|
||
© The Rockefeller University Press,
0021-9525/2001/12/969 $5.00
The Journal of Cell Biology, Volume 155, Number 6, December 10, 2001 969-978
Article |
The Tlg SNARE complex is required for TGN homotypic fusion
Address correspondence to Robert S. Fuller, Dept. of Biological Chemistry, Rm. 5413, MSI, 1301 Catherine Rd., University of Michigan Medical School, Ann Arbor, MI 48109-0606. Tel.: (734) 936-9764. Fax: (734) 763-7799. E-mail: bfuller{at}umich.edu
| Abstract |
|---|
|
|
|---|
Using a new assay for membrane fusion between late Golgi/endosomal compartments, we have reconstituted a rapid, robust homotypic fusion reaction between membranes containing Kex2p and Ste13p, two enzymes resident in the yeast trans-Golgi network (TGN). Fusion was temperature, ATP, and cytosol dependent. It was inhibited by dilution, Ca+2 chelation, N-ethylmaleimide, and detergent. Coimmunoisolation confirmed that the reaction resulted in cointegration of the two enzymes into the same bilayer. Antibody inhibition experiments coupled with antigen competition indicated a requirement for soluble NSF attachment protein receptor (SNARE) proteins Tlg1p, Tlg2p, and Vti1p in this reaction. Membrane fusion also required the rab protein Vps21p. Vps21p was sufficient if present on either the Kex2p or Ste13p membranes alone, indicative of an inherent symmetry in the reaction. These results identify roles for a Tlg SNARE complex composed of Tlg1p, Tlg2p, Vti1p, and the rab Vps21p in this previously uncharacterized homotypic TGN fusion reaction.
Key Words: TGN; rab; SNARE; fusion; Kex2p
| Introduction |
|---|
|
|
|---|
The trans-Golgi network (TGN) consists of a complex network of vesicles and tubules in continual communication with Golgi cisternae, early and late endosomes, and the cell surface. Numerous sorting, budding, and fusion events must occur in a coordinated fashion to maintain the functional integrity of the TGN and prevent undesirable mixing of endocytic and secretory cargo. The molecular details of how this is achieved are unclear. One approach toward understanding sorting in this organelle is to reconstitute TGN membrane fusion events.
We have developed an assay to monitor vesicular transport and membrane fusion events between the TGN and endosomal compartments in yeast. Using this assay, we have discovered a vigorous and previously uncharacterized membrane fusion event involving organelles containing the TGN resident enzymes Kex2p and Ste13p (dipeptidyl aminopeptidase [DPAP]A). Membrane fusion was energy and cytosol dependent. It was inhibited by rapid chelation of Ca2+ and the thiol-reactive reagent NEM.
Furthermore, the SNARE proteins Tlg1p, Tlg2p, and Vti1p, the rab5 homologue Vps21p, and the Sec1p homologue Vps45p, all of which have been implicated in late Golgi/endosomal function in vivo, are required for this reaction. NSF-sensitive SNARE complexes containing various combinations of Tlg1p, Tlg2p, and Vti1p have been isolated (Holthuis et al., 1998; Nichols et al., 1998; Coe et al., 1999). TGN homotypic fusion represents an event in which these three SNAREs appear to function together.
| Results |
|---|
|
|
|---|
-factor and other precursors of secreted proteins in the late Golgi (Fuller et al., 1989b; Graham and Emr, 1991). After Kex2p cleavage of pro
-factor, NH2 terminal dipeptides of
-factor intermediates are removed by the Ste13p DPAP (Julius et al., 1983). Kex2p and Ste13p colocalize to the yeast equivalent of the TGN by virtue of signals in their cytosolic tails. These signals regulate their transport to and retrieval from post-Golgi compartments (Redding et al., 1991; Wilcox and Fuller, 1991; Wilcox et al., 1992; Bryant and Boyd, 1993; Nothwehr et al., 1993; Brickner and Fuller, 1997; Bryant and Stevens, 1997). To better understand the trafficking and localization of TGN membrane proteins, we developed a sensitive quantitative assay for fusion of organelles containing Kex2p and Ste13p based on the mixing of their lumenal contents and their enzymatic activities (Fig. 1 A). A Kex2p substrate was created by fusing an
-factor cleavage site followed by the triple hemagglutinin (HA) epitope tag to the lumenal COOH terminus of Ste13p (Ste13
HA). Expression of this modified form of Ste13p complemented a ste13
mutation for
-specific mating, indicating that it was functional in vivo (unpublished data). Fusion of membranes containing Ste13
HA with membranes containing Kex2p followed by Kex2p-mediated proteolytic cleavage after the Lys-Arg cleavage site within the
-factor repeat should separate the HA epitope tag from the DPAP domain (Fig. 1 A). The cleaved product could then be quantified by measuring the fraction of DPAP activity that cannot be immunoprecipitated using anti-HA antibody (i.e., the fraction of the Ste13
HA that no longer has the HA tag). To determine if Ste13
HA was localized correctly and available for cleavage, we first examined whether Ste13
HA was processed by Kex2p in vivo. Ste13
HA was processed efficiently when coexpressed with Kex2p; whereas, the molecule was completely unprocessed when expressed in a kex2
strain (Fig. 1 B). This indicated that the fusion protein was properly localized and that the
-factor cleavage site was accessible to Kex2p. We next examined Ste13
HA processing in a cell-free system. Cell-free extracts were prepared from semiintact yeast cells by freeze-thaw lysis and centrifugation (Baker et al., 1988; Ruohola et al., 1988) to produce a medium speed supernatant (MSS) fraction containing cytosol along with late Golgi and endosomal membranes but not ER or early Golgi (Fig. 1 C, inset). Efficient Kex2p-dependent processing of Ste13
HA was observed when MSS membranes from a strain expressing Ste13
HA were incubated under reaction conditions with MSS membranes from a strain expressing Kex2p (Fig. 1 C). Processing was blocked at 0°C (Fig. 1 C) and was rapid, proceeding linearly for
10 min and reaching at 15 min a maximum level equivalent to cleavage of
3540% of total Ste13
HA (Fig. 1 D). Only a very short lag (<1 min) was observed before processing began in contrast to cell-free vesicular transport reactions between Golgi cisternae (Balch et al., 1984) from the ER to the Golgi (Baker et al., 1988) or from the late endosome/prevacuolar compartment (PVC) to the lysosome (Vida and Gerhardt, 1999), all of which display a pronounced lag (
10 min).
|
HA were cointegrated into the same membranes at the end of the reaction, product membranes were immunoisolated using affinity purified antibodies directed against the Kex2p cytosolic tail (Redding et al., 1991) by a method that results in quantitative isolation of membranes containing Kex2p (Sipos and Fuller, 2001). If processing of Ste13
HA by Kex2p resulted from the fusion of compartments containing the two enzymes, then isolation of Kex2p-containing compartments should result in coisolation of DPAP activity. MSS membranes from the Kex2p- and Ste13
HA-expressing strains were incubated under reaction conditions either together (Fig. 2, Mixed) or separately (Fig. 2, Separate). "Separate" samples were combined at the end of the incubation. Incubation of the membranes together resulted in efficient processing of Ste13
HA (35%; Fig. 2 A). The products of both reactions were then added to magnetic beads coated with affinity purified anti-Kex2p tail antibodies. After immunoisolation, beads were assayed for Kex2p and DPAP activity. In both samples, >90% of Kex2p activity was associated with the beads after immunoisolation (unpublished data). In Kex2p-containing membranes immunoisolated from the "separate" reaction, no measurable DPAP activity was detected, whereas,
12% of the total DPAP activity from the "mixed" reaction was associated with the beads (Fig. 2 B). This indicated that the observed Ste13
HA processing correlated with membrane fusion, resulting in membranes containing both Kex2p and DPAP activity.
|
HA processing in the crude system did not require addition of exogenous ATP (Fig. 3 A), omission of the ATP regeneration system completely blocked processing (Fig. 3 A), indicating that the reaction was ATP dependent. Second, processing of Ste13
HA occurred with maximal efficiency between 25 and 30°C and was inhibited at temperatures below 15°C or above 35°C (Fig. 3 B), similar to the temperature dependence of other cell-free biological membrane fusion reactions (Baker et al., 1988; Latterich and Schekman, 1994). Third, dilution of the MSS membranes progressively inhibited Ste13
HA processing, indicating that membrane concentration was important for efficient fusion (Fig. 3 C). Fourth, addition of Triton X-100 (1% wt vol-1) completely inhibited Kex2p processing of Ste13
HA even though both Kex2p and DPAP were fully active under these conditions (unpublished data), indicating that membrane integrity was essential for efficient processing (Fig. 3 D). Furthermore, this result shows that for processing to be observed in this dilute system Kex2p must be coconcentrated along with the substrate Ste13
HA in the lumenal space of fused late Golgi membrane vesicles. Taken together, the characteristics of the reaction suggested that the observed Kex2p-dependent processing of Ste13
HA represented a biologically relevant vesicular transport or membrane fusion event between membrane compartments containing Kex2p and Ste13
HA.
|
HA into Kex2p-containing membranes, not processing of Ste13
HA per se, was inhibited by BAPTA (Fig. 4, C and D). Examination of the kinetics of a reaction partially inhibited by BAPTA revealed that both the initial rate and extent of the reaction were reduced (unpublished data).
|
|
transmembrane domain [TMD]) of the SNARE proteins were used to compete with the inhibitory activity of the antisera. Addition of excess purified Tlg2
TMDp blocked inhibition by anti-Tlg2p serum (Fig. 6 B), confirming the specificity of antibody inhibition. At levels of anti-Tlg1p antisera that inhibited
60% of fusion, preincubation of serum with 10 µg of purified Tlg1
TMDp blocked the majority of anti-Tlg1p inhibition (Fig. 6 B). The antigen competition was specific for Tlg1p because an equivalent molar concentration of Vti1
TMDp (also 10 µg; the proteins have nearly identical molecular weights) was ineffective at blocking anti-Tlg1p inhibition (Fig. 6 B). Antigen competition experiments with anti-Vti1p serum at levels that reduced membrane fusion by
60% required high levels of antigen (>20 µM). These levels of Vti1
TMDp (antigen) inhibited fusion, presumably by a competition mechanism (Bennett et al., 1993; Hua and Scheller, 2001) even in the absence of antiserum (Fig. 6 B). Significantly, addition of Vti1
TMDp to the anti-Vti1pinhibited reaction restored membrane fusion to the same level observed in the presence of Vti1
TMDp antigen alone (Fig. 6 B). As an additional control for the specificity of SNARE function in this reaction, we raised a new antiserum against the Tlg2p cytosolic domain (see Materials and methods) and compared the inhibitory effects of IgG purified from this new serum with IgG purified from antiserum raised against the ER/Golgi t-SNARE, Bet1p (Stone et al., 1997) (Fig. 6 C). After preincubation of MSS membranes with IgG levels roughly equivalent to 1 µl of unfractionated antiserum (
6 µg), anti-Tlg2p IgG inhibited membrane fusion, whereas anti-Bet1 IgG had no effect. Taken together, these results argue for specific roles for Tlg1p, Tlg2p, and Vti1p and a potential role for Vps45p in the fusion reaction.
|
HA. We observed an elevated fraction of DPAP activity in MSS membranes prepared from the vps21 mutant strain that could not be precipitated by anti-HA (10%; as opposed to
2% observed in the case of wild-type strains), indicating that this fraction of the Ste13
HA had undergone Kex2-independent cleavage of the HA tag in vivo. Further Kex2-independent processing was not observed upon incubation of the membranes under reaction conditions (Fig. 7 A). When Kex2p- and Ste13
HA-containing membranes prepared from vps21 mutant strains were incubated together under reaction conditions, no additional processing of Ste13
HA above the elevated background level was observed (Fig. 7 B, column 4 compared with 6). In contrast, normal levels of processing of Ste13
HA were displayed by reactions in which either the Kex2p- or the Ste13
HA-containing membranes were prepared from a wild-type VPS21 strain (Fig. 7 B). These results suggested that Vps21p was essential for the membrane fusion reaction and could be donated by either MSS fraction.
|
HA-containing VPS21 P200 membranes, from which the cytosolic pool of Vps21p had been removed, with Kex2p-containing vps21 MSS (i.e., membranes plus cytosol) should not result in membrane fusion. However, as shown in Fig. 7 C reactions containing P200 membranes from a Ste13
HA-expressing VPS21 strain and MSS membranes from a Kex2p-expressing vps21 strain supported a substantial level of fusion, two thirds as much as seen in a reaction containing P200 membranes from the Ste13
HA-containing VPS21 strain and MSS from the Kex2p-containing VPS21 strain. These data argue that the rab5 homologue Vps21p is required for the reaction and rab activity on either of the two participating membranes will suffice to support fusion. | Discussion |
|---|
|
|
|---|
Mutations in the genes encoding the components of the Tlg SNARE complex give rise to distinguishable phenotypes, suggesting that each of these proteins catalyzes an unique set of fusion events (von Mollard et al., 1997; Abeliovich et al., 1999; Coe et al., 1999). The fusion event we measure here appears to represent one reaction in which these three proteins participate together. Consistent with our data, a t-SNARE complex of Tlg1p, Tlg2p, and Vti1p has been found to pair specifically with Snc1p to catalyze fusion when reconstituted in liposomes (Paumet et al., 2001). Preliminary evidence suggests that Snc1p is likely to function as the v-SNARE in conjunction with the Tlg SNARE complex in homotypic TGN fusion (unpublished data); however, this remains to be conclusively demonstrated. This study provides a biochemical assay for the coordinate function of all of these proteins in a single fusion event involving physiological membranes.
Steady-state localization of transmembrane proteins to the TGN in yeast depends on continuous cycles of transport between TGN and post-Golgi endosomal compartments (Vida et al., 1993; Cereghino et al., 1995; Piper et al., 1995; Cooper and Stevens, 1996; Brickner and Fuller, 1997; Bryant and Stevens, 1997). Thus, this reaction could hypothetically represent vesicular transport events between the TGN and the PVC. However, our data suggest that the reaction described here does not correspond to a vesicular transport event. First, the reaction did not display the extended lag phase typical of cell-free vesicular transport (Balch et al., 1984; Baker et al., 1988; Vida and Gerhardt, 1999). Second, whereas the PVC t-SNARE Pep12p is required for TGN to PVC transport and the class E Vps protein Vps27p is required for PVC to TGN transport, the reaction we observed required neither protein based on the following observations. Membranes prepared from a pep12 temperature-sensitive mutant strain (Burd et al., 1997) were able to support processing of Ste13
HA after a 5-min preincubation at the restrictive temperature to inactivate the protein (unpublished data). Moreover, anti-Pep12p antiserum failed to inhibit the reaction. Membranes prepared from vps27-null or temperature-sensitive mutants were fully competent to support processing of Ste13
HA (unpublished data). Finally, there was no requirement for the trans-Golgi localization signal (TLS)1 (Brickner and Fuller, 1997) in the cytosolic tail of Kex2p, which would be required if the reaction involved transport of Kex2p from the PVC to the TGN (unpublished data).
Several lines of evidence argue that the reaction described here measures a homotypic fusion event. Homotypic fusion involves fusion of like organelles through the pairing of t-SNAREs and v-SNAREs distributed comparably onto the fusing membranes. In the case of homotypic vacuolar fusion, v-SNAREs can be genetically ablated from one membrane and t-SNAREs from the other and fusion can still proceed (Wickner and Haas, 2000). In contrast, heterotypic fusion requires pairing of a v-SNARE on a vesicle with t-SNAREs on the target membrane. The absence of either blocks the reaction. Ideally, mutations of SNARE genes therefore can allow the classification of a fusion reaction as homotypic or heterotypic as in the case of vacuolar fusion (Wickner and Haas, 2000). However, because the existence of the compartments to which our reporter proteins are localized depends on the components of the Tlg SNARE complex, such an experiment would be difficult to interpret. An alternative way to distinguish homotypic and heterotypic fusion is the sensitivity of the reaction to pretreatment of one of the membranes with antiserum against one of the participating SNARE proteins. We have found that in the reconstituted reaction involving pelleted membranes and cytosol pretreatment of either membrane before centrifugation with antisera against Tlg1p or Tlg2p was sufficient to completely inhibit the fusion reaction (unpublished data). Although this result is somewhat different from what was found in vacuolar fusion (see above), it argues that identical v- and t-SNAREs are present and are functional in the reaction on both of the fusing membranes, a necessary characteristic of homotypic fusion. Vps21p rab function was required, but on only one of the two membranes, to support membrane fusion. The symmetry inherent in the fact that rab activity on either membrane was sufficient supports the conclusion that the reaction occurs between two identical membranes.
Because both Kex2p and Ste13p cycle between the TGN and late endosomal compartments and possibly through early endosomal compartments (unpublished data) the fusion reaction between Kex2p- and Ste13
HA-containing membranes could represent homotypic fusion of TGN or early or late endosomal membranes. It seems unlikely that this reaction involves late endosomal/PVC membranes because (a) antibodies against Pep12p, the major late endosomal t-SNARE, did not inhibit the fusion reaction and (b) MSS membranes from vps27-null mutants, which accumulate aberrant late endosomal membranes, exhibited normal fusion activity (unpublished data). Subsets of components of the Tlg SNARE complex have been implicated in endocytosis (Tlg1p, Tlg2p, and Vps21p [Abeliovich et al., 1998; Seron et al., 1998; Gerrard et al., 2000]), biosynthetic traffic to the vacuole (Vti1p and Vps21p [Horazdovsky et al., 1994; von Mollard et al., 1997]), and early endosome homotypic fusion in mammalian cells (rab5/Vps21p; [Gorvel et al., 1991]). These observations could implicate the involvement of early endosomal membranes in this reaction. Although this possibility cannot be excluded at this time, we believe it is more likely that the homotypic fusion reaction described here represents fusion of TGN membranes. First, up to 45% of Ste13
HA was processed in this cell-free reaction, suggesting that at least half of the Ste13
HA is localized to the membrane compartment that participates in the reaction. Ste13p has been shown to possess a strong TGN retention signal that slows its delivery to the late endosome, presumably by retarding its exit from the TGN (Bryant and Stevens, 1997). Therefore, it is unlikely that the majority of Ste13
HA is localized to the endocytic compartments. Second, Tlg1p and Tlg2p have been colocalized with Kex2p in the late Golgi and have been shown to be required for its proper localization and activity (Holthuis et al., 1998). These SNAREs do not colocalize extensively with Pep12p, a late endosomal marker, or with Sec7p, an early Golgi marker (Lewis et al., 2000).
We hope to use the cell-free fusion assay described here to analyze the function of the Tlg SNARE complex and identify the cytosolic components required for the reaction. The basic assay we have described may also be applied to reconstitute other transport and fusion events in the TGN/endosomal system by exploiting the use of distinct localization signals or accumulation in specific compartments to achieve differential localization of the enzyme (Kex2p) and substrate (Ste13
HA). Finally, these results call attention to the need for developing assays for TGN homotypic fusion in vivo in order to understand its importance for TGN membrane protein localization and TGN function.
| Materials and methods |
|---|
|
|
|---|
FCS was from GIBCO BRL. Boc-Leu-Lys-Arg-7-amino-4-methylcoumarin (LKR-AMC) was from Bachem and Ala-Pro-AMC (AP-AMC) was from Enzyme Systems Products. Restriction endonucleases and DNA modification enzymes were from New England Biolabs, Inc. Unless indicated otherwise, all other chemicals and reagents were from Sigma-Aldrich.
Strains and plasmids
The following strains were used: JBY209 (ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 kex2
::hisG dap2
::kanr pep4
::HIS3 ste13
::LEU2 MAT
), JBY209a (isogenic with JBY209, except that it is MATa), and BLY9 (his3 leu2 trp1 ura3 kex2
::hisG dap2
::kanr pep4
::HIS3 ste13
::LEU2 vps21). BLY9 was constructed by crossing the vps21 allele from strain 0587-21 (provided by Dr. Scott Emr, University of California, San Diego, CA) into JBY209a and isolating His+, Leu+, G418r, Vps-, and kex2
segregants after sporulation. To create Kex2p- or Ste13
HA-expressing strains, plasmids pCWKX10 or pSTE13
HA, respectively, were introduced by transformation. Untransformed JBY209 was used as the kex2
control.
Plasmids pCWKX10 (Wilcox et al., 1992), containing the KEX2 gene under its own promoter, pTLG2HISN1 and pTLG1HISC1 (Holthuis et al., 1998), and pET28aHis6VTI1
TMD (Fukuda et al., 2000) have been described. Plasmid pSTE13
HA was constructed as follows. The STE13 gene was amplified by PCR from pBRSTE13 (Jeremy Thorner, University of California, Berkeley, CA) using the following primers (5' to 3'): GTTATTCGTGTAAAAAATCTAGAAAGCCCCTA, which anneals directly upstream of the start codon and introduces an XbaI site and CAATCATCCATAAAGAATTCTAAATGCAAA, which anneals at the end of STE13 and both introduces an EcoRI site and changes the termination codon to GAA. The PCR product was ligated between the XbaI and EcoRI sites of p416TEF (Mumberg et al., 1995). The resulting plasmid, pTEF-STE13, was digested with EcoRI and SalI and ligated to the following phosphorylated oligonucleotides, which had been annealed to each other (5' to 3'): AATTGGATGCATCGGAATTCAGCGGCCGCTTG and TCGACAAGCGGCCGCTGAATTCCGATGCATCC. The resulting plasmid, pTEF-STE13 linker, was digested with NsiI and ligated to the following phosphorylated and annealed oligonucleotides (5' to 3'): TGGCATTGGTTGCAACTAAAACCTGGCCAACCAATGTACAAGAGAGATGCA and TCTCTCTTGTACATTGGTTGGCCAGGTTTTAGTTGCAACCAATGCCATGCA, encoding the following amino acid sequence from prepro
-factor: Trp His Leu Gln Leu Lys Pro Gly Gln Pro Met Tyr Lys Arg Asp Ala, confirmed by DNA sequencing. The resulting plasmid, pSTE13
, was digested with NotI and ligated to NotI-digested triple HA tag (Tyers et al., 1992), giving pSTE13
HA.
Preparation of membranes and cytosol
Permeabilized cells were prepared from JBY209 containing pCWKX10 or pSTE13
HA as described (Baker et al., 1988). Frozen spheroplasts (200 µl) were thawed (25°C, 2 min) and centrifuged (5 min, 14,000 rpm), and MSS fraction (containing microsomes and cytosol) was collected. For assays in which membranes were separated from cytosol, MSS membranes were diluted fourfold with lysis buffer and centrifuged through a 250-µl band of 12.5% ficoll in a TLS55 rotor (Beckman Coulter) at 55,000 rpm (200,000 g at ravg) for 1 h at 4°C to generate a high speed pellet fraction (P200). The P200 was resuspended in lysis buffer to 15% of the MSS volume and assayed for Kex2p or DPAP activity. P200 fractions were diluted to the same specific activity as the MSS membranes; 10 µl were used per reaction. Cytosol was prepared by centrifugation of MSS from JBY209 in a TLS55 rotor at 55,000 rpm for 1 h at 4°C and was concentrated on microcon-10 columns (Millipore) to a final protein concentration of 2025 mg/ml as determined by the Bradford assay (Bio-Rad Laboratories).
Cell-free fusion
10 µl of MSS membranes from both the Kex2p- and Ste13
HA-expressing strains were added to 10 µl of 3x reaction mix (0.2 M sorbitol, 10 mM Hepes, pH 7, 75 mM KOAc, 4 mM MgOAc, 0.25 mM EGTA, 140 mM phosphocreatine, 0.375 mg ml-1 creatine kinase, and 9 mM CaCl2) on ice. Reactions were started by shifting to 30°C and unless indicated otherwise were incubated for 20 min. 10 µl were then removed and added to tubes containing either immunoprecipitation (IP) mix (1% Triton X-100, 1 mM EDTA, 20 µl pansorbin, 1 µl 12CA5 monoclonal anti-HA, and 1 µl rabbit antimouse IgG) or mock IP mix (1% Triton X-100, 1 mM EDTA, 20 µl pansorbin, and 2 µl water). IPs were incubated at RT with gentle agitation for 30 min. Pansorbin was pelleted, and 30 µl of each supernatant fraction were assayed for DPAP activity. The fraction of Ste13
HA processed was calculated as the ratio of DPAP activity in the supernatant fraction (i.e., the activity that was immunodepletion resistant) to the DPAP activity in the mock IP reaction (i.e., the total). Error bars represent the standard deviation of the average of at least two reactions.
Enzymatic assays
DPAP assays were performed as described (Julius et al., 1983). The supernatant fraction from the IP reactions (30 µl) was added to 30 µl 2x DPAP reaction mix (240 mM Hepes, pH 8, 1% Triton X-100, 200 µM AP-AMC), and reactions were incubated in 96-well plates at 30°C in an fmax plate fluorimeter (360 nm excitation/460 nm emission filter pair; Molecular Devices). Data were collected approximately every 20 s for 20 min. Kex2p was assayed as described (Brenner and Fuller, 1992) except that LKR-AMC was used as substrate and 5 mM o-phenanthroline was included to inhibit a membrane-associated Kex2p-independent activity present in crude lysates (Sipos and Fuller, 2001).
Immunoisolation of Kex2p membranes
Anti-Kex2p cytosolic tail antibodies were affinity purified (Redding et al., 1991). Dynabeads (Dynal) were covalently coated with affinity purified goat anti-rabbit IgG/Fc fragment-specific antibodies and bound to affinity purified anti-Kex2p tail antibodies as recommended by the manufacturer. Beads were washed three times with 50 mM Hepes, pH 7.0, 200 mM KOAc, 2 mM EDTA, and 5% FCS before use.
Reactions (scaled up twofold) were performed as described above. In control reactions, Kex2p- and Ste13
HA-expressing membranes were incubated separately in reaction mix and combined after incubation. At the end of the incubation, half of each reaction was processed for IP or mock IP to determine processing efficiency. The remainder (30 µl) was adjusted to 50 mM Hepes, pH 7.0, 200 mM KOAc, 2 mM EDTA, 5% FCS, and 0.8 M sorbitol in a final volume of 50 µl and added to 150 µg Dynabeads. Binding was performed for 2 h with slow rotation at RT. Beads were isolated magnetically, washed three times with cold 50 mM Hepes, pH 7, 200 mM KOAc, and 0.8 M sorbitol and assayed for Kex2p and DPAP activity.
Preparation of soluble domains of Tlg2p, Tlg1 p, and Vti1p
His6-Tlg2
TMDp was expressed in E. coli BL21 (DE3) and purified using ProBondTM (Invitrogen) according to manufacturer's denaturing protocol. Recombinant protein was eluted with 20 mM NaPO4, pH 4.0, and 1 M urea. Fractions enriched for recombinant protein were pooled, dialyzed in 20 mM NaPO4, pH 7.0, 1 M urea, and concentrated to 1020 mg ml-1 on microcon-10 columns. Tlg1-His6
TMDp and His6-Vti1
TMDp were expressed and purified as described above except that denaturants were omitted during lysis and purification and elution was performed with 400 mM imidazole-HCl in 20 mM NaPO4, pH 7.4, and 500 mM NaCl.
Antigen competition
Polyclonal antiserum (
100 µg total protein) was incubated with 1040 µg recombinant protein on ice for 1 h. Antigen-saturated serum was then incubated with MSS membranes on ice for 1 h, and the membranes were tested for fusion competence.
IgG purification
Antisera were dialyzed overnight in 500-vol 20 mM KPO4, pH 7.2. Dialyzed serum was loaded onto a column containing equal volumes of CM- and DEAE-Sepharose. Flow through was collected and concentrated on microcon-10 columns. IgG purity and concentration were determined by SDS-PAGE and the Bradford assay.
| Footnotes |
|---|
J.H. Brickner's present address is Dept. of Biochemistry and Biophysics, University of California, San Francisco, CA 94143.
* Abbreviations used in this paper: DPAP, dipeptidyl aminopeptidase; HA, hemagglutinin; IP, immunoprecipitation; MSS, medium speed supernatant; NEM, N-ethylmaleimide; NSF, NEM-sensitive fusion protein; P200, 200,000 g pellet; PVC, prevacuolar compartment; SNARE, soluble NSF attachment protein receptor; TGN, trans-Golgi network; TLS, trans-Golgi localization signal; TMD, transmembrane domain; t-SNARE, target membrane SNARE; v-SNARE, vesicle SNARE.
| Acknowledgments |
|---|
This work was supported in part by National Institutes of Health grant GM50915 to R.S. Fuller and by Genetics Training grant GM07544 to J.M. Blanchette.
Submitted: 23 April 2001
Revised: 23 October 2001
Accepted: 23 October 2001
| References |
|---|
|
|
|---|
Abeliovich, H., E. Grote, P. Novick, and S. Ferro-Novick. 1998. Tlg2p, a yeast syntaxin homolog that resides on the Golgi and endocytic structures. J. Biol. Chem. 273:1171911727.
Abeliovich, H., T. Darsow, and S.D. Emr. 1999. Cytoplasm to vacuole trafficking of aminopeptidase I requires a t-SNARE-Sec1p complex composed of Tlg2p and Vps45p. EMBO J. 18:60056016.[Medline]
Antonin, W., C. Holroyd, D. Fasshauer, S. Pabst, G. Fischer Von Mollard, and R. Jahn. 2000. A SNARE complex mediating fusion of late endosomes defines conserved properties of SNARE structure and function. EMBO J. 19:64536464.[Medline]
Baker, D., L. Hicke, M. Rexach, M. Schleyer, and R. Schekman. 1988. Reconstitution of SEC gene product-dependent intercompartmental protein transport. Cell. 54:335344.[Medline]
Balch, W.E., W.G. Dunphy, W.A. Braell, and J.E. Rothman. 1984. Reconstitution of the transport of protein between successive compartments of the Golgi measured by the coupled incorporation of N-acetylglucosamine. Cell. 39:405416.[Medline]
Bark, I.C., and M.C. Wilson. 1994. Regulated vesicular fusion in neurons: snapping together the details. Proc. Natl. Acad. Sci. USA. 91:46214624.
Bassham, D.C., A.A. Sanderfoot, V. Kovaleva, H. Zheng, and N.V. Raikhel. 2000. AtVPS45 complex formation at the trans-Golgi network. Mol. Biol. Cell. 11:22512265.
Bennett, M.K., J.E. Garcia-Arraras, L.A. Elferink, K. Peterson, A.M. Fleming, C.D. Hazuka, and R.H. Scheller. 1993. The syntaxin family of vesicular transport receptors. Cell. 74:863873.[Medline]
Block, M.R., B.S. Glick, C.A. Wilcox, F.T. Wieland, and J.E. Rothman. 1988. Purification of an N-ethylmaleimide-sensitive protein catalyzing vesicular transport. Proc. Natl. Acad. Sci. USA. 85:78527856.
Brenner, C., and R.S. Fuller. 1992. Structural and enzymatic characterization of a purified prohormone-processing enzyme: secreted, soluble Kex2 protease. Proc. Natl. Acad. Sci. USA. 89:922926.
Brickner, J.H., and R.S. Fuller. 1997. SOI1 encodes a novel, conserved protein that promotes TGN-endosomal cycling of Kex2p and other membrane proteins by modulating the function of two TGN localization signals. J. Cell Biol. 139:2336.
Bryant, N.J., and A. Boyd. 1993. Immunoisolation of Kex2p-containing organelles from yeast demonstrates colocalisation of three processing proteinases to a single Golgi compartment. J. Cell Sci. 106:815822.[Abstract]
Bryant, N.J., and T.H. Stevens. 1997. Two separate signals act independently to localize a yeast late Golgi membrane protein through a combination of retrieval and retention. J. Cell Biol. 136:287297.
Bryant, N.J., R.C. Piper, S.R. Gerrard, and T.H. Stevens. 1998. Traffic into the prevacuolar/endosomal compartment in Saccharomyces cerevisiae: a VPS45-dependent intracellular route and a VPS45-independent endocytic route. Eur. J. Cell Biol. 76:4352.[Medline]
Burd, C.G., M. Peterson, C.R. Cowles, and S.D. Emr. 1997. A novel Sec18p/NSF-dependent complex required for Golgi-to-endosome transport in yeast. Mol. Biol. Cell. 8:10891104.[Abstract]
Carr, C.M., E. Grote, M. Munson, F.M. Hughson, and P.J. Novick. 1999. Sec1p binds to SNARE complexes and concentrates at sites of secretion. J. Cell Biol. 146:333344.
Cereghino, J.L., E.G. Marcusson, and S.D. Emr. 1995. The cytoplasmic tail domain of the vacuolar protein sorting receptor Vps10p and a subset of VPS gene products regulate receptor stability, function, and localization. Mol. Biol. Cell. 6:10891102.[Abstract]
Coe, J.G., A.C. Lim, J. Xu, and W. Hong. 1999. A role for Tlg1p in the transport of proteins within the Golgi apparatus of Saccharomyces cerevisiae. Mol. Biol. Cell. 10:24072423.
Cooper, A.A., and T.H. Stevens. 1996. Vps10p cycles between the late-Golgi and prevacuolar compartments in its function as the sorting receptor for multiple yeast vacuolar hydrolases. J. Cell Biol. 133:529541.
Cowles, C.R., S.D. Emr, and B.F. Horazdovsky. 1994. Mutations in the VPS45 gene, a SEC1 homologue, result in vacuolar protein sorting defects and accumulation of membrane vesicles. J. Cell Sci. 107:34493459.[Abstract]
DeBello, W.M., V. O'Connor, T. Dresbach, S.W. Whiteheart, S.S. Wang, F.E. Schweizer, H. Betz, J.E. Rothman, and G.J. Augustine. 1995. SNAP-mediated protein-protein interactions essential for neurotransmitter release. Nature. 373:626630.[Medline]
Fukuda, R., J.A. McNew, T. Weber, F. Parlati, T. Engel, W. Nickel, J.E. Rothman, and T.H. Sollner. 2000. Functional architecture of an intracellular membrane t-SNARE. Nature. 407:198202.[Medline]
Fuller, R.S., A. Brake, and J. Thorner. 1989a. Yeast prohormone processing enzyme (KEX2 gene product) is a Ca2+-dependent serine protease. Proc. Natl. Acad. Sci. USA. 86:14341438.
Fuller, R.S., A.J. Brake, and J. Thorner. 1989b. Intracellular targeting and structural conservation of a prohormone-processing endoprotease. Science. 246:482486.
Gerrard, S.R., N.J. Bryant, and T.H. Stevens. 2000. VPS21 controls entry of endocytosed and biosynthetic proteins into the yeast prevacuolar compartment. Mol. Biol. Cell. 11:613626.
Gorvel, J.P., P. Chavrier, M. Zerial, and J. Gruenberg. 1991. rab5 controls early endosome fusion in vitro. Cell. 64:915925.[Medline]
Graham, T.R., and S.D. Emr. 1991. Compartmental organization of Golgi-specific protein modification and vacuolar protein sorting events defined in a yeast sec18 (NSF) mutant. J. Cell Biol. 114:207218.
Grote, E., C.M. Carr, and P.J. Novick. 2000. Ordering the final events in yeast exocytosis. J. Cell Biol. 151:439452.
Hata, Y., C.A. Slaughter, and T.C. Sudhof. 1993. Synaptic vesicle fusion complex contains unc-18 homologue bound to syntaxin. Nature. 366:347351.[Medline]
Holthuis, J.C., B.J. Nichols, S. Dhruvakumar, and H.R. Pelham. 1998. Two syntaxin homologues in the TGN/endosomal system of yeast. EMBO J. 17:113126.[Medline]
Horazdovsky, B.F., G.R. Busch, and S.D. Emr. 1994. VPS21 encodes a rab5-like GTP binding protein that is required for the sorting of yeast vacuolar proteins. EMBO J. 13:12971309.[Medline]
Hua, Y., and R.H. Scheller. 2001. Three SNARE complexes cooperate to mediate membrane fusion. Proc. Natl. Acad. Sci. USA. 98:80658070.
Julius, D., L. Blair, A. Brake, G. Sprague, and J. Thorner. 1983. Yeast alpha factor is processed from a larger precursor polypeptide: the essential role of a membrane-bound dipeptidyl aminopeptidase. Cell. 32:839852.[Medline]
Latterich, M., and R. Schekman. 1994. The karyogamy gene KAR2 and novel proteins are required for ER-membrane fusion. Cell. 78:8798.[Medline]
Lazar, T., M. Gotte, and D. Gallwitz. 1997. Vesicular transport: how many Ypt/Rab-GTPases make a eukaryotic cell? Trends Biochem. Sci. 22:468472.[Medline]
Lewis, M.J., B.J. Nichols, C. Prescianotto-Baschong, H. Riezman, and H.R. Pelham. 2000. Specific retrieval of the exocytic SNARE Snc1p from early yeast endosomes. Mol. Biol. Cell. 11:2338.
McNew, J.A., F. Parlati, R. Fukuda, R.J. Johnston, K. Paz, F. Paumet, T.H. Sollner, and J.E. Rothman. 2000. Compartmental specificity of cellular membrane fusion encoded in SNARE proteins. Nature. 407:153159.[Medline]
Mills, I.G., A.T. Jones, and M.J. Clague. 1999. regulation of endosome fusion. Mol. Membr. Biol. 16:7379.[Medline]
Mumberg, D., R. Muller, and M. Funk. 1995. Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene. 156:119122.[Medline]
Nichols, B.J., J.C. Holthuis, and H.R. Pelham. 1998. The Sec1p homologue Vps45p binds to the syntaxin Tlg2p. Eur. J. Cell Biol. 77:263268.[Medline]
Nothwehr, S.F., C.J. Roberts, and T.H. Stevens. 1993. Membrane protein retention in the yeast Golgi apparatus: dipeptidyl aminopeptidase A is retained by a cytoplasmic signal containing aromatic residues. J. Cell Biol. 121:11971209.
Paumet, F., B. Brügger, F. Parlati, J.A. McNew, T.H. Söllner, and J.E. Rothman. 2001. A t-SNARE involved in endocytosis must be activated for fusion. J. Cell Biol. 155:961968.
Peters, C., and A. Mayer. 1998. Ca2+/calmodulin signals the completion of docking and triggers a late step of vacuole fusion. Nature. 396:575580.[Medline]
Piper, R.C., A.A. Cooper, H. Yang, and T.H. Stevens. 1995. VPS27 controls vacuolar and endocytic traffic through a prevacuolar compartment in Saccharomyces cerevisiae. J. Cell Biol. 131:603617.
Poirier, M.A., W. Xiao, J.C. Macosko, C. Chan, Y.K. Shin, and M.K. Bennett. 1998. The synaptic SNARE complex is a parallel four-stranded helical bundle. Nat. Struct. Biol. 5:765769.[Medline]
Redding, K., C. Holcomb, and R.S. Fuller. 1991. Immunolocalization of Kex2 protease identifies a putative late Golgi compartment in the yeast Saccharomyces cerevisiae. J. Cell Biol. 113:527538.
Rexach, M.F., and R.W. Schekman. 1991. Distinct biochemical requirements for the budding, targeting, and fusion of ER-derived transport vesicles. J. Cell Biol. 114:219229.
Rothman, J.E., and F.T. Wieland. 1996. Protein sorting by transport vesicles. Science. 272:227234.[Abstract]
Ruohola, H., A.K. Kabcenell, and S. Ferro-Novick. 1988. Reconstitution of protein transport from the endoplasmic reticulum to the Golgi complex in yeast: the acceptor Golgi compartment is defective in the sec23 mutant. J. Cell Biol. 107:14651476.
Schiavo, G., M.J. Gmachl, G. Stenbeck, T.H. Sollner, and J.E. Rothman. 1995. A possible docking and fusion particle for synaptic transmission. Nature. 378:733736.[Medline]
Seron, K., V. Tieaho, C. Prescianotto-Baschong, T. Aust, M.O. Blondel, P. Guillaud, G. Devilliers, O.W. Rossanese, B.S. Glick, H. Riezman, et al. 1998. A yeast t-SNARE involved in endocytosis. Mol. Biol. Cell. 9:28732889.
Sipos, G., and R.S. Fuller. 2001. Separation of Golgi and endosomal compartments. Methods Enzymol. In press.
Sollner, T., S.W. Whiteheart, M. Brunner, H. Erdjument-Bromage, S. Geromanos, P. Tempst, and J.E. Rothman. 1993. SNAP receptors implicated in vesicle targeting and fusion. Nature. 362:318324.[Medline]
Stone, S., M. Sacher, Y. Mao, C. Carr, P. Lyons, A.M. Quinn, and S. Ferro-Novick. 1997. Bet1p activates the v-SNARE Bos1p. Mol. Biol. Cell. 8:11751181.[Abstract]
Sutton, R.B., D. Fasshauer, R. Jahn, and A.T. Brunger. 1998. Crystal structure of a SNARE complex involved in synaptic exocytosis at 2.4 A resolution. Nature. 395:347353.[Medline]
Tyers, M., G. Tokiwa, R. Nash, and B. Futcher. 1992. The Cln3-Cdc28 kinase complex of S. cerevisiae is regulated by proteolysis and phosphorylation. EMBO J. 11:17731784.[Medline]
Vida, T., and B. Gerhardt. 1999. A cell-free assay allows reconstitution of Vps33p-dependent transport to the yeast vacuole/lysosome. J. Cell Biol. 146:8598.
Vida, T.A., G. Huyer, and S.D. Emr. 1993. Yeast vacuolar proenzymes are sorted in the late Golgi complex and transported to the vacuole via a prevacuolar endosome-like compartment. J. Cell Biol. 121:12451256.
von Mollard, G.F., S.F. Nothwehr, and T.H. Stevens. 1997. The yeast v-SNARE Vti1p mediates two vesicle transport pathways through interactions with the t-SNAREs Sed5p and Pep12p. J. Cell Biol. 137:15111524.
Warren, G., and V. Malhotra. 1998. The organisation of the Golgi apparatus. Curr. Opin. Cell Biol. 10:493498.[Medline]
Wickner, W., and A. Haas. 2000. Yeast homotypic vacuole fusion: a window on organelle trafficking mechanisms. Annu. Rev. Biochem. 69:247275.[Medline]
Wilcox, C.A., and R.S. Fuller. 1991. Posttranslational processing of the prohormone-cleaving Kex2 protease in the Saccharomyces cerevisiae secretory pathway. J. Cell Biol. 115:297307.
Wilcox, C.A., K. Redding, R. Wright, and R.S. Fuller. 1992. Mutation of a tyrosine localization signal in the cytosolic tail of yeast Kex2 protease disrupts Golgi retention and results in default transport to the vacuole. Mol. Biol. Cell. 3:13531371.[Abstract]
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|