 2, A and B). However, P0-mediated adhesion was reduced dramatically in all cell lines with deletions of 28 amino acids or greater (Fig. 2, A and B). This suggests that the sequence between amino acids 193 and 206 is essential for P0-mediated cellcell adhesion. This region contains three serine residues that are phosphorylated in mouse sciatic nerve: S197, S199, and S204 (Hilmi et al., 1995). These residues are conserved in the human P0 sequence. Furthermore, serine 199 is part of a PKC recognition motif (198-RSTK-201) (Kishimoto et al., 1985; Woodgett et al., 1986), suggesting that phosphorylation mediated by PKC is critical to P0 adhesive function.
|
A PKC target motif and PKC activity are essential for P0-mediated adhesion
To investigate the importance of the RSTK motif and the adjacent serine, we assayed L cells transfected with P0 containing mutations in the RSTK motif (S199A and T200A) and in serine 204 (S204A) for their ability to form homophilic P0 adhesions. In addition, we assayed cells bearing a mutation at serine 197 (S197A), a site of low level in vivo phosphorylation (Hilmi et al., 1995), aspartic acid 195 (D195A), and tyrosine 191 (Y191A) as controls. Stable cell lines were created and tested for P0 expression by RT-PCR and immunoprecipitation of cell surface labeled P0 as above. All constructs were expressed at the cell surface (unpublished data). Cells expressing P0 mutated at serine sites 199 or 204 or threonine 200 failed to form P0-mediated adhesions (Fig. 3 A), indicating that both the PKC motif and serine residue 204 are functionally important. In contrast to these mutations, substitution of serine 197 or aspartic acid 195 have little or no effect (Fig. 3 A). Furthermore, replacement of tyrosine 191, a site shown recently to be phosphorylated in vivo (Xu et al., 2000a) with alanine, also has little or no effect on P0-mediated adhesion (Fig. 3 A).
|
Mutation within the RSTK domain (R198S) causes the demyelinating peripheral neuropathy CMT1B and loss of P0 homophilic adhesion
We have identified an individual with CMT1B who is heterozygous for a P0 mutation producing a substitution of arginine for serine at amino acid 198 (R198S) within the PKC binding motif. The patient had normal growth, development, and motor function until 5 yr ago, in his late 30s, when he noted the onset of lower extremity clumsiness; however, these symptoms have not progressed notably since that time. On neurological examination, he had minimal symmetrical foot dorsiflexor weakness, a mild decrease in both large and small fiber sensory modalities (vibration and pin prick) in his feet, and diminished Achilles and patellar deep tendon reflexes. His gait appeared normal, but he was unable to walk on his heels, confirming the mild weakness of the foot dorsiflexors. In addition, he had bilateral pes cavus, a common finding in patients with inherited neuropathy, probably caused by weakness of the intrinsic muscles of the feet. On electrophysiological testing, the nerve conduction velocities of peroneal and tibial motor nerves were slowed bilaterally to
25 m/s, whereas his right sural sensory NCV was slowed to 28 m/s. The left sural potential was unobtainable. These neurological signs and symptoms and electrophysiological findings are consistent with the presence of a mild demyelinating sensory and motor peripheral neuropathy.
To determine if this mutation affected P0 homophilic adhesion, we transfected L cells with P0 bearing this mutation. Expression was assayed as above and was found approximately equivalent to other P0 constructs in L cells (unpublished data). These cells showed a much reduced ability to form P0 homophilic adhesions (Fig. 3 C). Thus, elimination of PKC target residues or alteration of the PKC target motif not only abolishes P0 adhesive function in vitro but also causes demyelinating disease in humans.
PKC
and the PKC binding protein RACK1 are associated with P0 in situ
The functional requirement for the PKC target motif in P0 and its importance to human disease led us to determine which of the many isoforms of PKC is present in sciatic nerve. We find that two conventional PKCs,
and
, are detected, as well as the novel isoforms
,
, and
(Table I).
|
is present in association with P0 (Fig. 4). Furthermore, PKC
is present and associated with P0 in cultured Schwann cells (Fig. 4, SC).
|
and RACK1 with P0 (Fig. 5, compare
13 with
28 and
59). However, point mutations altering the RSTK substrate recognition motif or the adjacent serine 204, mutations that do eliminate P0-mediated adhesion, do not alter PKC or RACK1 binding. Thus, substrate recognition by PKC and binding, presumably mediated by RACK1, are two independent events occurring through distinct sites within a 14 amino acid domain of P0.
|
| Discussion |
|---|
|
|
|---|
Of the PKC isoforms present in sciatic nerve and our L cell model, PKC
is specifically immunoprecipitated with P0, indicating an in situ association between the two molecules. This interaction may be mediated by RACK1, the receptor for activated C kinase, since we find that under our experimental conditions the association of these two proteins is absolutely correlated. Furthermore, the association of both proteins with P0 is dependent on a 14 amino acid sequence in the cytoplasmic domain, amino acids 193206. This is the same region containing the PKC substrate motif; however, the substrate site and the binding site are distinct, since point mutations in the substrate site that eliminate adhesion function do not eliminate binding of PKC or RACK1. RACK1 is one member of a group of proteins that bind PKC at a site distinct from the substrate-binding site (Mochly-Rosen et al., 1991; Sim and Scott, 1999; for review see Jaken and Parker, 2000). We suggest that RACK1 binds activated PKC and interacts with P0 either directly or through an additional adaptor to bring activated PKC
into substrate proximity.
PKC has been implicated previously in phosphorylation of P0 in vitro (Suzuki et al., 1990; Rowe-Rendleman and Eichberg, 1994) and tumor promoters that activate PKC accentuate phosphorylation in situ (Agrawal and Agrawal, 1989). Most pertinent to our identification of PKC
as the critical isoform, abolition of phorbol 12,13 dibutyrateinduced upregulation of PKC in sciatic nerve is accompanied by a reduction in PKC
(Rowe-Rendleman and Eichberg, 1994). However, these prior studies were not able to correlate the PKC-dependent phosphorylation of P0 with a specific function. Our data indicate for the first time that PKC-mediated phosphorylation on serine residues is important for P0 adhesion function: P0-mediated adhesion is abolished by mutations of a PKC target motif, PKC
and the adaptor RACK1 are immunoprecipitated with wild-type P0, and P0-mediated adhesion is decreased dramatically by calphostin C, a kinase inhibitor that preferentially blocks PKC activity (IC50 for PKC = 50 nM).
There are two possible mechanisms by which phosphorylation of the cytoplasmic domain of P0 may regulate adhesion and/or myelination. One is a direct mechanism in which phosphorylation of P0 alters its conformation, allowing the cis or trans interactions required for adhesion (Shapiro et al., 1996). The second is an indirect mechanism in which phosphorylation of P0 allows or facilitates the binding of effector or adaptor molecules essential for adhesion. In either case, dynamic changes in the phosphorylation state of P0 would have significant effects on P0-mediated adhesion and/or myelination. Further experiments will clearly be required to distinguish between these two possibilities.
Our deletion and mutational analysis are consistent with some of the mutations known to give rise to human neuropathies. There are no known human mutations in the COOH-terminal 13 amino acids that give rise to pathology (Fig. 6); the single amino acid change identified in this region (R215L) appears to have no physiological ramifications (Nelis et al., 1999). Accordingly, we find that deletion of this entire region has no effect on adhesion. Five human mutations causing neuropathy produce a shift in the reading frame, and two result in introduction of a stop codon, all altering or deleting the PKC target site and/or serine 204. One of the frame shifts leaves the RSTK motif intact but deletes serine 204. This mutation gives rise to a severe form of CMT1, emphasizing the importance of this residue. In addition, we have identified a patient with CMT1B in which an arginine residue has been changed to a serine within this PKC target motif (RSTK
SSTK), potentially eliminating the ability of PKC to phosphorylate residues critical to adhesive function (Fig. 6). Indeed, mimicking this mutation in our in vitro assay abolishes P0 homophilic adhesion. Thus, these data implicate PKC-mediated phosphorylation of the cytoplasmic domain of P0 in both the regulation of homophilic adhesion and myelination. Consistent with this possibility, mutations in a dual specificity phosphatase, myotubularin-related protein-2, cause an autosomal recessive form of demyelinating CMT, called CMT4B (Bolino et al., 2000). Although it is not yet known whether myotubularin-related protein-2 cleaves phosphate groups on P0, these results clearly demonstrate that a phosphorylation/dephosphorylation cascade plays a role in the regulation of normal PNS myelination.
|
| Materials and methods |
|---|
|
|
|---|
27 KD P0 molecule in the rat sciatic nerve (unpublished data). Antipan cadherin antibody is from Sigma-Aldrich. Antibodies to PKC isoforms and RACK1 were from Transduction Laboratories. HRP-conjugated antimouse or rabbit IgG were from Cappel Laboratories (ICN Biomedicals). The secondary antibodies conjugated to magnetic beads used in immunoprecipitations were obtained from PerSeptive Biosystems.
Cloning the wild-type P0 and creating a series of mutated P0 constructs
The coding sequences of full-length wild-type P0 (P0WT) and P0 COOH-terminal deletion mutants were cloned into the pCMV-Tag4 expression vector (Stratagene) using a PCR-based technique. These various mutants contain deletions at the COOH terminus of the P0 cytoplasmic domain lacking the last 13 (
13), 28 (
28), 43 (
43), or 59 (
59) amino acids. All constructs were created using the same forward primer (P0WT5, ATAGGATCCCACCATGGCTCCTGGGGCTC), containing a BamHI restriction site and a Kozak consensus sequence. The reverse 3' primers were designed to contain overlapping DNA sequence according to the position of the deletion followed by a stop codon and a XhoI restriction site (Fig. 1 A): P0WT3, ATACTCGAGTTTCTTATCCTTGCGAGAC;
13flag, ATACTCGAGGTCGTCCTCGCCAC;
28flag, ATACTCGAGATACAGCACTGGCGTCT;
43flag, ATACTCGAGAGACTTGTGAAATTTCCCCT; and
59flag, ATACTCGAGGGCAGCCTGCCTGCGCAG.
All constructs were cloned into pCMV-Tag4 and tested by restriction enzyme cleavage and sequenced to ensure that the insertions were in frame and that no mutations were introduced during PCR.
Site-directed mutagenesis
Recombinant PCR was used to introduce point mutations in the P0 cytoplasmic domain substituting the natural amino acids with alanine residues. The oligonucleotide primers for point mutations were as follows. The underlined bases indicate the changes from the naturally occurring nucleotides: forward Y191A, 5'-AGACCCCAGTGCTGGCTGCCAT-3'; reverse Y191A, 5'-TGGTCCAGCATGGCAGCCAGCACT-3'; forward D195A, 5'-TGCTGGCCCACAGCCGAA-3'; reverse D195A, 5'-TGCTTCGGCTGTGGGCCAGCA-3'; forward S197A, 5'-CTGGACCACGCTCGAAGCACCAAA-3'; reverse S197A, 5'-AGCTTTGGTGCTTCGAGCGTGGT-3'; forward S199A, 5'-CTGGACCACAGCCGAGCTACCAAA-3'; reverse S199A, 5'-AGCTTTGGTAGCTCGGCTGTGGT-3'; forward T200A, 5'-CACAGCCGAAGCGCCAAAGCT-3'; reverse T200A, 5'-TGGCAGCTTTGGCGCTTCGGCT-3'; forward S204A, 5'-AAGCACCAAAGCTGCCGCTGAGAA-3'; and reverse S204A, 5'-ATTTCTTCTCAGCGGCAGCTT-3'.
All mutant constructs were confirmed by sequencing. The constructs were named Y191A, D195A, S197A, S199A, T200A, S204A, and R198, respectively.
Transfection of L and HeLa cells
All of the constructs and pCMV-Tag4 without inserts (Vect) were transfected into mouse L cells. WTP0,
13,
28,
43,
59, and Vect were also transfected into HeLa cells. Stable cell lines were selected for 2 wk in the presence of 1 mg/ml and maintained in the presence of 200 µg/ml of G418 (GIBCO BRL). Single clones were isolated and expanded. Clones of cells expressing high levels of transfected proteins as determined by immunoblotting with anti-P0 serum were chosen for adhesion assays.
RT-PCR
Expression of transfected constructs was assayed by RT-PCR. In brief, total RNA was isolated from cultured cells using a QIAGEN kit and reverse transcribed with Superscript II and oligo dT primers (GIBCO BRL). The resulting cDNA was used to amplify the transfected construct using the same primers that were used for cloning. For RT-PCR, the hypoxanthine phosphoribosyl transferase (HPRT) cDNA was used as an internal control. The two primers for HPRT amplification were: forward primer, 5'-CACAGGACTAGAACACCTGC-3', and reverse primer, 5'-GCTGGTGAAAAGGACCTCT-3'.
Expression of transfected cDNAs
To analyze protein expression of the transfected cDNAs and determine plasma membrane localization, cell surface molecules were labeled by biotinylation of intact cells followed by immunoprecipitation. Confluent cell layers in 100-mm dishes were rinsed free of serum and labeled with 0.1 mg/ml freshly prepared NHS-LC-biotin (Pierce Chemical Co.) in cold PBS for 30 min. After washing and quenching, cell lysates were prepared using 1 ml of lysis buffer (1.5% NP-40, 0.15 M NaCl, 10 mM Tris, pH 7.2, 5 mM EDTA, 1 mM PMSF, 100 µg/ml protease inhibitor cocktail [Sigma-Aldrich], and 100 µg/ml DNase) per 100-mm plate, cleared by centrifugation at 14,000 g for 5 min, and the supernatant immunoprecipitated with anti-P0 antibody. The immunoprecipitated proteins were separated by SDS-PAGE, transferred to PVDF membrane, and biotinylated proteins were detected with HRP-streptavidin.
Immunoprecipitation and Western blotting
To analyze the expression of PKC isoforms in sciatic nerve, equal weights of mouse sciatic nerve were solubilized in 4% SDS, fractionated by SDS-PAGE, and transferred to PVDF membranes. The membranes were probed with the indicated anti-PKC isoform antibody followed by HRP-conjugated antimouse IgG and visualized using the extended duration HRP substrate (Pierce Chemical Co.). For L cells transfected with wild-type P0, cultures were grown to confluence on 100-mm plates, washed, and incubated free of serum for 2 h before lysis as indicated above. An aliquot of the lysate was fractionated by SDS-PAGE and immunoblotted with antibodies to the PKC isoforms detected in sciatic nerve. The remaining lysate was preincubated with preimmune rabbit serum followed by goat antirabbit magnetic beads. The beads were discarded, and the cleared supernatant was incubated with anti-P0 antibody. The immunoprecipitated P0 and associated molecules were then fractionated by SDS-PAGE, transferred to PVDF, and probed with anti-PKC and anti-RACK1 antibodies. The immunoblots were processed as described above.
Adhesion assays
Cell layers were washed free of serum, harvested using 0.1% trypsin (GIBCO BRL) in PBS buffer, and resuspended in serum-free medium (DME) containing 10 mM EDTA at 5 x 106 cells/ml. 2 µl/ml of fluorogenic dye calcein acetoxymethyl ester (calcein AM) (Molecular Probes) were added to the cell suspensions and incubated at 37°C for 30 min. After two washes, 5 x 105 single calcein-labeled cells were added to prepared microplate wells containing confluent monolayers of cells expressing wild-type P0 or BSA-coated wells as controls. After 1 h incubation at 37°C, the nonadherent calcein-labeled cells were removed by carefully washing several times with DME containing 10 mM EDTA until the BSA-coated wells had no cells left. The number of cells adhering to the monolayer was measured with a molecular device microplate reader equipped with a fluorescein filter set at 494 nm.
To determine the importance of the PKC motif in the P0 sequence, calphostin C (Calbiochem) was used to specifically inhibit PKC. Wild-type P0-transfected cells were preincubated with increasing concentrations of calphostin C for 1 h and then assayed for adhesion as described above.
| Footnotes |
|---|
* Abbreviations used in this paper: HPRT, hypoxanthine phosphoribosyl transferase; PNS, peripheral nervous system; PVDF, polyvinylene difluoride; RACK, receptor for activated C kinase; RT, reverse transcription.
| Acknowledgments |
|---|
This research was supported by a grant from the National Multiple Sclerosis Society to J. Kamholz and M. Shy.
Submitted: 26 July 2001
Revised: 14 September 2001
Accepted: 21 September 2001
| References |
|---|
|
|
|---|
Agrawal, H.C., and D. Agrawal. 1989. Tumor promoters accentuate phosphorylation of P0: evidence for the presence of protein kinase C in purified PNS myelin. Neurochem. Res. 14:409413.[Medline]
Aplin, A.E., A. Howe, S.K. Alahari, and R.L. Juliano. 1998. Signal transduction and signal modulation by cell adhesion receptors: the role of integrins, cadherins, immunoglobulin-cell adhesion molecules, and selectins. Pharm. Rev. 5:197263.
Bolino, A., M. Muglia, F.L. Conforti, E. LeGuern, M.A. Salih, D.M. Georgiou, K. Christodoulou, I. Hausmanowa-Petrusewicz, P. Mandich, A. Schenone, et al. 2000. Charcot-Marie-Tooth type 4B is caused by mutations in the gene encoding myotubularin-related protein-2. Nat. Genet. 25:1720.[Medline]
Crossin, K.L., and L.A. Krushel. 2000. Cellular signaling by neural cell adhesion molecules of the immunoglobulin superfamily. Develop. Dyn. 218:260279.[Medline]
Doyle, J.P., J.G. Stempak, P. Cowin, D.R. Colman, and D. D'Urso. 1995. Protein zero, a nervous system adhesion molecule, triggers epithelial reversion in host carcinoma cells. J. Cell Biol. 131:465482.
Filbin, M.T., and G.I. Tennekoon. 1993. Homophilic adhesion of the myelin P0 protein requires glycosylation of both molecules in the homophilic pair. J. Cell Biol. 122:451459.
Filbin, M.T., F.S. Walsh, B.D. Trapp, J.A. Pizzey, and G.I. Tennekoon. 1990. Role of P0 protein as a homophilic adhesion molecule. Nature. 344:871872.[Medline]
Giese, K.P., R. Martini, G. Lemke, P. Soriano, and M. Schachner. 1992. Mouse P0 gene disruption leads to hypomyelination, abnormal expression of recognition molecules, and degeneration of myelin and axons. Cell. 17:565576.
Hilmi, S., M. Fournier, H. Valeins, J.C. Gandar, and J. Bonnet. 1995. Myelin P0 glycoprotein: identification of the site phosphorylated in vitro and in vivo by endogenous protein kinases. J. Neurochem. 64:902907.[Medline]
Iyer, S., C.L. Rowe-Rendleman, R. Bianchi, and J. Eichberg. 1996. Tyrosine phosphorylation of myelin protein P0. J. Neurosci. Res. 46:531539.[Medline]
Jaken, S., and P.J. Parker. 2000. Protein kinase C binding partners. Bioessays. 22:245254.[Medline]
Kishimoto, A., K. Nishiyama, H. Nakanishi, Y. Uratsuji, H. Nomura, Y. Takeyama, and Y. Nishizuka. 1985. Studies on the phosphorylation of myelin basic protein by protein kinase C and adenosine 3':5'-monophosphate-dependent protein kinase. J. Biol. Chem. 260:1249212499.
Martini, R., J. Zielasek, K.V. Toyka, K.P. Giese, and M. Schachner. 1995. Protein zero (P0)-deficient mice show myelin degeneration in peripheral nerves characteristic of inherited human neuropathies. Nat. Genet. 11:281286.[Medline]
Mochly-Rosen, D., H. Khaner, and J. Lopez. 1991. Identification of intracellular receptor proteins for activated protein kinase C. Proc. Natl. Acad. Sci. USA. 88:39974000.
Nelis, E., H. Neva, and C. Van Broeckhoven. 1999. Mutations in the peripheral myelin genes and associated genes in inherited peripheral neuropathies. Human Mutation. 13:1128.[Medline]
Rowe-Rendleman, C.L., and J. Eichberg. 1994. P0 phosphorylation in nerves from normal and diabetic rats: role of protein kinase C and turnover of phosphate groups. Neurochem. Res. 19:10231031.[Medline]
Shapiro, L., J.P. Doyle, P. Hensley, D.R. Coleman, and W.A. Hendrickson. 1996. Crystal structure of the extracellular domain from P0, the major structural protein of peripheral nerve myelin. Neuron. 17:435449[Medline]
Sim, A.T.R., and J.D. Scott. 1999. Targeting of PKA, PKC and protein phosphatases to cellular microdomains. Cell Cal. 26:209217.[Medline]
Shy, M.E., J. Balsamo, J. Lilien, and J. Kamholz. 2001. A molecular basis for hereditary motor and sensory neuropathy disorders. Curr. Neurol. Neurosci. Rep. 1:7788.[Medline]
Suzuki, M., Y. Sakamoto, K. Kitamura, K. Fukunaga, H. Yamamoto, E. Miyamoto, and K. Uyemura. 1990. Phosphorylation of Po glycoprotein in peripheral nerve myelin. J. Neurochem. 55:19661971.[Medline]
Svetlov, S., and S. Nigam. 1993. Calphostin C, a specific protein kinase C inhibitor, activates human neutrophils: effect on phospholipase A2 and aggregation. Biochim. Biophys. Acta. 1177:7578.[Medline]
Tamaoki, T., and H. Nakano. 1990. Potent and specific inhibitors of protein kinase C of microbial origin. Biotech. 8:732735.
Vleminckx, K., and R. Kemler. 1999. Cadherins and tissue formation integrating adhesion and signaling. Bioessays. 21:211220.[Medline]
Warner, L.E., M.J. Hilz, S.H. Appel, J.M. Killian, E.H. Kolodry, G. Karpati, S. Carpenter, G.V. Watters, C. Wheeler, D. Witt, et al. 1996. Clinical phenotypes of different MPZ (P0) mutations may include Charcot-Marie-Tooth type 1B, Dejerine-Sottas, and congenital hypomyelination. Neuron. 17:451460.[Medline]
Wong, M.-H., and M.T. Filbin. 1994. The cytoplasmic domain of the myelin Po protein influences the adhesive interactions of its extracellular domain. J. Cell Biol. 126:10891097.
Wong, M.-H., and M.T. Filbin. 1996. Dominant negative effect on adhesion by myelin Po protein truncated in its cytoplasmic domain. J. Cell Biol. 134:15311541.
Woodgett, J.R., K.L. Gould, and T. Hunter. 1986. Substrate specificity of protein kinase C. Use of synthetic peptides corresponding to physiological sites as probes for substrate recognition requirements. Eur. J. Biochem. 161:177184.[Medline]
Wrabetz, L., M.L. Feltri, A. Quattrini, D. Imperiale, D. Previtali, M. D'Antonio, X. Yin, B.D. Trapp, L. Zhou, S.Y. Chiu, et al. 2000. P(0) glycoprotein overexpression causes congenital hypomyelination of peripheral nerves. J. Cell Biol. 148:10211034.
Xu, M., R. Zhao, X. Sui, F. Xu, and Z.J. Zhao. 2000a. Tyrosine phosphorylation of myelin P0 and its implication in signal transduction. Biochem. Biophys. Res Commun. 267:820825.[Medline]
Xu, W., D. Manichella, H. Jiang, J.M. Vallat, J. Lilien, P. Baron, G. Scarlato, J. Kamholz, and M.E. Shy. 2000b. Absence of P0 leads to dysregulation of myelin gene expression and myelin morphogenesis. J. Neurosci. Res. 60:714724.[Medline]
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|