|
||
© The Rockefeller University Press,
0021-9525/2002/4/125 $5.00
The Journal of Cell Biology, Volume 157, Number 1, April 1, 2002 125-136
Article |
Muscle-specific RING finger-1 interacts with titin to regulate sarcomeric M-line and thick filament structure and may have nuclear functions via its interaction with glucocorticoid modulatory element binding protein-1
Address correspondence to Carol C. Gregorio, Ph.D., Department of Cell Biology and Anatomy, University of Arizona, 1501 N. Campbell Avenue, LSN 455, Tucson, AZ 85724. Tel.: (520) 626-8113. Fax.: (520) 626-2097. E-mail: gregorio{at}u.arizona.edu
| Abstract |
|---|
|
|
|---|
The COOH-terminal A168170 region of the giant sarcomeric protein titin interacts with muscle-specific RING finger-1 (MURF-1). To investigate the functional significance of this interaction, we expressed green fluorescent protein fusion constructs encoding defined fragments of titin's M-line region and MURF-1 in cardiac myocytes. Upon expression of MURF-1 or its central region (containing its titin-binding site), the integrity of titin's M-line region was dramatically disrupted. Disruption of titin's M-line region also resulted in a perturbation of thick filament components, but, surprisingly, not of the NH2-terminal or I-band regions of titin, the Z-lines, or the thin filaments. This specific phenotype also was caused by the expression of titin A168170. These data suggest that the interaction of titin with MURF-1 is important for the stability of the sarcomeric M-line region.
MURF-1 also binds to ubiquitin-conjugating enzyme-9 and isopeptidase T-3, enzymes involved in small ubiquitin-related modifiermediated nuclear import, and with glucocorticoid modulatory element binding protein-1 (GMEB-1), a transcriptional regulator. Consistent with our in vitro binding data implicating MURF-1 with nuclear functions, endogenous MURF-1 also was detected in the nuclei of some myocytes. The dual interactions of MURF-1 with titin and GMEB-1 may link myofibril signaling pathways (perhaps including titin's kinase domain) with muscle gene expression.
Key Words: MURF-1; titin; GMEB-1; cardiac myocyte; SUMO-3
| Introduction |
|---|
|
|
|---|
33.7 MD) (Maruyama et al., 1977; Wang et al., 1979; Labeit and Kolmerer, 1995; Bang et al., 2001). Titin molecules from adjacent sarcomeres overlap in the Z-line, and those from opposite half sarcomeres overlap in the M-line, thus forming a continuous filament system within myofibrils (Obermann et al., 1996; Gregorio et al., 1999). The majority (
90%) of the titin molecule is comprised of repeating modular domains from the fibronectin (FN)* type III and the immunoglobulin (Ig) superfamilies. Additionally, there are 17 unique insertions distributed along the length of titin, including a serine/threonine kinase domain in its M-line region (Labeit et al., 1992), the function of which remains elusive. To dissect the functional properties of titin's domains, recent investigations have focused on searching for novel titin-binding proteins. One of these proteins is muscle-specific RING finger-1 (MURF-1) (Centner et al., 2001), also recently identified as striated muscle RING zinc finger (SMRZ) (Dai and Liew, 2001) and RING finger 28 (RNF 28) (see http://www.gene.ucl.ac.uk/cgi-bin/nomenclature/searchgenes.pl). This protein binds to the titin domains A168169170 (A168170) located directly NH2-terminal to the titin kinase domain (Centner et al., 2001). Two proteins with a high degree of homology to MURF-1 also have been identified: MURF-2 (RNF 29) and MURF-3 (RNF 30) (Spencer et al., 2000; Centner et al., 2001). The three MURFs are members of the RING finger-B-box-coiled-coil (RBCC) family, a class of proteins that have critical roles in cellular processes including signal transduction, gene transcription, ubiquitination, and differentiation (for reviews see Freemont, 2000; Borden, 2000). Structurally, the MURFs contain a Zn-binding RING finger domain at their extreme NH2-terminal end, a MURF familyspecific conserved region, a B-box domain, coiled-coil motifs, and an acidic tail (Spencer et al., 2000; Centner et al., 2001; Dai and Liew, 2001).
To date, little insight into the cellular roles of the MURFs is available. In vitro binding studies revealed that MURF family members homo- and hetero-oligomerize (Centner et al., 2001). MURF-3 appears to associate with microtubules and have a role in myogenic differentiation and microtubule stabilization (Spencer et al., 2000). MURF-1 (SMRZ) recently has been shown to interact with small ubiquitin-related modifier-3 (SUMO-3/SMT3b; Dai and Liew, 2001), a member of a ubiquitin-related class of proteins implicated in subcellular targeting and nuclear import (for review on SUMO proteins see Melchior, 2000). Consistent with this finding, MURF-1 is detected in nuclei (Dai and Liew, 2001; this study). In a different study, it was determined that MURF-1 appears to be the only MURF family member that interacts directly with titin, within the M-line region of the sarcomere (Centner et al., 2001). Despite these recent studies, the exact physiological role(s) of the MURF family members, particularly MURF-1 and -2, have remained elusive.
To determine which regions of MURF-1 target to myofibrils and/or nuclear sites, and as an initial approach to decipher the cellular properties of MURF-1, we expressed green fluorescent protein (GFP) fusion constructs encoding defined regions of MURF-1 and its titin-binding site, A168170, in live cardiac myocytes. Our data suggest that the interaction of titin with the central region of MURF-1 is important for maintaining the integrity of titin's M-line structure. In turn, titin's COOH-terminal (M-line) region appears to be necessary for thick filament integrity, but, surprisingly, not for the integrity of titin's NH2-terminal or I-band region, the thin filaments, or the Z-lines.
Intriguingly, endogenous MURF-1 also was detected in the nuclei of some myocytes. Consistent with this observation, in vitro interaction studies revealed that MURF-1 binds to ubiquitin-conjugating enzyme 9 (Ubc9) and isopeptidase T-3 (ISOT-3), enzymes involved in SUMO modification of target proteins, a posttranslational modification that occurs in the nucleus. Our in vitro interaction studies also demonstrated that MURF-1 is capable of binding to glucocorticoid modulatory element binding protein-1 (GMEB-1), a nuclear protein implicated in transcriptional regulation (Theriault et al., 1999; Jimenez-Lara et al., 2000; Zeng et al., 2000b). Therefore, our data suggest MURF-1 has an important role in titin filament M-line structure (and perhaps in titin kinase-based signaling processes) as well as a nuclear function (potentially in the control of muscle gene expression). Future studies will likely provide insights into how the dual functions of MURF-1 are associated, as well as how myofibrillogenesis and the regulation of muscle gene expression are linked.
| Results |
|---|
|
|
|---|
-actinin, which stains all myofibrils, revealed that in some myocytes, MURF-1 assembled in only a few myofibrils, whereas in other myocytes, it was assembled in all myofibrils (Fig. 1 a, arrows). Consistent with this observation, immunolocalization studies on isolated rat cardiac and skeletal muscle myofibrils also demonstrated that MURF-1 was detected at the M-line region in only a portion of myofibrils (3050%; unpublished data). Interestingly, although MURF-1 was detected at the M- and the Z-line in adult cardiac tissue sections (Centner et al., 2001), MURF-1 was not detected at the Z-line in rat fetal or chick embryonic cardiac myocytes. The significance of this is not known, but may be due to developmental differences. MURF-1 staining was also observed diffuse in the cytoplasm (Fig. 1, c and e, arrowheads) and at varying intensities in the nuclei of some cardiac myocytes, as shown by colocalization with DAPI staining (Fig. 1, e and f); this was confirmed by scanning at different focal planes by deconvolution microscopy (unpublished data). MURF-1's nuclear localization is consistent with a recent study that detected MURF-1 (SMRZ) fusion proteins in the nuclei of C2C12 skeletal muscle cells (Dai and Liew, 2001). Staining with the secondary antibody alone yielded negligible background in all experiments (unpublished data).
|
|
|
8090% of cells transfected with MURF-1 had disrupted COOH-terminal titin structure, whereas
6070% of the cells had perturbed thick filament structure (Fig. 6). This difference in percentages of cells affected suggests that the thick filament perturbation may be a secondary effect of the disruption of titin's M-line region. Unexpectedly, the structure of the actin (thin) filaments, the I-band region of titin, and the Z-lines (as assessed by the distribution of phalloidin, titin N2A, and
-actinin staining, respectively) appeared in typical striated patterns in the majority of GFPMURF-1transfected cells (Figs. 5 and 6), even though the COOH-terminal region of titin was disrupted (Fig. 5, i and j).
|
|
|
|
10% of myocyte nuclei, suggesting that it does not contain a fully functional nuclear targeting site. These data, together with the observations that MURF-1's RING domain binds to the nuclear protein SUMO-3 (Dai and Liew, 2001) and other RING proteins have been reported in nuclei (for review see Borden, 2000), are consistent with the RING domain targeting MURF-1 to the nuclei of cardiac myocytes.
|
Next, we costained transfected myocytes with antiCOOH-terminal titin antibodies to identify the region(s) of MURF-1 involved in M-line structure. Expression of each of the three MURF-1 fragments containing its central region, shown above to contain an M-line targeting site, resulted in a phenotype identical to that observed when full-length MURF-1 was expressed. Specifically, a marked disruption of titin A168170 staining was observed in the vast majority of cells expressing Central, Tailless, or RINGless (Fig. 8, f, h, and j), compared with regular, striated titin staining in myocytes expressing RING or Tail (Fig. 8, b and d). These studies reveal that MURF-1 contains two distinct targeting and functional domains. Its central region, containing the titin-binding site, targets it to the M-line and participates in maintaining the integrity of titin's COOH-terminal region. The RING domain, containing the binding site for SUMO-3, appears to be involved in MURF-1 nuclear targeting.
|
|
| Discussion |
|---|
|
|
|---|
To decipher the roles of titin in sarcomeric structure, recent studies have focused on dissecting the properties of individual titin regions and their potential ligands (for reviews see McElhinny et al., 2000; Sanger and Sanger, 2001). Here, we aimed to investigate the functional significance of the interaction of titin's COOH-terminal Ig domains A168170 (located directly NH2-terminal to the titin Ser/Thr kinase domain) with MURF-1, a RING finger protein. Expression of MURF-1 or titin A168170 in primary cultures of embryonic chick cardiac myocytes severely disrupted the integrity of titin's M-line region. The region of MURF-1 that is responsible for this phenotype was mapped to its central region, which previously has been shown to contain its titin-binding site (Centner et al., 2001). The most plausible explanation for our observations is that a dominant-negative phenotype occurred. That is, upon expression of the central region of MURF-1 or titin A168170, the fusion proteins likely interfered with the interaction of endogenous MURF-1 with titin. Surprisingly, expression of the full-length MURF-1 molecule also resulted in this striking phenotype, suggesting that endogenous MURF-1 levels are tightly regulated. Our data suggest that MURF-1 and its interaction with titin A168170 are critical for maintaining the stability of titin's COOH-terminal region.
In turn, it appears that the interaction of titin with MURF-1 plays a critical role in maintaining the stability of the thick filaments. Although all of the sarcomeric components comprising the M-line region have not been elucidated, the thick filaments appear to be laterally associated with titin via their interactions with MyBP-C (along the A-band), and myomesin (at the M-line) (Houmeida et al., 1995; Obermann et al., 1997). In fact, it has been proposed that titin specifies the number and location of thick filament components (Whiting et al., 1989; Trinick, 1994; Houmeida et al., 1995). It is striking that expression of titin A168170 in cardiac myocytes perturbed M-line titin and thick filament structure, yet expression of other titin COOH-terminal domains (M1-M2-M3, M8-M9-M10, titin kinase domain, or a mutant, constitutively active kinase domain) had no effect on M-line or thick filament integrity. These results specifically implicate titin A168170 and MURF-1 in the regulation of sarcomeric M-line and thick filament organization. We hypothesize that MURF-1 forms a complex with titin A168170 that functions in the assembly of M-line and thick filament components during myofibrillogenesis, as well as in myofibril turnover.
Intriguingly, although titin's COOH-terminal region and the thick filaments were disrupted in MURF-1 or titin A168-170transfected myocytes, the structural integrity of the thin filaments remained intact. These data are consistent with the observation that thin filament assembly occurs independently of the formation of the thick filaments (Antin et al., 1981; Schultheiss et al., 1990; Epstein and Fischman, 1991; Holtzer et al., 1997; Ehler et al., 1999; Gregorio and Antin, 2000; Rudy et al., 2001). Because titin's NH2-terminal and I-band regions were also intact, these data indicate that certain regions of the titin filament can be "selectively" perturbed. Previous studies have shown that titin interacts with various Z-line components (
-actinin and T-cap/telethonin) and thin filament components (actin) (Funatsu et al., 1993; Jin, 1995; Granzier et al., 1997; Linke et al., 1997; Sorimachi et al., 1997; Gregorio et al., 1998; Mues et al., 1998; Young et al., 1998). From our studies, it appears that these associations along the titin molecule stabilize its NH2-terminal and I-band regions even when the structure of its COOH-terminal end is perturbed. Consistent with this idea, the NH2-terminal end of titin becomes organized during myofibril assembly before the COOH-terminal end of titin and other M-line components (Fürst et al., 1989; Schultheiss et al., 1990; Komiyama et al., 1993; van der Loop et al., 1996; Ehler et al., 1999; Rudy et al., 2001). A possible explanation for this observation is that the less organized M-line region of titin filaments may not be concentrated enough for a signal to be detected by immunofluorescence microscopy (Ehler et al., 1999). Therefore, in our study, it is likely that titin's COOH-terminal region lost its stable interactions and was "less organized," whereas the more NH2-terminal regions remained "bolted" to other Z- and I-band components. Interestingly, another study has demonstrated that the thick filaments remain intact when the thin filaments are perturbed upon expression of titin's I-band, N2B region (Linke et al., 1999), in the same cell type used in our studies. Thus, titin also may function to keep the thick filaments aligned in the absence of thin filaments.
In addition to sarcomeric M-line localization, endogenous MURF-1 was detected in the nuclei of cardiac myocytes. The observation that MURF-1 assembles in only some myofibrils also indicates that its cellular levels are tightly regulated. An excellent candidate for regulating MURF-1 levels, its localization pattern, and nuclear import is SUMO-3. SUMO-3 binds to MURF-1's RING domain (Dai and Liew, 2001), the region of MURF-1 that appears to be involved in its nuclear localization (this study). We found that two enzymes potentially involved in regulating the conjugation of SUMO with its target proteins, Ubc9 and ISOT-3, interact with MURF-1 and other MURF family members. Although the biochemical pathways and classes of enzymes involved in "SUMO modification" are parallel to those in ubiquitination, the two processes may be functionally distinct. In fact, SUMO modification has been implicated in regulating the levels and localization patterns of target proteins, including nuclear localization (for review see Melchior, 2000). All three MURF proteins exhibit multiple cellular localization patterns (Spencer et al., 2000; Centner et al., 2001; unpublished data), consistent with them being potential SUMO targets. Interestingly, SUMO-3 has recently been shown to be a key component of a new class of acute and reversible cellular stress response pathways (Saitoh and Hinchey, 2000). Further studies are needed to determine whether MURF-1 levels and/or localization patterns change in response to cellular stress, and whether titin plays a role in sensing stress response pathways in cardiac myocytes.
Strongly implicating MURF-1 with nuclear functions are the data demonstrating its specific interaction with GMEB-1 and their colocalization in the nuclei of some myocytes. GMEB-1 was first characterized as a component of a complex that binds to the GME in liver cells, thereby modulating transcription in response to glucocorticoid levels (Zeng et al., 1998; Theriault et al., 1999). Recent studies indicate that GMEB-1 is expressed in a wide range of cell types and may have roles in development and differentiation (Zeng et al., 2000a). We confirmed that GMEB-1 mRNA transcripts are present in striated muscle tissue and found that GMEB-1GFP fusion proteins targeted to the nuclei of transfected cardiac myocytes. Given that MURF-1 is involved both in sarcomeric M-line structure (via its interaction with titin) and potentially in gene expression (via its interaction with GMEB-1), we speculate that MURF-1 acts as a link between gene expression and myofibril signaling pathways. Currently, it remains unclear what factors might modulate the MURF-1based myofibril-to-nuclear signaling pathways. One idea is that the titin kinase domain could play a role in this process, because the MURF-1 binding site is located adjacent to this domain (Centner et al., 2001).
In conclusion, we demonstrated that the central region of MURF-1 targets to the M-line region and participates in its structural integrity in cardiac myocytes, most likely through its interaction with titin's COOH-terminal A168170 region. Interestingly, MURF-1 is an RBCC protein, a family whose members have been referred to as "builders of master scaffolds" because many are involved in the formation of multiprotein complexes (for review see Borden, 2000). Thus, perhaps additional factors, such as other MURF family members, are involved in regulating M-line and thick filament structure through their interactions with MURF-1. It is also striking that RING finger and RBCC proteins have been implicated in ubiquitination pathways (for review see Freemont, 2000). Consistent with this, recombinant MURF-1 protein was recently reported to have ubiquitin ligase activity (Bodine et al., 2001). Moreover, MURF-1-/- mice were resistant to skeletal muscle atrophy, suggesting that MURF-1 regulates the degradation of critical muscle proteins (Bodine et al., 2001). These results and the results from our study support our hypothesis that MURF-1 is involved in a novel pathway responsible for titin structure and/or turnover. Intriguingly, because MURF-1 also is a nuclear component that binds to the transcriptional modulator GMEB-1, MURF-1 may participate in both the regulation of myofibril assembly and structure as well as muscle gene expression. In support of our hypothesis, rat skeletal muscle MURF-1 mRNA levels increased 10-fold in response to glucocorticoid exposure (Bodine et al., 2001), which regulates GMEB-1 transcriptional activity (Theriault et al., 1999; Zeng et al., 2000b). Future studies are required to elucidate whether the dual localization of MURF-1 to myofibrils and nuclei is a result of dynamic SUMO modification.
| Materials and methods |
|---|
|
|
|---|
5 d). In screens where the pAS2-1 bait vector was used, the plates were supplemented with 1.5 mM 3-amino-1,2,4-triazole (Sigma-Aldrich). Transformants were picked, restreaked onto SD/Leu-/Trp-/His- plates, and screened for ß-galactosidase activity. ß-Galactosidase activity of the cells was measured either by colony lift filter assays using X-gal or in liquid culture using chlorophenol red ß-D-galactopyranoside, as described by the manufacturer (CLONTECH Laboratories, Inc.). ß-Galactosidasepositive colonies were processed to lose the bait plasmid, and prey clones were recovered by electroporation of yeast DNA in Escherichia coli and sequenced. To confirm binding, transformants were retransformed into yeast with either the bait or the vector. In addition, the inserts of the bait and the prey vector were swapped and cotransformed into yeast; identical results were obtained (unpublished data).
RT-PCR analysis of GMEB-1 mRNA transcripts
To determine the tissue distribution of GMEB-1 mRNA transcripts, commercially available mRNAs (Stratagene) were reverse transcribed using random hexamer primers and SuperScript reverse transcriptase according to the manufacturer (Stratagene). To ensure that PCR products were not amplified from contaminating genomic DNA, RNA also was incubated without SuperScript reverse transcriptase. PCR amplifications were performed essentially as described by Centner et al. (2000), using GMEB-1specific primers designed to amplify a 511-bp product (forward primer: CGGAGGAGGGTGTAAAGAAAGACTC; reverse primer: GGGTGAGATGACTGTGAACTGAGG). PCR products were verified by sequencing.
In vitro translation and GST pull-down experiments
In vitro transcription and translation were performed in the presence of [35S]methionine (Amersham Pharmacia Biotech) using a TNT T7coupled reticulocyte lysate system according to the manufacturer's instructions (Promega). His6GST double-tagged fusion proteins were obtained by cloning into a modified pET9D vector. The constructs were transformed into BL21-DE3 (CLONTECH Laboratories, Inc.) cells. Whole-cell lysates in coating buffer (2x PBS, 1% Triton X-100) were prepared as previously described (Studier et al., 1990). The GST fusion protein was immobilized on glutathioneSepharose 4B beads (Amersham Pharmacia Biotech) by incubating
200 µl of the lysate with 50 µl of beads (50% slurry) for 1 h at 4°C. The beads were washed three times with coating buffer and resuspended in binding buffer (20 mM Tris, pH 7.4, 100 mM KCl, 1 mM EDTA, 1% Triton X-100, plus protease inhibitors). 5 µl of in vitrotranslated 35S-labeled proteins were added to 50 µl of beads coated with 20 µg of bound GST fusion proteins in 300 µl binding buffer. The mixture was incubated for 1.5 h at 4°C, washed three times with binding buffer, and resuspended in SDS sample buffer. The protein complexes were fractionated by SDS-PAGE using 15% gels. The gels were fixed (20% methanol, 10% acetic acid), stained with Coomassie blue, treated with Amplify (Amersham Pharmacia Biotech), dried, and exposed using BioMax MR-1 film (Eastman Kodak Co.). The results of the Coomassie blue staining confirmed that equal amounts of each GST fusion protein were bound to the beads in the different samples (unpublished data).
Cell culture and transfection procedures
For myocyte expression studies, cDNAs containing the entire open reading frame of MURF-1 (residues 1565) and subfragments of MURF-1, corresponding to its 82 NH2-terminal residues, central 243 residues, and 85 COOH-terminal residues (Fig. 2), were amplified by PCR, using total human skeletal cDNA as a template. The MURF-1 cDNA sequence has been deposited in the GenBank/EMBL/DDBJ data library under accession no. AJ291713 (Centner et al., 2001). The full-length MURF-1 was cloned into pEGFP-N1 (CLONTECH Laboratories, Inc.). The primers used to generate the MURF-1 fragments were: 475S/720R for RING, 1525R/685S for RINGless, 475S/1413R for Tailless, 685S/1413R for Central, and 1370S/1525R for Tail, and the fragments were cloned into pEGFP-C1 (CLONTECH Laboratories, Inc.). Similarly, titin fragments corresponding to the MURF-1 binding site, A168A170, the COOH-terminally located kinase domain, and M-line Ig domains were amplified from total human cDNA and cloned into pEGFP-C1. The full-length human cardiac titin accession no. in the GenBank/EMBL/DDBJ data library is X90568, and primers (listed as base pairs) used to generate the titin fragments were: 73419S/74402R for A168170, 74254S/75345R for titin kinase, 74397S/75242R for mutated activated titin kinase, 75343S/76280R for M1-M2-M3, and 79177S/80918R for M8-M9-M10. Recombinant pEGFP-C1 constructs were purified using Qiagen columns (QIAGEN) before transfection into myocytes. Plasmids were verified by sequencing. To rule out any potential artifacts resulting from the GFP tag, pCMVmyc-MURF1 constructs, as well as constructs encoding MURF-1 with the GFP tag at its COOH-terminal end, were generated (Gregorio et al., 1998) and transfected into cardiac myocytes. Identical results were obtained (unpublished data).
Cardiac myocytes were prepared from 6-d embryonic chick hearts and cultured as described previously (Gregorio and Fowler, 1995). Isolated cells were plated in 35-mm tissue culture dishes containing 12-mm round coverslips (106 cells/dish). 1520% of the cells in our primary cultures are fibroblasts. 24 h after plating, cultured myocytes were washed two times in OptiMEM, placed in 800 µl fresh OptiMEM, and returned to the incubator while DNA liposome complexes were prepared using LipofectAmine Plus reagents. In brief, 1 µg plasmid was mixed with 6 µl PLUS Reagent in 100 µl serum-free OptiMEM and incubated at room temperature for 15 min. Next, 4 µl of LipofectAmine reagent were added to 100 µl of OptiMEM and mixed with the DNAPLUS reagent solution. After 15 min, the DNAlipid complexes were added dropwise to the culture dish. 3 h later, 1 ml of minimal essential medium (10% FBS; Hyclone Laboratories, Inc.) was added to the dish. 36 d later, cells were gently washed with PBS and fixed with 2% formaldehyde in PBS for 10 min. Coverslips were washed and stored in PBS at 4°C until staining. Over 200 transfected cells per construct were analyzed. Our transfection efficiencies ranged from 1040%. All tissue culture reagents (except where noted) were purchased from Life Technologies.
Indirect immunofluorescence microscopy
Primary cultures of rat cardiac myocytes were isolated and maintained as previously described (Gustafson et al., 1987). Transfected cardiac myocytes were essentially stained as described by Gregorio et al. (1998). Cells were fixed in 2% formaldehydePBS for 10 min, washed in PBS, and permeabilized in 0.2% Triton X-100PBS for 15 min. The coverslips were preincubated in 2% BSA, 1% normal donkey serumPBS for 1 h to minimize nonspecific binding of antibodies. For double-labeling protocols, cells were incubated with affinity-purified rabbit polyclonal antibodies specific to MURF-1 (510 µg/ml) (Centner et al., 2001), followed by Cy2-conjugated goat antirabbit IgG (1:600), and incubated with monoclonal sarcomeric anti
-actinin antibodies (1:1,500) (EA-53; Sigma-Aldrich) followed by goat antimouse Texas redconjugated IgG (1:600). For staining GFP-transfected cells, well-characterized antibodies were used against various sarcomeric components, including monoclonal anti-titin T11 antibodies (1:1,000; Sigma-Aldrich), monoclonal anti-myosin antibodies F59 (1:10; provided by F. Stockdale, Stanford University, Stanford, CA), rabbit anti-titin M-linespecific antibodies (1:100; Centner et al., 2001), anti-titin N2A antibodies (10 µg/ml; Centner et al., 2000), rabbit antiMyBP-C antibodies (1:50; Linke et al., 1999), monoclonal anti-titin AB5 (1:3 of cultured supernatant; provided by John Trinick, University of Leeds, Leeds, UK) (Whiting et al., 1989), monoclonal anti-myomesin B4 antibodies (1:50 of cultured supernatant; provided by J.C. Perriard, Swiss Federal Institute of Technology, Zurich, Switzerland) (Grove et al., 1984), and Texas redconjugated phalloidin (1:200; Molecular Probes Inc.). The staining was followed by incubation with Texas redconjugated goat antimouse IgG plus IgM (1:600) or Texas redconjugated donkey antirabbit antibodies (1:700) for 45 min. To identify nuclei in some experiments, fixed cells were also incubated in a DAPI stain (10 µg/ml; Sigma-Aldrich) for 5 min at room temperature before the final washing steps. Note, because of the intense diffuseness of soluble titinGFP fusion proteins in transfected cells, we extracted soluble proteins with cytoskeletal (myofibril) stabilization buffer before fixation in some experiments (Gregorio and Fowler, 1995). For triple-labeling studies, a cascade blueconjugated secondary antibody was used (1:200). All coverslips were mounted on slides using Aqua Poly/Mount (Polysciences, Inc.) and subsequently analyzed on a Zeiss Axiovert microscope using a 100x (NA 1.3) objective, and micrographs were recorded as digital images on a SenSys cooled HCCD (Photometrics). For triple-labeling studies, transfected cells were analyzed on a DeltaVision Deconvolution Model D-OL Olympus microscope with a 60x objective (1.4 NA) using a Photometrics Series 300 CCD camera (Applied Precision). Images were processed for presentation using Adobe Photoshop® 6.0. All secondary antibodies were purchased from Jackson ImmunoResearch Laboratories, except the Cy2-conjugated antibodies, which were purchased from Pierce Chemical Co.
| Footnotes |
|---|
| Acknowledgments |
|---|
This work was supported by the National Institutes of Health (grants HL57461 and HL03985 to C.C. Gregorio; HL07249 to A.S. McElhinny), the American Heart Association (0120586Z to A.S. McElhinny), the Deutsche Forschungsgemeinschaft (La668/5-2 to S. Labeit), and a Core Research for Evolutional Science and Technology grant 11B-1 from the Ministry of Health and Welfare (H. Sorimachi).
Submitted: 17 August 2001
Revised: 28 February 2002
Accepted: 28 February 2002
| References |
|---|
|
|
|---|
Antin, P.B., S. Forry-Schaudies, T.M. Friedman, S.J. Tapscott, and H. Holtzer. 1981. Taxol induces postmitotic myoblasts to assemble interdigitating microtubule-myosin arrays that exclude actin filaments. J. Cell Biol. 90:300308.
Bang, M.L., T. Centner, F. Fornoff, A.J. Geach, M. Gotthardt, M. McNabb, C.C. Witt, D. Labeit, C.C. Gregorio, H. Granzier, and S. Labeit. 2001. The complete gene sequence of titin, expression of an unusual approximately 700-kDa titin isoform, and its interaction with obscurin identify a novel Z-line to I-band linking system. Circ. Res. 89:10651072.
Bodine, S.C., E. Latres, S. Baumhuerer, V.K. Lai, L. Nunez, B.A. Clarke, W.T. Poueymirou, F.J. Panaro, E. Na, K. Dharmarajan, Z.Q. Pan, D.M. Valenzuela, T.M. DeChiara, T.N. Stirr, G.D. Yancopoulos, and D.J. Glass. 2001. Identification of ubiquitin ligases required for skeletal muscle atrophy. Science. 294:17041708.
Borden, K.L. 2000. RING domains: master builders of molecular scaffolds? J. Mol. Biol. 295:11031112.[CrossRef][Medline]
Centner, T., F. Fougerousse, A. Freiburg, C. Witt, J.S. Beckmann, H. Granzier, K. Trombitas, C.C. Gregorio, and S. Labeit. 2000. Molecular tools for the study of titin's differential expression. Adv. Exp. Med. Biol. 481:3549.[Medline]
Centner, T., J. Yano, E. Kimura, A.S. McElhinny, K. Pelin, C.C. Witt, M.L. Bang, K. Trombitas, H. Granzier, C.C. Gregorio, et al. 2001. Identification of muscle specific ring finger proteins as potential regulators of the titin kinase domain. J. Mol. Biol. 306:717726.[CrossRef][Medline]
Dai, K.S., and C.C. Liew. 2001. A novel human striated muscle RING zinc finger protein, SMRZ, interacts with SMT3b via its RING domain. J. Biol. Chem. 276:2399223999.
Desterro, J.M., J. Thomson, and R.T. Hay. 1997. Ubch9 conjugates SUMO but not ubiquitin. FEBS Lett. 417:297300.[CrossRef][Medline]
Ehler, E., B.M. Rothen, S.P. Hammerle, M. Komiyama, and J.C. Perriard. 1999. Myofibrillogenesis in the developing chicken heart: assembly of Z-disk, M-line and the thick filaments. J. Cell Sci. 112:15291539.[Abstract]
Epstein, H.F., and D.A. Fischman. 1991. Molecular analysis of protein assembly in muscle development. Science. 251:10391044.
Freemont, P.S. 2000. RING for destruction? Curr. Biol. 10:8487.
Funatsu, T., E. Kono, H. Higuchi, S. Kimura, S. Ishiwata, T. Yoshioka, K. Maruyama, and S. Tsukita. 1993. Elastic filaments in situ in cardiac muscle: deep-etch replica analysis in combination with selective removal of actin and myosin filaments. J. Cell Biol. 120:711724.
Fürst, D.O., M. Osborn, and K. Weber. 1989. Myogenesis in the mouse embryo: differential onset of expression of myogenic proteins and the involvement of titin in myofibril assembly. J. Cell Biol. 109:517527.
Granzier, H., M. Kellermayer, M. Helmes, and K. Trombitas. 1997. Titin elasticity and mechanism of passive force development in rat cardiac myocytes probed by thin-filament extraction. Biophys. J. 73:20432053.
Gregorio, C.C., and P.B. Antin. 2000. To the heart of myofibril assembly. Trends Cell Biol. 10:355362.[CrossRef][Medline]
Gregorio, C.C., and V.M. Fowler. 1995. Mechanisms of thin filament assembly in embryonic chick cardiac myocytes: tropomodulin requires tropomyosin for assembly. J. Cell Biol. 129:683695.
Gregorio, C.C., K. Trombitas, T. Centner, B. Kolmerer, G. Stier, K. Kunke, K. Suzuki, F. Obermayr, B. Herrmann, H. Granzier, et al. 1998. The NH2 terminus of titin spans the Z-disc: its interaction with a novel 19-kD ligand (T-cap) is required for sarcomeric integrity. J. Cell Biol. 143:10131027.
Gregorio, C.C., H. Granzier, H. Sorimachi, and S. Labeit. 1999. Muscle assembly: a titanic achievement? Curr. Opin. Cell Biol. 11:1825.[CrossRef][Medline]
Grove, B.K., V. Kurer, C. Lehner, T.C. Doetschman, J.C. Perriard, and H.M. Eppenberger. 1984. A new 185,000-dalton skeletal muscle protein detected by monoclonal antibodies. J. Cell Biol. 98:518524.
Gustafson, T.A., J.J. Bahl, B.E. Markham, W.R. Roeske, and E. Morkin. 1987. Hormonal regulation of myosin heavy chain and alpha-actin gene expression in cultured fetal rat heart myocytes. J. Biol. Chem. 262:1331613322.
Holtzer, H., T. Hijikata, Z.X. Lin, Z.Q. Zhang, S. Holtzer, F. Protasi, C. Franzini-Armstrong, and H.L. Sweeney. 1997. Independent assembly of 1.6m long bipolar MHC filaments and I-Z-I bodies. Cell Struc. Func. 22:8393.[Medline]
Houmeida, A., J. Holt, L. Tskhovrebova, and J. Trinick. 1995. Studies of the interaction between titin and myosin. J. Cell Biol. 131:14711481.
Jimenez-Lara, A.M., M.J. Heine, and H. Gronemeyer. 2000. Cloning of a mouse glucocorticoid modulatory element binding protein, a new member of the KDWK family. FEBS Lett. 468:203210.[CrossRef][Medline]
Jin, J.-P. 1995. Cloned rat cardiac titin class I and class II motifs. J. Biol. Chem. 270:69086916.
Johnson, E.S., I. Schwienhorst, R.J. Dohmen, and G. Blobel. 1997. The ubiquitin-like protein Smt3p is activated for conjugation to other proteins by an Aos1p/Uba2p heterodimer. EMBO J. 16:55095519.[CrossRef][Medline]
Komiyama, M., K. Kouchi, K. Maruyama, and Y. Shimada. 1993. Dynamics of actin and assembly of connectin (titin) during myofibrillogenesis in embryonic chick cardiac muscle cells in vitro. Dev. Dyn. 196:291299.[Medline]
Labeit, S., and B. Kolmerer. 1995. Titins, giant proteins in charge of muscle ultrastructure and elasticity. Science. 270:293296.
Labeit, S., M. Gautel, A. Lakey, and J. Trinick. 1992. Towards a molecular understanding of titin. EMBO J. 11:17111716.[Medline]
Labeit, S., B. Kolmerer, and W.A. Linke. 1997. The giant protein titin: Emerging roles in physiology and pathophysiology. Circ. Res. 80:290294.
Linke, W.A., M. Ivemeyer, S. Labeit, H. Hinssen, J.C. Ruegg, and M. Gautel. 1997. Actin-titin interaction in cardiac myofibrils: probing a physiological role. Biophys. J. 73:905919.
Linke, W.A., D.E. Rudy, T. Centner, M. Gautel, C. Witt, S. Labeit, and C.C. Gregorio. 1999. I-band titin in cardiac muscle is a three-element molecular spring and is critical for maintaining thin filament structure. J. Cell Biol. 146:631644.
Maruyama, K., R. Matsubara, Y. Natori, S. Nonomura, S. Kimura, K. Ohashi, F. Murakami, S. Handa, and G. Eguchi. 1977. Connectin, an elastic protein of muscle. J. Biochem. (Tokyo). 82:317337.
McElhinny, A.S., S. Labeit, and C.C. Gregorio. 2000. Probing the functional roles of titin ligands in cardiac myofibril assembly and maintenance. Adv. Exp. Med. Biol. 481:6786.[Medline]
Melchior, F. 2000. SUMOnonclassical ubiquitin. Annu. Rev. Cell Dev. Biol. 16:591626.[CrossRef][Medline]
Muller, S., C. Hoege, G. Pyrowolakis, and S. Jentsch. 2001. SUMO, ubiquitin's mysterious cousin. Nat. Rev. Mol. Cell Biol. 22022210.
Mues, A., P.F. van der Ven, P. Young, D.O. Furst, and M. Gautel. 1998. Two immunoglobulin-like domains of the Z-disc portion of titin interact in a conformation-dependent way with telethonin. FEBS Lett. 428:111114.[CrossRef][Medline]
Obermann, W.M., M. Gautel, F. Steiner, P.F. van der Ven, K. Weber, and D.O. Fürst. 1996. The structure of the sarcomeric M band: localization of defined domains of myomesin, M protein, and the 250-kD carboxy terminal region of titin by immunoelectron microscopy. J. Cell Biol. 134:14411453.
Obermann, W.M., M. Gautel, K. Weber, and D.O. Fürst. 1997. Molecular structure of the sarcomeric M band: mapping of titin and myosin binding domains in myomesin and the identification of a potential regulatory phosphorylation site in myomesin. EMBO J. 16:211220.[CrossRef][Medline]
Rudy, D.E., T.A. Yatskievych, P.B. Antin, and C.C. Gregorio. 2001. Assembly of thick, thin, and titin filaments in chick precardiac explants. Dev. Dyn. 221:6171.[CrossRef][Medline]
Saiki, R.K., S.J. Scharf, F. Faloona, G.T. Mullis, and H.A. Erlich. 1985. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science. 230:13501354.
Saitoh, H., and J. Hinchey. 2000. Functional heterogeneity of small ubiquitin-related protein modifiers SUMO-1 versus SUMO-2/3. J. Biol. Chem. 275:62526258.
Sanger, J.W., and J.M. Sanger. 2001. Fishing out proteins that bind to titin. J. Cell Biol. 154:2124.
Schultheiss, T., Z. Lin, M.-H. Lu, J. Murray, D.A. Fischman, K. Weber, M. Masaki, M. Imamura, and H. Holtzer. 1990. Differential distribution of subsets of myofibrillar proteins in cardiac nonstriated and striated myofibrils. J. Cell Biol. 110:11591172.
Sorimachi, H., A. Freiburg, B. Kolmerer, S. Ishiura, G. Stier, C.C. Gregorio, D. Labeit, W.A. Linke, K. Suzuki, and S. Labeit. 1997. Tissue-specific expression and alpha-actinin binding properties of the Z-disc titin: implications for the nature of vertebrate Z-discs. J. Mol. Biol. 270:688695.[CrossRef][Medline]
Spencer, J.A., S. Eliazer, R.L. Ilaria, Jr., J.A. Richardson, and E.N. Olson. 2000. Regulation of microtubule dynamics and myogenic differentiation by MURF, a striated muscle RING-finger protein. J. Cell Biol. 150:771784.
Studier, F.W., A.H. Rosenberg, J.J. Dunn, and J.W. Dubendorff. 1990. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185:6089.[Medline]
Tatham, M.H., E. Jaffray, O.A. Vaughan, J.M. Desterro, C. Botting, J.H. Naismith, and R.T. Hay. 2001. Polymeric chains of SUMO-2 and SUMO-3 are conjugated to protein substrates by SAE1/SAE2 and Ubc9. J. Biol. Chem. 276:3536835374.
Theriault, J.R., S.J. Charette, H. Lambert, and J. Landry. 1999. Cloning and characterization of hGMEB1, a novel glucocorticoid modulatory element binding protein. FEBS Lett. 452:170176.[CrossRef][Medline]
Trinick, J. 1994. Titin and nebulin protein rulers in muscle? Trends Biochem. Sci. 19:405408.[CrossRef][Medline]
Trinick, J., and L. Tskhovrebova. 1999. Titin: a molecular control freak. Trends Cell Biol. 9:377380.[CrossRef][Medline]
van der Loop, F.T., P.F. van der Ven, D.O. Furst, M. Gautel, G.J. Van Eys, and F.C. Ramaekers. 1996. Integration of titin into the sarcomeres of cultured differentiating human skeletal muscle cells. Eur. J. Cell Biol. 69:301307.[Medline]
Wang, K., J. McClure, and A. Tu. 1979. Titin: major myofibrillar components of striated muscle. Proc. Natl. Acad. Sci. USA. 76:36983702.
Whiting, A., J. Wardale, and J. Trinick. 1989. Does titin regulate the length of muscle thick filaments? J. Mol. Biol. 205:263268.[CrossRef][Medline]
Young, P., C. Ferguson, S. Banuelos, and M. Gautel. 1998. Molecular structure of the sarcomeric Z-disk: two types of titin interactions lead to an asymmetrical sorting of alpha-actinin. EMBO J. 17:16141624.[CrossRef][Medline]
Zeng, H., D.A. Jackson, H. Oshima, and S.S. Simons, Jr. 1998. Cloning and characterization of a novel binding factor (GMEB-2) of the glucocorticoid modulatory element. J. Biol. Chem. 273:1775617762.
Zeng, H., S. Kaul, and S.S. Simons, Jr. 2000a. Genomic organization of human GMEB-1 and rat GMEB-2: structural conservation of two multifunctional proteins. Nucleic Acids Res. 28:18191829.
Zeng, H., S.Y. Plisov, and S.S. Simons, Jr. 2000b. Ability of the glucocorticoid modulatory element to modify glucocorticoid receptor transactivation indicates parallel pathways for the expression of glucocorticoid modulatory element and glucocorticoid response element activities. Mol. Cell. Endocrinol. 162:221234.[CrossRef][Medline]
Related Article
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|