|
||
© The Rockefeller University Press,
0021-9525/2002/1/41 $5.00
The Journal of Cell Biology, Volume 156, Number 1, January 7, 2002 41-52
Article |
A predominantly nuclear protein affecting cytoplasmic localization of ß-actin mRNA in fibroblasts and neurons
Address correspondence to Robert H. Singer, Dept. of Anatomy and Structural Biology, Albert Einstein College of Medicine, 1300 Morris Park Ave., Bronx, NY 10461. Tel.: (718) 430-8646. Fax: (718) 430-8697. E-mail: rhsinger{at}aecom.yu.edu
| Abstract |
|---|
|
|
|---|
The localization of ß-actin mRNA to the leading lamellae of chicken fibroblasts and neurite growth cones of developing neurons requires a 54-nt localization signal (the zipcode) within the 3' untranslated region. In this study we have identified and isolated five proteins binding to the zipcode. One of these we previously identified as zipcode binding protein (ZBP)1, a 4-KH domain protein. A second is now investigated in detail: a 92-kD protein, ZBP2, that is especially abundant in extracts from embryonic brain. We show that ZBP2 is a homologue of the human hnRNP protein, KSRP, that appears to mediate pre-mRNA splicing. However, ZBP2 has a 47amino acid (aa) sequence not present in KSRP. Various portions of ZBP2 fused to GFP indicate that the protein most likely shuttles between the nucleus and the cytoplasm, and that the 47-aa insert promotes the nuclear localization. Expression of a truncated ZBP2 inhibits the localization of ß-actin mRNA in both fibroblast and neurons. These data suggest that ZBP2, although predominantly a nuclear protein, has a role in the cytoplasmic localization of ß-actin mRNA.
Key Words: RNA localization; RNA binding proteins; nuclear-cytoplasmic trafficking; RNA splicing; KH domain proteins
| Introduction |
|---|
|
|
|---|
The localization of ß-actin mRNA in motile fibroblasts and growth cones of developing neurons provides good models by which to understand the molecular mechanism whereby specific mRNAs are transported and targeted to precise cytoplasmic environments, hence promoting cellular asymmetry. Spatially restricted synthesis of actin proteins results from targeting of ß-actin mRNA at the leading edge of chicken embryonic fibroblasts (CEFs)* where actin polymerization drives cell motility (Kislauskis et al., 1994). Fibroblasts with localized ß-actin mRNA migrate significantly further than those with nonlocalized ß-actin mRNA (Kislauskis et al., 1997). In cultured rat and chicken developing neurons, the sorting of ß-actin mRNA to neurite growth cones has also been observed (Bassell et al., 1998; Zhang, et al., 1999), and mRNA localization is necessary for enrichment of ß-actin protein and forward movement of growth cones (Zhang et al., 2001). These data suggest that neurons and fibroblasts may share a similar mechanism for sorting of ß-actin mRNA.
We have previously reported a cis-acting element, the zipcode, which is necessary and sufficient for asymmetric segregation of ß-actin mRNA in fibroblasts. Deletion or mutation of the zipcode delocalized a reporter mRNA, and antisense treatment of the zipcode affected the regional synthesis of ß-actin protein and, as a consequence, the cell motility (Kislauskis et al., 1994, 1997; Shestakova et al., 2001; Zhang et al., 2001). A cytoplasmic trans-acting factor, zipcode binding protein(ZBP)1, has been characterized (Ross et al., 1997); it bound to the zipcode of ß-actin mRNA, but did not bind to a mutated zipcode incapable of asymmetrically localizing a reporter. Recently, the Xenopus homologue of ZBP1 has been identified by virtue of its binding to a localization element in Vg1 mRNA, an RNA that becomes localized to the vegetal pole of oocytes (Deshler et al., 1998; Havin et al., 1998). This implies that a common machinery may exist for targeting different mRNAs in diverse cell types.
It is likely that ZBP1 is a member of the locasome, a complex of proteins specialized for localization (Bertrand et al., 1998). Because ß-actin mRNA is also localized in neurons, we searched for the complex in brain extracts. In this work we report a second protein that binds to the zipcode and is highly enriched in brain. We show that ZBP2 is a homologue of human hnRNP protein, KSRP, that regulates premRNA splicing (Min et al., 1997). Interestingly, ZBP2, like KSRP, is predominately a nuclear protein. The in vitro and in vivo data suggest that ZBP2 also has a small fraction present in the cytoplasm and may spend a short time in the cytoplasm, and in this way may contribute to the subcellular localization of ß-actin mRNA.
| Results |
|---|
|
|
|---|
|
68 kD, the same molecular mass as ZBP1 (Ross et al., 1997). Complexes M and S (the brain-enriched bands) contained a crosslinked protein with an estimated molecular mass of
92 kD. The migration difference of complexes M and S in native gel, and the identity in molecular mass on SDS-PAGE, suggested that complex S could be a dimer of complex M. From these data we conclude that the 68- and 92-kD proteins bind to the zipcode, the ß-actin mRNA localization signal. The 68-kD band is likely ZBP1, but the other ZBP is preferentially expressed in brain. The 92-kD protein was named ZBP2. The fact that they segregate into separate complexes indicates that ZBP1 and ZBP2 do not bind simultaneously to the zipcode.
Purification of ZBPs
To identify the brain-enriched protein, we purified ZBPs by using RNA affinity selection techniques. We passed brain or cultured fibroblast extracts over an affinity chromatography column containing zipcode RNA. After extensive washes, the proteins retained on the column were eluted with increasing salt concentration steps and analyzed by SDS-PAGE with silver staining (Fig. 2 A). Although the starting extract and flow-through fraction were heterogeneous (Fig. 2 A, lane 1), after a series of washes (lanes 25), specific proteins were eluted with increasing salt conditions (Fig. 2 A, lanes 79). The protein fraction eluted with 1 and 2 M KCl contained distinct protein bands (Fig. 2 A, lanes 8 and 9, arrows); three proteins were
68 kD and one was 92 kD. The estimated molecular masses were in close agreement with that of the UV-crosslinked RNAprotein complexes identified by SDS-PAGE (Fig. 1 B). A lower molecular mass protein (53 kD) had also been detected previously (Ross et al., 1997).
|
Microsequencing of affinity purified proteins
Proteins in the 2-M KCl fraction of RNA affinity column (Fig. 2 A, lane 9) were concentrated with a centricon-30 filter, resolved in 12% SDS-PAGE, and visualized by Coomassie blue staining. Four protein bands of
92, 70, 65, and 45 kD were eluted from the gel and microsequenced. Six peptides of the purified 92-kD protein, which we named ZBP2, were obtained after microsequencing. A database search with the peptide sequences of ZBP2 revealed that the six peptides matched a human nuclear protein, KSRP, that has been previously identified as a regulatory splicing factor (Min et al., 1997). The other three proteins were also identified by their peptide sequences. The 70-kD protein was a homologue of a human protein, FBP, which was known as a transcription factor for the c-myc gene (Duncan et al., 1994). The 65-kD protein was an unknown protein. We did not sequence the 68-kD protein, as we assumed that this protein was ZBP1 (Ross et al., 1997). The 45-kD protein was identified as ssDBF, a single-strand DNA binding factor in chicken (Smidt et al., 1995), and was homologous to a human protein, ABBP, a type A/B hnRNP protein that plays a role in mRNA editing (Lau et al., 1997).
Isolation of chicken cDNA for ZBP2
The cDNA-encoding ZBP2 was obtained by screening three chicken cDNA libraries and rapid amplification of cDNA ends (RACE)-PCR amplification of the 5' terminus. The ZBP2 and the human KSRP share
81% identity in the nucleic acid sequence and >86% identity in amino acid (aa) sequence (Fig. 3), indicating that ZBP2/KSRP is a highly conserved protein. As with human KSRP and ZBP1, ZBP2 also contains four hnRNP type K homology RNA binding (KH) domains and a COOH-terminal region enriched in glutamines, with four repeats of an AWEEYYK motif and an NH2-terminal proline-glycine rich domain (Fig. 3). However, chicken ZBP2 contains a 47-aa segment before the first KH domain not found in KSRP, and significant sequence differences in the 5' end of the mRNA.
|
|
Developmental regulation of ZBP2
To determine the expression pattern of ZBP2 in developing neurons, protein extracts were prepared from different developmental stages of chicken brain and analyzed for ZBP2 levels by Western blotting (Fig. 5). The highest expression of ZBP2 was seen in 6-d embryos (Fig. 5, 6 d), the level of expression was reduced to 30% before hatching and remained stable thereafter (Fig. 5). In contrast, the amount of ß-actin protein is nearly constant in the same time points. This is consistent with the events during neural embryogenesis, when axons and dendrites are at maximal growth, and also coincides with the expression of ZBP1 (unpublished data).
|
|
ZBP2 and ß-actin mRNA are physically associated
To determine whether the ZBP2 and ß-actin mRNA could be physically associated, we employed immunoprecipitation followed by RT-PCR assays to determine whether the immunoprecipitated pellet with anti-ZBP2 antibodies contained ß-actin mRNA (Fig. 7). RNA was isolated from the immunoprecipitated pellet from brain extract using either anti-ZBP2 antibodies or rat preimmune serum, and then subjected to RT-PCR. A 398-bp fragment of the ß-actin mRNA 3' untranslated region (UTR) was chosen for PCR amplification. We used a plasmid without ß-actin cDNA as a negative control (Fig. 7, lane 1), and a plasmid with ß-actin cDNA as a positive control (Fig. 7, lane 6). A fragment of the 3' UTR of ß-actin mRNA was amplified from the immunoprecipitations with ZBP2 antiserum or antibodies (Fig. 7, lanes 3 and 5). The immunoprecipitations with preimmune rat serum or IgG did not demonstrate any PCR-amplified DNA fragments (Fig. 7, lanes 2 and 4). This experiment indicated that ß-actin mRNA and ZBP2 were most likely physically associated with each other in chicken brain extracts.
|
|
400 aa including the 47 aa with four KH domains (Fig. 8 C), was transfected into CEFs. We postulated that the KH domains would compete for RNA binding with the full-length ZBP2, analogous to ZBP1 (unpublished data), and hence act as a dominant negative for ß-actin mRNA localization. The EGFP signal in fibroblasts transfected with the truncate was mainly present in the nucleus. Localization of the ß-actin mRNA was visualized by fluorescence in situ hybridization. The percentage of cells with localized ß-actin mRNA decreased roughly by half in the transfected CEFs (Fig. 9, top) in contrast to the cells transfected with EGFP or EGFP-KSRP as a control (the human ZBP2 homologue). The intensity of cytoplasmic signal of ß-actin mRNA did not change significantly, indicating that the nuclear export of ß-actin mRNA was not inhibited by the dominant negative construct (unpublished data). In transfected developing neurons, this truncation also caused a 35% decrease of ß-actin mRNA signal in processes or growth cones compared with the control experiment (Fig. 9, middle). This suggested that the overexpression of the truncated, but still nuclear, ZBP2 affected the ß-actin mRNA localization. To demonstrate that the dominant negative effect of ZBP2 truncate is specific, we performed cotransfections of both the full-length ZBP2 and central domain into CEFs. The delocalization of ß-actin mRNA in transfected cells was partially rescued by using the wild-type ZBP2 (Fig. 9, bottom).
|
| Discussion |
|---|
|
|
|---|
The amino acid sequence predicted from ZBP2 cDNA demonstrates that ZBP2 is a chicken homologue of human KSRP, a regulatory splicing factor (Min et al., 1997). Like ZBP1 (Ross et al., 1997), KSRP/ZBP2 contains four KH domains, a glutamine-rich COOH-terminal domain, and a proline, glycine-rich NH2-terminal domain that may provide flexibility for the protein to fold properly. In addition, ZBP2 is particularly abundant in cell nuclei where it could also be involved in splicing of many pre-mRNAs, possibly including ß-actin, as well as their localization.
Our results provide evidence that ZBP2 interacts with the zipcode in vitro and participates in ß-actin mRNA localization in vivo. First, the recognition of the zipcode by ZBP2 is specific: it does not bind to nonzipcode RNA. This was demonstrated using RNA competition and immunodepletion assays wherein the formation of the RNAprotein complexes was abolished. That the mutant zipcode failed to bind ZBP2 in vitro is consistent with the previous study showing that mutated zipcode delocalized ß-actin mRNA in vivo (Ross et al., 1997). Second, we verified the physical association of ZBP2 with the zipcode using UV to covalently crosslink it to the zipcode, and by immunoprecipitation where the ß-actin mRNA copurified with it in brain extracts. Third, immunocytochemistry and in situ hybridization showed ZBP2 present infrequently in the cytoplasm, where it colocalized with ß-actin mRNA at the leading edge of fibroblasts and growth cones of developing neurons. Moreover, EGFPZBP2 transfected into fibroblasts, although also infrequently cytoplasmic, showed a similar colocalization pattern to the endogenous ZBP2 and ß-actin mRNA, suggesting that the movement of ZBP2 toward the cell's leading edge was associated with localization of the mRNA. Importantly, the expression of a truncated construct of ZBP2 containing the central KH domains and the nuclear localizer 47 aa interfered with endogenous ß-actin mRNA localization.
ZBP2, a predominantly nuclear protein, is shown here to play a role in cytoplasmic transport of ß-actin mRNA by binding to the localization signal. Of interest, ZBP2 has similarities to ZBP1, a predominantly cytoplasmic protein, which also is involved in ß-actin mRNA localization in fibroblasts and neurons (Zhang et al., 2001). However, unlike ZBP2, ZBP1 has a nuclear export signal (Ross et al., 1997), which may explain its predominate cytoplasmic localization. Although both ZBP1 and ZBP2 are in different cellular compartments, they share many common features. Both ZBP1 and ZBP2 recognize the wild-type zipcode, but not the mutant zipcode in vitro, and colocalize with ß-actin mRNA in vivo (Ross et al., 1997; Zhang et al., 2001). Therefore, the two hnRNP proteins, one cytoplasmic and the other nuclear, are involved in localization of the same mRNA. We propose that the process for ß-actin mRNA localization may initiate in nuclei where ZBP2 may interact with the zipcode, perhaps with other proteins, such as ssDBF and FBP. Upon nuclear export of the RNA, ZBP1 may take over the process of cytoplasmic localization. The fact that the proteins form different complexes with the zipcode suggests that they bind sequentially rather than simultaneously.
Increasing evidence demonstrates that specific interactions between RNA localization elements and cellular factors play an essential role in cytoplasmic sorting of mRNAs to their destinations. Strikingly, although mRNA localization is a cytoplasmic event, proteins that shuttle between the nucleus and cytoplasm participate in this pathway. A number of other nuclear proteins participating in cytoplasmic mRNA localization have been documented in recent studies (Hoek et al., 1998; Cote et al., 1999; Lall et al., 1999; Long et al., 2001). VgRBP60, a hnRNP I type protein in Xenopus, binds to the VM1 localization motif of Vg1 mRNA in vitro and colocalizes with Vg1 mRNA in vivo (Cote et al., 1999). Lall et al. (1999) reported that sqd, a Drosophila hnRNP protein is required for ftz mRNA localization in embryos. In yeast, an exclusively nuclear protein (does not shuttle), Loc1p, binds to the 3' UTR zipcode of ASH 1 mRNA and is required for its efficient cytoplasmic localization to the bud tip (Long et al., 2001). Therefore, our finding that ZBP2, an hnRNP protein with known nuclear location, was involved in cytoplasmic localization of ß-actin mRNA was consistent with hnRNPs being part of a common localization mechanism. It is possible that hnRNPs including ZBP2/KSRP are required for packaging the RNA in nucleus in a way that marks it for a localization pathway in the cytoplasm.
The fact that ZBP2 is only found in the cytoplasm of 510% of the cells strongly suggests that it rapidly shuttles, spending a short time there. This is the opposite of ZBP1, which spends only a short time in the nucleus (unpublished data) and is predominantly cytoplasmic. The 47-aa segment has a strong effect on ZBP2 nuclear retention, just as the nuclear export signal in ZBP1 has a strong effect on its cytoplasmic presence (unpublished data). When removed from ZBP2, the 47-aa segment increases the presence in the cytoplasm. KSRP, which does not have this 47-aa segment, also does not appear in the cytoplasm, at appreciable levels. Possibly KSRP is an alternatively spliced variant of ZBP2, but we have not found evidence for this in chicken, which does not appear to have KSRP. Like KSRP, ZBP2 is a member of a KH domaincontaining family of neuronally expressed proteins which include KSRP, ZBP1, FMRP (Fridell et al., 1996), and NOVA (Polydorides et al., 2000), all involved in some aspects of the nuclear regulation of RNA.
Microsequencing of the other proteins copurified with ZBP2/KSRP by RNA affinity selection showed that the 70-kD protein is also a KH domain containing protein, a homologue of FBP, a human transcription factor, that binds to single-stranded DNA and activates the transcription of the c-myc gene (Duncan et al., 1994). It is possible that FBP was copurified with ZBP2 because it has been shown that FBP associates with KSRP in human nuclear extracts (Min et al., 1997). However, this does not eliminate the possibility that FBP may have a function in cytoplasmic mRNA distribution. The 45-kD protein, which was copurified with ZBP2, is ssDBF, a nuclear hnRNP A/B type protein that binds to the regulatory site of apo VLDL II gene (Smidt et al., 1995), and a human homologue of ssBDF is involved in Apo mRNA editing (Lau et al., 1997). ssDBF shares
74% identity with MBP mRNA binding protein (Hoek et al., 1998), and 41% identity with sqd, the ftz binding protein in Drosophila (Lall et al., 1999), both of which are also hnRNA A/B proteins. Whereas both MBP mRNA binding protein and sqd appear to perform an essential role for localization of their respective mRNAs, ssDBF involvement in cytoplasmic ß-actin mRNA segregation remains to be determined.
These proteins could be part of a complex that we have termed the locasome (Bertrand et al., 1998). This structure most likely contains proteins unique to both the nucleus and the cytoplasm, in the first case marking the RNA for localization, and in the second case directing the peripheral location to the leading edge of the fibroblast or the growth cone of the developing neuron.
| Materials and methods |
|---|
|
|
|---|
1020 µg/µl. To prepare CEF extract, fibroblasts were isolated from breast muscle tissue of 11-d-old chick embryos. Cells were grown to
95% confluency (Kislauskis et al., 1994), and then scraped and washed in cold buffer A and pelleted by centrifugation (Ross et al., 1997). The cells were resuspended in buffer A and homogenized in a Dounce homogenizer. Homogenates were centrifuged as described above. The protein concentration of prepared extract was 510 µg/µl.
Neuronal cultures
Primary cultures of embryonic chick forebrain neurons were generated as described previously (Zhang et al., 1999). Briefly, forebrains were dissected from 8-d chick embryos, trypsinized, dissociated, and plated on poly-L-lysine (0.2 mg/ml, 16 h) and laminin- (0.02 mg/ml, 12 min) coated coverslips in MEM with 10% FBS for 2 h. Cells were inverted onto a monolayer of chick astrocytes in N2-conditioned medium with serum (0.2% FBS) and cultured for 4 d at 37°C in 5% CO2.
In vitro RNA transcription
The pCZIP was constructed by inserting the 54 nucleotide zipcode of chick ß-actin mRNA into a pSP64-Poly(A) vector (Promega) at Hind III and Ava I sites. To construct the pCZIPm plasmid, the following pair of complementary oligos were synthesized, annealed, and inserted between Hind III and Ava I sites of pSP64 Poly(A) vector: Sense: 5' AGCTTACCGGACT-GTTACCATGTGTGTGTGTGCTGTGATGAAACAAAACCCATAAATGC 3' and antisense: 5' CCGGGCATTTATGGGTTTTGTTTCATCCAGCACACACACACATGGTAACAGTCCGGTA 3'.
For gel mobility shift assays, [32P]-labeled RNA was generated by SP6 RNA polymerase directed in vitro transcription from Ava I linearized pCZIP DNA. The transcribed RNA was gel purified by 6%. For RNA affinity purification, polyadenylated transcripts were synthesized in vitro with SP6 polymerase (MEGAScript kit; Ambion) from EcoRI-linearized pCZIP constructs. Trace amounts of [32P]-CTP were added to allow detection and quantitation of transcribed RNA. The transcribed RNA contained the 54 nts of pCZIP RNA and a poly(A) tail of 30 nts.
Gel mobility shift assay and UV crosslinking
Briefly, 105 CPM of the [32P]-labeled RNA probe was incubated at room temprature with 5 µl of brain or fibroblast protein extract for 20 min in a 20-µl binding solution containing 20 mM Hepes, pH 7.4, 50 mM KCl, 3 mM MgCl2, 2 mM DTT, and 5% glycerol. Unbound RNAs were degraded by a 10-min incubation with 1 U of RNase T1, and nonspecific RNAprotein interactions were minimized by incubation with 5 mg/ml heparin for 10 min. The RNAprotein complexes formed were separated in a 4% native gel and visualized by autoradiography. To establish the specificity of RNA-protein interactions, competition assays were performed by preincubating the protein extract with unlabeled RNA competitors.
UV crosslinking of RNAprotein complexes was performed by irradiating the reactions on ice in a UV Chamber (GS gene linker; Bio-Rad Laboratories) with 254-nm, 8-W UV bulbs for 10 min and resolved by 4% native gel. The UV crosslinked RNAprotein complexes, detected by autoradiography, were cut from the gel, mixed with SDS loading buffer and incubated with 10 U RNase T1 for 30 min at room temperature. The gel slices were loaded on a 10% SDS-polyacrylamide gel and electrophoresed to distinguish the RNAprotein complexes.
Affinity purification of proteins that bind to RNA
2 ml of poly(U) agarose beads (type 6; Amersham Pharmacia Biotech) were suspended in RNA binding buffer (25 mM Tris HCl, pH 7.4, 100 mM KCl) and packed into a 10-ml column. About 1 mg in vitro synthesized poly(A) zipcode RNA was added to the column and cycled four times. The efficiency of RNA bound to poly(U) agarose beads was monitored by measuring the amount of [32P]-labeled RNA present in the RNA preparation. After binding, the beads were equilibrated with the extract buffer, mixed with 40 ml of brain protein extracts or 20 ml fibroblast extracts containing 50 U/ml RNasin (Promega), and incubated for 1 h at room temperature with gentle shaking. To lower nonspecific protein binding, yeast tRNA and heparin were added to 50 µg/ml and 5 mg/ml to binding buffer, respectively. The beads were then centrifuged for 2 min at 1,000 g, resuspended in binding buffer, and repacked into a 10-ml column. The column was extensively washed in 5 x 20 ml of binding buffer as follows: (1) binding buffer; (2) binding buffer + 40 µg/ml yeast RNA; (3) binding buffer + 5 mg/ml heparin; (4) binding buffer + 0.1% Triton X-100; and (5) binding buffer only. Proteins retained on the RNA affinity column were step eluted with 20 mM Hepes buffer, pH 7.4, containing 0.5, 1, and 2 M KCl. The eluted proteins were analyzed by SDS-PAGE and band shift assay.
Production of rat anti-ZBP2 antibodies
The 2-M KCl elution fraction from zipcode affinity column was concentrated with centricon-30 filter and eletrophoresed in 10% SDS-PAGE. After staining with Coomassie blue, the expected protein bands were cut from the gel, crushed, mixed with adjuvant, and injected into rats (Covance, Inc.) for antibody production. The titer of the antiserum was tested by immunoblot.
Immunoblotting
Aliquots of proteins were resolved in 10% SDS-PAGE and transferred onto Zeta membranes by a semidry transferring blotter (Bio-Rad Laboratories). The membranes were blotted overnight with PBS containing 5% nonfat milk at 4°C and then incubated with antiserum against ZBP2 (1:2,000) in PBS containing 1% BSA for 2 h at room temperature. After washing three times with PBS/0.3% Tween-20, the membranes were incubated with horseradish peroxidase conjugated goat antirat antibodies (1:8,000), ZBP2 was detected with the ECL system (Amersham Pharmacia Biotech) or with DAB/H2O2.
Immunoprecipitation and ß-actin mRNA detection
10 µg purified antibodies or 5 µl of antiserum against ZBP2 were incubated with 100 µl of brain protein extract for 1 h at 4°C with gentle agitation. 30 µl of protein Gcoupled agarose beads (Pierce Chemical Co.) were added to the mixture and incubated for another 1 h at 4°C. After centrifugation for 5 min at 1,500 g, the supernatant was taken for immunoblotting and RNA band shift assays. For analysis of ZBP2, the pelleted agarose beads were extensively washed with PBS and the proteins bound to the beads were eluted with 100 µl of ImmunoPure IgG Elution Buffer (Pierce Chemical Co.). For detecting ß-actin mRNA, the pelleted agarose beads were washed three times with DEPC-PBS, resuspended in 100 µl DEPC water and boiled for 10 min. Total RNA was extracted from the supernatant using TRIzol RNA isolation reagent (GIBCO BRL). RT-PCR for ß-actin mRNA was performed for 20 cycles with 1 µl of RNA as template using ReadyToGo RT-PCR-beads (Amersham Pharmacia Biotech). The following primers were used for amplification: 5' CTGACACCTTCACCATTCCAG 3' and 5' ATTGCTGACAGGATGCAGAAG 3'. The expected PCR product is a 398-bp DNA fragment of ß-actin mRNA in 3' UTR at the positions of 10211419.
Isolation and cloning of ZBP2 cDNA
Two primers, zbp21 and zbp22, were designed and synthesized according to the two peptide sequences (ZBP2 amino acids 621627 and 685709, respectively) and human KSRP cDNA sequence (zbp21 GCTTGGGAGGAGTACTACAA, zbp22 AGGACCTGGGGTCTGTCCGTA): A 200-bp DNA fragment was amplified from a chicken embryo brain library (CLONTECH Laboratories, Inc.) and verified by sequencing. This fragment was used for screening the chicken embryo brain library. Two cDNA clones were isolated from the library screening. After sequence analysis, it was evident that both clones contained a 500-bp COOH-terminal coding sequence followed by 150 bp of 3' UTR. 5' RACE PCR was applied to obtain an NH2-terminal fragment of ZBP2 (CLONTECH Laboratories, Inc.) RACE 4 primers were used in the 5' RACE experiment (RACE61: CACGCGGCGTTGGGGTCGGCTGC, RACE7: TTATAGGCGGCCCA-CGCGGCGTTGG, RACEF1: GAACGCGTCCTTCCGGATCC, RACEF2: CCCAATTTTTGCCGCTATCTG). The sequences of DNA fragments amplified by RACE were determined by automated DNA sequence analyses. The full-length gene was spliced together by PCR and confirmed by sequencing.
In situ hybridization and immunocytochemistry
In situ hybridization was performed on fibroblasts as described by Kislauskis et al. (1993), and on neurons as described by Zhang et al. (1999). 9-d-old CEFs were cultured in MEM supplemented with 10% FCS. After growing on coverslips for 2 d, the cells were fixed in 4% paraformaldehyde in PBS for 10 min and permeabilized with 0.5% Triton X-100 for another 10 min at room temperature. Distribution of ZBP2 in CEFs was visualized by incubation of rat antiserum against ZBP2 (1:800) followed by Cy3 or FITC conjugated rabbit antirat antibodies (1:500; Jackson ImmunoResearch Lab). Neurons were cultured in N2 conditioned media with 2% fetal bovine serum (FBS) for 2 or 4 d and fixed in 4% paraformaldehyde in PBS for 15 min at room temperature. After permeabilization with 0.5% Triton X-100, the cells were incubated with rat antiserum against ZBP2 (1:750) followed by Cy3-labeled rabbit antirat antibodies (1:750). For in situ hybridization and immunochemistry, cells were first processed for hybridization of ß-actin mRNA, washed with PBS, and immunostained as previously described (Zhang et al., 1999). Cells were viewed with an Olympus Bx60 with 60x Plan Apo 1.4NA objective. Images were acquired with a cooled CCD camera, operated by Espirit imaging software.
GFP fusion protein constructs
Human KSRP cDNA (the homologue of chicken ZBP2), a gift from D. Black (University of California at Los Angeles, Los Angeles, CA), was subcloned to pEGFP C1 vector (CLONTECH Laboratories, Inc.) at the EcoRI and Hind III sites. (pGFP-KSRP). All other EGFP fusion constructs are either full-length or truncated chicken ZBP2. The central domain fragment containing aa sequence 103650, including the 47-aa sequence unique to ZBP2 and 4-KH domains, was amplified by PCR and cloned into pEGFP-C1 vector at EcoRI and Xbal sites to generate plasmid pGFP-CD. The 4-KH domains of ZBP2 were cloned into pEGFP-C1 vector at SalI and XbaI site to produce construct pGFP-KH. The 47-aa unique sequence was amplified by PCR and introduced into pEGFPC1 at EcoRI Hind III (site pGFP-IN). The COOH-terminal domain, including from amino acids 650 to the stop codon, were excised from the plasmid pBS-LS2 (isolated from library screening) using EcoRI and XhoI sites and cloned into pEGFPC1 vector, generating pGFP-CT. Full-length ZBP2 was cloned into pEGFPC2 (CLONTECH Laboratories, Inc.) at EcoRI and Hind III sites to generate pGFP-FULL. The 47-aa unique sequence was deleted from full-length ZBP2 by two-step splicing PCR, and was cloned into pEGFPC2 vector by EcoRI and Hind III sites to generate pGFP-
47. All constructs mentioned above were verified by DNA sequencing.
Transfection and imaging of transfected cells
CEFs were transfected for 45 h with GFPZBP2 constructs using Qiagen's Effectene Reagent according to manufacturer's protocol. Cultured neurons were transfected with DOTAP as described (Zhang et al., 1999). GFP imaging with or without FISH was performed (Zhang et al., 1999). For CEFs, the GFP and ß-actin mRNA signals were visualized by fluorescence microscopy using an Olympus Bx60 microscope with a 60x objective, n.a. 1.4. At least 50 transfected cells were counted per coverslip for the ß-actin mRNA localization.
The EGFP/ZBP2 fusion expressed in neurons was identified using a fluorescence microscopy (Nikon Eclipse inverted microscope) equipped with 60x Plan-Neofluar objective, phase optics, 100 W mercury arc lamp and HiQ bandpass filters (ChromaTech). Fluorescence images were immediately acquired in a constant exposure time (1 s) with a cooled CCD camera that was run by IP Lab computer software. The perimeter of each axonal dendrites (first 30 µm from cell body) was traced using phase image. Region of interest was transferred to the fluorescence image in the same cell, and fluorescence intensity of ß-actin mRNA was measured by IP Lab software. The fluorescence intensity of ROI within untransfected cells on the coverslip was measured as normal control. Over 20 cells in each group were analyzed.
| Footnotes |
|---|
* Abbreviations used in this paper: aa, amino acid(s); CEF, chicken embryonic fibroblast; EGFP, enhanced green fluorescence protein; NLS, nuclear localization signal; RACE, rapid amplification of cDNA ends; UTR, untranslated region; ZBP, zipcode binding protein.
| Acknowledgments |
|---|
This work was supported by grants from the National Institutes of Health (AR41480 to R.H. Singer, and GM55599 to G.J. Bassell).
Submitted: 30 May 2001
Revised: 16 November 2001
Accepted: 16 November 2001
| References |
|---|
|
|
|---|
Ainger, K., D. Avossa, F. Morgan, S.J. Hill, C. Barry, E. Barbarese, and J.H. Carson. 1993. Transport and localization of exogenous myelin basic protein mRNA microinjected into oligodendrocytes. J. Cell Biol. 123:431441.
Ainger, K., D. Avossa, A.S. Diana, C. Barry, E. Barbarese, and J.H. Carson. 1997. Transport and localization elements in myelin basic protein mRNA. J. Cell Biol. 138:10771087.
Amon, A. 1996. Mother and daughter are doing fine: asymmetric cell division in yeast. Cell. 84:651654.
Bassell, G.J., and R.H. Singer. 1997. MRNA and cytoskeletal filaments. Curr. Opin. Cell Biol. 9:109115.
Bassell, G.J., and R.H. Singer. 2001. Neuronal RNA localization and the cytoskeleton. In Results and Problems in Cell Differentiation. D. Richter, editor. Springer-Verlag, 34:4156.
Bassell, G.J., H.L. Zhang, A.L. Byrd, A.M. Femino, R.H. Singer, K.L. Taneja, L.M. Lifshitz, I.M. Herman, and K.S. Kosik. 1998. Sorting of ß-actin mRNA and protein to neurites and growth cones in culture. J. Neurosci. 18:251265.
Bassell, G.J., Y. Oleynikov, and R.H. Singer. 1999. The travels of mRNAs through all cells large and small. FASEB J. 13:447454.
Bashirullah, A., R.L. Cooperstock, and H.D. Lipshitz. 1998. RNA localization in development. Annu. Rev. Biochem. 67:335394.
Behar, L., R. Marx, E. Sadot, J. Barg, and I. Ginzburg. 1995. cis-acting signals and trans-acting proteins are involved in tau mRNA targeting into neurites of differentiating neuronal cells. Int. J. Dev. Neurosci. 13:113127.
Bertrand, B., C. Pascal, M. Schaefer, S.M. Shenoy, R.H. Singer, and R.M. Long. 1998. Localization of ASH1 mRNA particles in living yeast. Mol. Cell. 2:437445.
Cote, C.A., D. Gautreau, J.M. Denegre, T. Kress, N.A. Terry, and K.L. Mowry. 1999. A Xenopus protein related to hnRNP I has a role in cytoplasmic RNA localization. Mol. Cell. 4:431437.
Deshler, J.O., M.I. Highett, T. Abramson, and B.J. Schnapp. 1998. A highly conserved RNA-binding protein for cytoplasmic mRNA localization in vertebrates. Curr. Biol. 8:489496.
Duncan, R., L. Bazar, G. Michelotti, T. Tomonaga, H. Krutzsch, M. Avigan, and D. Levens. 1994. A sequence-specific, single-strand binding protein activates the far upstream element of c-myc and defines a new DNA-binding motif. Genes Dev. 8:465480.
Ephrussi, A., L.K. Dickinson, and R. Lehmann. 1991. Oskar organizes the germ plasm and directs localization of the posterior determinant nanos. Cell. 66:3750.
Fridell, R.A., R.E. Benson, J. Hua, H.P. Bogerd, and B.R. Cullen. 1996. A nuclear role for the fragile X mental retardation protein. EMBO J. 19:54085414.
Havin, L., A. Git, Z. Elisha, F. Oberman, K. Yaniv, S.P. Schwartz, N. Standart, and J.K. Yisraeli. 1998. RNA-binding protein conserved in both microtubule- and microfilament-based RNA localization. Genes Dev. 12:15931598.
Hoek, K.S., G.J. Kidd, J.H. Carson, and R. Smith. 1998. hnRNP A2 selectively binds the cytoplasmic transport sequence of myelin basic protein mRNA. Biochemistry. 37:70217029.
Jansen, R.P. 2001. mRNA localization: message on the move. Nat. Rev. Mol. Cell. Biol. 4:247256.
Kislauskis, E.H., Z.F. Li, R.H. Singer, and K.L. Taneja. 1993. Isoform-specific 3'-untranslated sequences sort
-cardiac and ß-cytoplasmic actin messenger RNAs to different cytoplasmic compartments. J. Cell Biol. 123:165172.
Kislauskis, E.H., X.-C. Zhu, and R.H. Singer. 1994. A sequence required for intracellular localization of ß-actin messenger RNA also affects cell phenotype. J. Cell Biol. 127:441451.
Kislauskis, E.H., X.-C. Zhu, and R.H. Singer. 1997. ß-actin messenger RNA localization and protein synthesis augment cell motility. J. Cell Biol. 136:12631270.
Kleiman, R., G. Banker, and O. Steward. 1990. Differential subcellular localization of particular mRNAs in hippocampal neurons in culture. Neuron. 6:821830.
Lall, S., H. Francis-Lang, A. Flament, A. Norvell, T. Schüpbach, and D. Ish-Horowicz. 1999. Squid hnRNA protein promotes apical cytoplasmic transport and localization of Drosophila pair-rule transcripts. Cell. 98:171180.
Lau, P.P., H.-J. Zhu, M. Nakamuta, and L. Chan. 1997. Cloning of an apobec-1-binding protein that also interacts with apolipoprotein B mRNA and evidence for its involvement in RNA editing. J. Biol. Chem. 272:14521455.
Litman, P., J. Barg, L. Rindzoonski, and I. Ginzburg. 1993. Subcellular localization of tau mRNA in differentiating neuronal cell culture: Implications for neuronal polarity. Neuron. 10:627638.
Long, R.M., R.H. Singer, X.H. Meng, I. Gonzales, K. Nasmyth, and R.-P. Jansen. 1997. Mating type switching in yeast controlled by asymmetric localization of ASH1 mRNA. Science. 277:383387.
Long, R.M., W. Gu, X. Meng, G. Gonsalvez, R.H. Singer, and P. Chartrand. 2001. An exclusively nuclear RNA-binding protein affects asymmetric localization of ASH1 mRNA and Ash1p in yeast. J. Cell Biol. 153:307318.
Min, S., C.W. Turck, J.M. Nikolic, and D.L. Black. 1997. A new regulatory protein, KSRP, mediates exon inclusion through an intronic splicing enhancer. Genes Dev. 11:10231036.
Ross, A.F., Y. Oleynikov, E.H. Kislausksi, K. Taneja, and R.H. Singer. 1997. Characterization of a ß-actin mRNA zipcode-binding protein. Mol. Cell. Biol. 17:21582165.
Polydorides, A.D., H.J. Okano, Y.Y. Yang, G. Stefani, and R.B. Darnell. 2000. A brain-enriched polypyrimidine tract-binding protein antagonizes the ability of Nova to regulate neuron-specific alternative splicing. Proc. Natl. Acad. Sci. USA. 12:63506355.
Shestakova, E.A., R.H. Singer, and J. Condeelis. 2001. The physiological significance of ß-actin mRNA localization in determining cell polarity and directional motility. Proc. Natl. Acad. Sci. USA. 98:70457050.
Smidt, M.P., B. Russchen, L. Snippe, J. Wijnholds, and A.B. Geert. 1995. Cloning and characterization of a nuclear, site specific ssDNA binding protein. Nucl. Acid Res. 23:23892395.
Takizawa, P.A., A. Sil, J.R. Swedlow, I. Herskowitz, and R.D. Vale. 1997. Actin-dependent localization of an RNA encoding a cell-fate determinant in yeast. Nature. 389:9093.
Zhang, H.L., R.H. Singer, and G.J. Bassell. 1999. Neurotrophin regulation of ß-actin mRNA and protein localization within growth cones. J. Cell Biol. 147:5970.
Zhang, H.L., T. Eom, Y. Oleynikov, S.M. Shenoy, D.A. Liebelt, J.B. Dictenberg, R.H. Singer, and G.J. Bassell. 2001. Neurotrophin-induced transport of zipcode binding protein with ß-actin mRNA increases ß-actin levels and stimulates growth cone motility. Neuron. 31:261275.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|