JCB logo
CountessT Automated Cell Counter
  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

Published 10 June 2002. doi:10.1083/jcb.200201025
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 357K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JCB
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bonapace, I. M.
Right arrow Articles by Di Fiore, P. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bonapace, I. M.
Right arrow Articles by Di Fiore, P. P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

© The Rockefeller University Press, 0021-9525/2002/6/909 $5.00
The Journal of Cell Biology, Volume 157, Number 6, June 10, 2002 909-914


Report

Np95 is regulated by E1A during mitotic reactivation of terminally differentiated cells and is essential for S phase entry



Ian Marc Bonapace1,2, Lucia Latella3, Roberto Papait1,2, Francesco Nicassio1,4, Alessandra Sacco3, Masahiro Muto5, Marco Crescenzi3 and Pier Paolo Di Fiore1,4,6

1 The FIRC Institute for Molecular Oncology, 20134 Milan, Italy
2 Dipartimento di Biologia Strutturale e Funzionale, Universita' dell'Insubria, Busto Arsizio, 21052, Italy
3 Laboratory of Comparative Toxicology and Ecotoxicology, Istituto Superiore di Sanità, 00161 Rome, Italy
4 European Institute of Oncology, 20141, Milan, Italy
5 Division of Biology and Oncology, National Institute of Radiological Sciences, Inage-ku, Chiba 263-8555, Japan
6 Dipartimento di Medicina Chirurgia ed Odontoiatria, Universita' degli Studi di Milano, 20122 Milan, Italy

Address correspondence to Pier Paolo Di Fiore, The FIRC Institute for Molecular Oncology, Via Serio 21, 20134 Milan, Italy. Tel.: 39-02-57489855. Fax: 39-02-57489851. E-mail: difiore{at}ifom-firc.it


   Abstract
 Top
 Abstract
 Introduction
 Results and discussion
 Materials and methods
 References
 

Terminal differentiation exerts a remarkably tight control on cell proliferation. However, the oncogenic products of DNA tumor viruses, such as adenovirus E1A, can force postmitotic cells to proliferate, thus representing a powerful tool to study progression into S phase. In this study, we identified the gene encoding Np95, a murine nuclear phosphoprotein, as an early target of E1A-induced transcriptional events. In terminally differentiated (TD) cells, the activation of Np95 was specifically induced by E1A, but not by overexpression of E2F-1 or of the cyclin E (cycE)–cyclin-dependent kinase 2 (cdk2) complex. In addition, the concomitant expression of Np95 and of cycE–cdk2 was alone sufficient to induce S phase in TD cells. In NIH-3T3 cells, the expression of Np95 was tightly regulated during the cell cycle, and its functional ablation resulted in abrogation of DNA synthesis. Thus, expression of Np95 is essential for S phase entry. Previous evidence suggested that E1A, in addition to its well characterized effects on the pRb/E2F-1 pathway, activates a parallel and complementary pathway that is also required for the reentry in S phase of TD cells (Tiainen, M., D. Spitkousky, P. Jansen-Dürr, A. Sacchi, and M. Crescenzi. 1996. Mol. Cell. Biol. 16:5302–5312). From our results, Np95 appears to possess all the characteristics to represent the first molecular determinant identified in this pathway.

Key Words: Np95; cell cycle; E1A; pRb; cycE–cdk2


   Introduction
 Top
 Abstract
 Introduction
 Results and discussion
 Materials and methods
 References
 
Terminal differentiation of a cell is marked by its functional specialization and irreversible loss of proliferation ability. Skeletal muscle cells, such as C2C12, are a well characterized model system to study this process. In vitro, myoblasts deprived of growth factors enter an irreversible postmitotic state and activate the expression of muscle-specific genes, thus becoming myocytes. Myocytes, in turn, can fuse into multinucleated, syncytial structures called myotubes (Okazaki and Holtzer, 1966). Terminally differentiated (TD)* myotubes can be induced to enter the cell cycle by growth factors. However, they cannot progress beyond a mid-G1 block, and hence do not enter the S phase (Tiainen et al., 1996a). Even forced expression of cell cycle regulators, such as E2Fs or the cyclin E (cycE)–cyclin-dependent kinase 2 (cdk2) complex, is unable to trigger DNA synthesis in TD muscle cells (Puri et al., 1998; Pajalunga et al., 1999; Latella et al., 2001). Conversely, early gene products of DNA tumor viruses, such as adenovirus E1A, are able to stimulate S phase entry of quiescent or TD cells (Crescenzi et al., 1995; Tiainen et al., 1996b). Thus, they constitute a powerful tool to study how postmitotic cells can be forced to proliferate, an issue of great relevance to the understanding of human cancer.

The E1A region of human adenovirus 5 produces two major mRNAs, 12S and 13S, which encode nuclear proteins of 243 and 289 amino acids, respectively. The 12S variant of E1A (hereafter referred to as E1A) is sufficient to promote cell cycle reentry and S phase in TD myotubes (Tiainen et al., 1996b) by a mechanism that is only partially elucidated. E1A displays multiple interactions with key components of cellular growth-regulatory pathways, including retinoblastoma protein (pRb)-family proteins (the so-called pocket proteins) and the transcriptional coactivators p300 and CBP (Arany et al., 1994, 1995). Although these interactions are required for the ability of E1A to immortalize and transform cells (Eckner, 1996), its capacity to reactivate the cell cycle segregates with binding to pocket proteins, whereas binding to p300 is not required (Stein et al., 1990; Tiainen et al., 1996b; Puri et al., 1997).

Binding of E1A to pocket proteins releases transcription factors of the E2F family (Nevins, 1990) that are master regulators of the G1/S transition and are able to induce DNA synthesis in a variety of quiescent, non-TD cells (Johnson et al., 1993; Lukas et al., 1996). E2Fs act in part by transcriptionally up-regulating the kinase activity of the cycE–cdk2 complex (Müller and Helin, 2000). However, neither the overexpression of several E2Fs nor that of cycE–cdk2 could force the reentry into S phase of TD myotubes (Pajalunga et al., 1999; Latella et al., 2001). Thus, E1A must be activating complementary pathways that contribute to the G1/S transition of TD myotubes. An investigation of such pathways is warranted by both their central role in the control of cell proliferation and their possible alterations in neoplastic cells. The present studies were undertaken in an attempt to elucidate this issue.


   Results and discussion
 Top
 Abstract
 Introduction
 Results and discussion
 Materials and methods
 References
 
Np95 is induced early in the reentry of TD myotubes in the cell cycle
To gain insight into the molecular mechanisms leading to reactivation of TD cells, we used a cDNA subtraction approach to identify genes induced by E1A in TD myotubes. TD C2C12 mouse myotubes were infected with either the adenovirus dl520, which expresses only the 12S E1A mRNA, or the control adenovirus dl312, in which the E1A gene is deleted (Jones and Shenk, 1979). The efficiency of S phase reentry, measured 48 h after dl520 infection, was ~70–80% (Fig. 1 A). To select for genes induced by E1A at early stages, mRNAs from infected cells were harvested at 14, 15, 16, 18, 20, and 24 h after infection. These time points precede (by at least 6 h) the onset of DNA replication (occurring ~30 h after infection). Pooled mRNAs were used for the cDNA subtraction procedures (see Materials and methods).



View larger version (70K):
[in this window]
[in a new window]
 
Figure 1. Np95 is an early E1A-induced gene. (A) TD myotubes were infected with either dl520 (left, MOI, 400 pfu/cell) or dl312 as a control (right, MOI, 400 pfu/cell). 24 h later, cells were treated with BrdU. 48 h after infection, cells were fixed and stained with anti–myosin heavy chain (red) to check differentiation and anti-BrdU (green) antibodies. Nuclear counterstaining was performed with DAPI (blue). (B) Schematic of mouse Np95; the various domains of the protein are indicated (Ubl, ubiquitin-like; NLS, nuclear localization signal). Two putative pRb-binding motifs, LxCxE and IxCxE (Dahiya et al., 2000), are indicated by asterisks. (C) TD myotubes were infected with either dl520 (MOI, 400 pfu/cell) or dl312 (MOI, 400 pfu/cell), and mRNA or proteins were harvested at the indicated time points. RNAs (2 µg Poly(A)+, top) were analyzed in Northern blot (NB) with the indicated probes. Proteins (40 µg of total cellular lysates, bottom) were immunoblotted (IB) with the indicated antibodies. pRb and ph-pRb are a pan–anti-pRb and a specific anti-phosphoRb, respectively (see Materials and methods). The levels of Np95 before (myoblasts) and after (myotubes) differentiation are also shown.

 
Among the genes induced by E1A, we isolated Np95, which encodes a previously described murine nuclear phosphoprotein, and whose expression is cell cycle regulated (Fujimori et al., 1998; Uemura et al., 2000; Miura et al., 2001; Fig. 1 B). Fig. 1 C shows the mRNA and protein expression of Np95, before and after terminal differentiation of C2C12 cells, and after their reentry in the cell cycle induced by infection with dl520. The expression of Np95 was virtually abolished by terminal differentiation, both at the mRNA and protein levels (Fig. 1 C, compare Myoblasts with Myotubes), and reinduced by infection with dl520, but not with dl312. Np95 mRNA and protein started to be detectable ~15–16 h after infection, and continued to increase until the last time points were checked (20–24 h after infection; Fig. 1 C). Because the expression of the E1A mRNA was first detectable at 15 h after infection (unpublished data), as also previously reported (Tiainen et al., 1996a), we concluded that Np95 is an early E1A-induced gene.

Np95 is specifically induced by E1A and complements cycE–cdk2 in the induction of reentry in the cell cycle of TD myotubes
To establish a role for Np95 in the sequence of events activated by E1A, we performed a series of experiments. First, we investigated the induction of Np95 by different stimuli. As shown in Fig. 2 A, overexpression of E1A (dl520 lane) potently induced the expression of Np95. Stimulation with serum, or overexpression of either E2F-1 or of cycE–cdk2, only exerted minute effects (Fig. 2 A), possibly attributable to a small percentage of myoblasts contaminating the myotube cultures. As a control, we checked the levels of cycE and the phosphorylation status of pRb. As expected, both E1A and E2F-1 induced the expression of cycE (Tiainen et al., 1996b; Pajalunga et al., 1999), whereas both E1A and cycE–cdk2, but not E2F-1, induced hyperphosphorylation of pRb (Tiainen et al., 1996b; Pajalunga et al., 1999; Mal et al., 2000; Latella et al., 2001; Fig. 2 A). Thus, in TD myotubes Np95 expression depends essentially on the activation by E1A of pathways besides those relying on the stimulation of the activity of the cycE–cdk2 complex or the presence of high levels of free E2F-1.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 2. Role of Np95 in the reentry in the cell cycle of TD myotubes. (A) TD myotubes were infected with dl520 (MOI, 400 pfu/cell), dl312 (MOI, 400 pfu/cell), or adenoviral vectors encoding E2F-1 (MOI, 400 pfu/cell), cycE (MOI, 100 pfu/cell)/cdk2 (MOI, 400 pfu/cell), or stimulated with 5% FCS, as indicated on top. 48 h after infection, total cellular lysates were extracted and immunoblotted (40 µg) with the indicated antibodies. Lanes myoblasts and myotubes are as in Fig. 1 C. (B) TD myotubes were infected with adenoviral vectors, as indicated on the right. MOIs were as follows: cycE, 100 pfu/cell; cdk2, 400 pfu/cell; and Np95, 60 pfu/cell. 24 h later, cells were treated with BrdU. 48 h after infection, cells were fixed and stained with anti-BrdU (red), and either anti–myosin heavy chain (green, top two rows, MHC), or anti-cycE (green, middle row) antibodies, or detected by epifluorescence (green, bottom two rows, to detect GFP-Np95). Nuclear counterstaining was performed with DAPI (blue). For each condition (horizontally paired panels), two pictures of the same microscopic field are shown. All left panels display the blue (DAPI) and green (either MHC, or cycE, or GFP) channels. All right panels display the green (either MHC, or cycE, or GFP) and red (BrdU) channels. Stainings are also indicated by a color code (squares).

 
E1A reactivates proliferation of TD muscle cells by a mechanism that includes release of E2Fs and activation of the cycE–cdk2 complex, but also requires other pathway(s) that are presently not molecularly defined (Tiainen et al., 1996b; Latella et al., 2001). From these results, Np95 appears to possess the requisites to be part of such a pathway. If so, its overexpression might complement that of cycE–cdk2 toward induction of the S phase in TD myotubes. Thus, we coexpressed Np95, cycE and cdk2 in C2C12 myotubes, through adenoviral vectors. When the three proteins were coexpressed, ~20% of the myotubes entered S phase within 60 h after infection (Fig. 2 B and Table I). Conversely, no reentry in the cell cycle was induced by expression of Np95 alone, by the cycE–cdk2 combination, or several other negative controls (Fig. 2 B and Table I).


View this table:
[in this window]
[in a new window]
 
Table I. Np95 cooperates with cycE–cdk2 to induce S phase entry of TD myotubes

 
Np95 is essential for entry into S phase
Taken together, the previous results suggest that Np95 could be a critical effector in the progression of a cell through the cycle. The fact that Np95 cooperates with cycE–cdk2 to overcome the G1 block in TD cells further suggests that its action might be exerted physiologically at the G1/S transition. To address this question, we switched to NIH-3T3 cells in which functional ablation of the expression of a protein could be more easily achieved. In these cells, the expression of Np95 is known to be cell cycle regulated (Uemura et al., 2000; Miura et al., 2001). Indeed, in serum-starved NIH-3T3 cells, Np95 was undetectable (Fig. 3 A). Its expression started to be clearly detectable after 9 h of restimulation with serum, i.e., 6 h before the onset of S phase (Fig. 3 B). These results mirrored those obtained in TD myotubes stimulated with E1A, and suggested the reactivation of Np95 occurs by similar mechanisms in cells that display either a reversible or an irreversible cell cycle arrest.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 3. Cell cycle–dependent regulation of Np95 in NIH-3T3 cells. (A) NIH-3T3 cells were serum-starved for 48 h, and then stimulated with 10% FCS for the indicated time points. (A) Immunoblots (40 µg of total proteins) with the indicated antibodies. The levels of Np95 in serum-starved cells (Starv) or in an asynchronously growing population (Async) are also shown. (B) FACS® profiles: open circles, G0/G1; closed circles, S; squares, G2/M.

 
Next, we attempted functional ablation of Np95, by an antisense approach. Serum-starved NIH-3T3 cells were microinjected with a morpholino-modified antisense oligonucleotide of 25 bp that matched the sequence of Np95 and overlapped its ATG. As a control, we microinjected a similar oligonucleotide bearing four mismatched bases, including one in the start codon (see Materials and methods). Serum and BrdU were then added to the cells that were fixed 24 h later. As shown in Fig. 4 A, the expression of Np95 and BrdU incorporation was dramatically reduced in cells microinjected with the antisense oligonucleotide, but not with the mismatched control. Around 80% of the cells microinjected with the antisense oligonucleotide were inhibited in their progression into S phase (Fig. 4 B), thus demonstrating that Np95 is essential for the progression through the cell cycle.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 4. Functional ablation of Np95 in NIH-3T3 cells. (A) NIH-3T3 were serum starved for 48 h, and then microinjected with the Np95 antisense (AS) oligonucleotide or its mismatched (MIS) control. IgGs were also microinjected to identify microinjected cells. BrdU and 10% FCS were then added, and cells were fixed 24 h later and stained as indicated. Nuclear counterstaining was performed with DAPI. (B) A quantitative assessment was performed on three independent experiments, in which at least 150 microinjected cells per experiment were counted. Results are shown as a percentage of microinjected cells (±SD) that were Np95-positive (solid bars) or BrdU-positive (empty bars).

 
Np95: an oncogene candidate?
Terminal differentiation exerts a remarkably tight control on cell proliferation. Because TD cells constitute the majority in an adult mammal, the understanding of how they can be forced to reenter the cell cycle might be very relevant to human cancer. TD myotubes are extremely refractory to the mitogenic action of several oncogenes and growth-promoting inducers (Tiainen et al., 1996b; Latella et al., 2001), but sensitive to the action of E1A, and therefore represents an invaluable tool to dissect critical mechanisms in cell cycle progression. Previous evidence suggests that E1A, in addition to its well characterized effects on the pRb/E2F-1 pathway, activates a parallel and complementary pathway that is also required for the reentry in S phase (Tiainen et al., 1996b; Alevizopoulos et al., 1998, 2000; Latella et al., 2001). In this study, we show that Np95 has all the characteristics to be the first molecular determinant identified in this pathway. Np95 appears to constitute a critical effector of this pathway, because it can complement the overexpression of cycE–cdk2 toward stimulation of S phase in TD myotubes. In addition, the function of Np95 is physiologically required for progression through the cell cycle, as witnessed by its tight regulation and by the dramatic effects of its functional ablation in NIH-3T3 cells.

Many important questions remain to be addressed. How is the transcription of Np95 regulated under physiological conditions? What is the physiological function of Np95? How does it signal downstream? With regard to the first question, we note that overexpression of cycD–cdk4 was recently shown to induce S phase entry of TD myotubes (Latella et al., 2001). Thus, it is possible that Np95 is a transcriptional target of a pathway that includes the kinase activity of this complex, a possibility that we are currently testing.

As far as the function of Np95 is concerned, a human gene (ICBP90) that displays remarkable similarity to mouse Np95 (74% identity and 84% overall similarity at the amino acid level), was recently isolated in a one-hybrid system as an inverted CCAAT box–interacting protein of the topoisomerase II{alpha} promoter (Hopfner et al., 2000), and shown to be involved in the transcriptional control of this gene. Although it remains to be established whether ICBP90 and Np95 are orthologues, our results suggest the possibility that Np95 acts in transcriptional control. In addition, the presence in Np95 of many structural and functional domains, including a ubiquitin-like domain, a PHD finger, pRb-binding motifs, and a RING domain, suggests that Np95 might control several protein–protein interactions and enzymatic activities required for S phase entry. The absolute requirement for Np95 in this critical phase of the cell cycle warrants further investigations on its possible role in malignant transformation.


   Materials and methods
 Top
 Abstract
 Introduction
 Results and discussion
 Materials and methods
 References
 
Cells and microinjection procedures
C2C12 myoblasts (Yaffe and Saxel, 1977) were cultured in collagen-coated dishes in DME supplemented with 10% FBS. Differentiation was induced by serum deprivation for 72 h (Tiainen et al., 1996b). Unless otherwise stated, 50 mM 1-ß-D-arabinofuranosylcytosine (Ara-C) was added during the first 48 h to eliminate undifferentiated cells. Ara-C–purified myotubes contained >90% of the nuclei in the culture.

For microinjections, morpholino-modified oligonucleotides (Gene-Tools Inc.) were prepared at a concentration of 0.5 µM. The following oligos were used in Fig. 4: antisense, 5'CATGATGCCGATGTACTCTCTCACG3' (the antisense codon corresponding to ATG is underlined); and control (bearing four mismatches), 5'CAAGATCCCGATGTACTGTCTGACGCAAGATGCCGATGTACTGTCTGACG3'. Microinjection was performed with a microinjector (model Axiovert 100; ZEISS).

Adenoviruses
The dl520 and dl312 adenoviruses have been described previously (Haley et al., 1984; Zerler et al., 1987; Wang et al., 1993). The Ad-cdk2 and Ad-cycE recombinant adenoviruses have also been described previously (Latella et al., 2001). Ad-E2F-1 was a gift of J. Nevins (Howard Hughes Medical Institute, Duke University Medical Center, Durham, NC; DeGregori et al., 1997). The Ad-Np95 adenovirus was generated according to He et al. (1998) by placing the cDNA for Np95 (Fujimori et al., 1998) under the control of the cytomegalovirus immediate-early promoter enhancer. This virus also expressed the green fluorescent protein under the control of a second copy of the cytomegalovirus promoter. All adenoviruses were grown and titrated in the permissive 293 cell line (Harrison et al., 1977). The multiplicity of infection (MOI) for all biological experiments is expressed as plaque-forming unit (pfu), as established by titration on 293 cells per infected cells.

RNA extraction, Northern blotting, and cDNA subtraction
Total RNAs were prepared by guanidine-cesium chloride gradient according to published methods (Sambrook et al., 1989). Poly(A)+ RNA was prepared with a commercial kit (Amersham Pharmacia Biotech), based on the oligo-dT method, according to the manufacturer's instructions. The cDNA subtraction was performed with the PCR select cDNA subtraction kit (CLONTECH Laboratories, Inc.) according to the manufacturer's instructions (Diatchenko et al., 1996).

Protein studies
Preparation of cellular lysates, immunoprecipitation, and immunoblotting were performed as described previously (Fazioli et al., 1993). Immunofluorescence procedures were also as described previously (Tiainen et al., 1996b; Latella et al., 2001). Antibodies used were as follows: rabbit antiserum to cycE (Santa Cruz Biotechnology, Inc.), mAb clone G3–245 to pRb (BD PharMingen; pRb in all figures), rabbit antiserum to pRb phosphorylated on serine 807/811 (Cell Signaling; ph-pRb in all figures), mAb against E2F-1 (a gift of K. Helin, European Institute of Oncology, Milan Italy), goat antiserum against lamin B (Santa Cruz Biotechnology, Inc.), rat Th-10a mAb to Np95 (Muto et al., 1995), mouse mAb to BrdU (Becton Dickinson), and rabbit antiserum to muscle-specific myosin heavy chain (a gift of G. Cossu, Stem Cell Research Institute, Rome, Italy). In immunofluorescence experiments, mAbs were detected either with donkey anti–mouse Cy3 (red) or donkey anti–mouse FITC (green) secondary antibodies. The Np95 mAb was detected with a goat anti–rat Cy3 (red). pAbs were detected with donkey anti–rabbit FITC (green). Pictures were acquired with a color-chilled camera (model 3CCD-C5810; Hamamatsu Corporation). Blots were digitalized with an AGFA scan system. All images were managed with Adobe Photoshop®.


   Footnotes
 
* Abbreviations used in this paper: cdk2, cyclin-dependent kinase 2; cycE, cyclin E; MOI, multiplicity of infection; pfu, plaque-forming unit; pRb, retinoblastoma protein; TD, terminally differentiated. Back


   Acknowledgments
 
M. Crescenzi and P.P. Di Fiore dedicate this paper to the memory of Franco Tatò.

We thank J. Nevins, G. Cossu, and K. Helin for reagents.

This work was supported by grants from Associazione Italiana Ricerca sul Cancro (AIRC), Telethon Italy (Grant D-90), Consiglio Nazionale delle Ricerche (target project Biotechnology) and European Community (V Framework) to P.P. Di Fiore, and from AIRC, Telethon Italy (Grant GP0293/01), and the Italian Ministry of Health to M. Crescenzi. R. Papait and A. Sacco were supported by fellowships from the Associazione per la Promozione della Ricerca Medico-Biologica–Brescia and AIRC, respectively.

Submitted: 4 January 2002

Revised: 24 April 2002

Accepted: 6 May 2002


   References
 Top
 Abstract
 Introduction
 Results and discussion
 Materials and methods
 References
 

Alevizopoulos, K., B. Catarin, J. Vlach, and B. Amati. 1998. A novel function of adenovirus E1A is required to overcome growth arrest by the CDK2 inhibitor p27(Kip1). EMBO J. 17:5987–5997.[CrossRef][Medline]

Alevizopoulos, K., B. Sanchez, and B. Amati. 2000. Conserved region 2 of adenovirus E1A has a function distinct from pRb binding required to prevent cell cycle arrest by p16INK4a or p27Kip1. Oncogene. 19:2067–2074.[CrossRef][Medline]

Arany, Z., W.R. Sellers, D.M. Livingston, and R. Eckner. 1994. E1A-associated p300 and CREB-associated CBP belong to a conserved family of coactivators. Cell. 77:799–800.[CrossRef][Medline]

Arany, Z., D. Newsome, E. Oldread, D.M. Livingston, and R. Eckner. 1995. A family of transcriptional adaptor proteins targeted by the E1A oncoprotein. Nature. 374:81–84.[CrossRef][Medline]

Crescenzi, M., S. Soddu, and F. Tatò. 1995. Mitotic cycle reactivation in terminally differentiated cells by adenovirus infection. J. Cell. Physiol. 162:26–35.[CrossRef][Medline]

Dahiya, A., M.R. Gavin, R.X. Luo, and D.C. Dean. 2000. Role of the LXCXE binding site in Rb function. Mol. Cell. Biol. 20:6799–6805.[Abstract/Free Full Text]

DeGregori, J., G. Leone, A. Miron, L. Jakoi, and J.R. Nevins. 1997. Distinct roles for E2F proteins in cell growth control and apoptosis. Proc. Natl. Acad. Sci. USA. 94:7245–7250.[Abstract/Free Full Text]

Diatchenko L, Y.F. Lau, A.P. Campbell, A. Chenchik, F. Moqadam, B. Huang, S. Lukyanov, K. Lukyanov, N. Gurskaya, E.D. Sverdlov, and P.D. Siebert. 1996. Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc. Natl. Acad. Sci. USA. 93:6025–6030.[Abstract/Free Full Text]

Eckner, R. 1996. p300 and CBP as transcriptional regulators and targets of oncogenic events. Biol. Chem. 377:685–688.[Medline]

Fazioli, F., L. Minichiello, V. Matoska, P. Castagnino, T. Miki, W.T. Wong, and P.P. Di Fiore. 1993. Eps8, a substrate for the epidermal growth factor receptor kinase, enhances EGF-dependent mitogenic signals. EMBO J. 12:3799–3808.[Medline]

Fujimori, A., Y. Matsuda, Y. Takemoto, Y. Hashimoto, E. Kubo, R. Araki, R. Fukumura, K. Mita, K. Tatsumi, and M. Muto. 1998. Cloning and mapping of Np95 gene which encodes a novel nuclear protein associated with cell proliferation. Mamm. Genome. 9:1032–1035.[CrossRef][Medline]

Haley, K.P., J. Overhauser, L.E. Babiss, H.S. Ginsberg, and N.C. Jones. 1984. Transformation properties of type 5 adenovirus mutants that differentially express the E1A gene products. Proc. Natl. Acad. Sci. USA. 81:5734–5738.[Abstract/Free Full Text]

Harrison, T., F.L. Graham, and J. Williams. 1977. Host-range mutant of adenovirus type 5 defective for growth in HeLa cells. Virology. 77:319–329.[CrossRef][Medline]

He, T.C., S. Zhou, L.T. da Costa, J. Yu, K.W. Kinzler, and B. Vogelstein. 1998. A simplified system for generating recombinant adenoviruses. Proc. Natl. Acad. Sci. USA. 95:2509–2514.[Abstract/Free Full Text]

Hopfner, R., M. Mousli, J.M. Jeltsch, A. Voulgaris, Y. Lutz, C. Marin, J.P. Bellocq, P. Oudet, and C. Bronner. 2000. ICBP90, a novel human CCAAT binding protein, involved in the regulation of topoisomerase IIalpha expression. Cancer Res. 60:121–128.[Abstract/Free Full Text]

Johnson, D.G., J.K. Schwartz, W.D. Cress, and J.R. Nevins. 1993. Expression of transcription factor E2F-1 induces quiescent cells to enter S phase. Nature. 365:349–352.[CrossRef][Medline]

Jones, N., and T. Shenk. 1979. Isolation of adenovirus type 5 host range deletion mutants defective for transformation of rat embryo cells. Cell. 17:683–689.[CrossRef][Medline]

Latella, L., A. Sacco, D. Pajalunga, M. Tiainen, D. Macera, M. D'Angelo, A. Felici, A. Sacchi, and M. Crescenzi. 2001. Reconstitution of cyclin D1-associated kinase activity drives terminally differentiated cells into the cell cycle. Mol. Cell. Biol. 16:5631–5643.

Lukas, J., B.O. Petersen, K. Holm, J. Bartek, and K. Helin. 1996. Deregulated expression of E2F family members induces S-phase entry and overcomes p16INK4A-mediated growth suppression. Mol. Cell. Biol. 16:1047–1057.[Abstract/Free Full Text]

Mal, A., D. Chattopadhyay, M.K. Ghosh, R.Y. Poon, T. Hunter, and M.L. Harter. 2000. p21 and retinoblastoma protein control the absence of DNA replication in terminally differentiated muscle cells. J. Cell Biol. 149:281–292.[Abstract/Free Full Text]

Miura, M., H. Watanabe, T. Sasaki, K. Tatsumi, and M. Muto. 2001. Dynamic changes in subnuclear Np95 location during the cell cycle and its spatial relationship with DNA replication foci. Exp. Cell Res. 263:202–208.[CrossRef][Medline]

Müller, H., and K. Helin. 2000. The E2F transcription factors: key regulators of cell proliferation. Biochim. Biophys. Acta. 1470:M1–M12.[Medline]

Muto, M., M. Utsuyama, T. Horiguchi, E. Kubo, T. Sado, and K. Hirokawa. 1995. The characterization of the monoclonal antibody Th-10a, specific for a nuclear protein appearing in the S phase of the cell cycle in normal thymocytes and its unregulated expression in lymphoma cell lines. Cell Prolif. 12:645–657.

Nevins, J.R. 1990. Adenovirus E1A-dependent trans-activation of transcription. Semin. Cancer Biol. 1:59–68.[Medline]

Okazaki, K., and H. Holtzer. 1966. Myogenesis: fusion, myosin synthesis, and the mitotic cycle. Proc. Natl. Acad. Sci. USA. 56:1484–1490.[Free Full Text]

Pajalunga, D., D. Tognozzi, M. Tiainen, M. D'Angelo, F. Ferrantelli, K. Helin, A. Sacchi, and M. Crescenzi. 1999. E2F activates late-G1 events but cannot replace E1A in inducing S phase in terminally differentiated skeletal muscle cells. Oncogene. 18:5054–5062.[CrossRef][Medline]

Puri, P.L., V. Sartorelli, X.J. Yang, Y. Hamamori, V.V. Ogryzko, B.H. Howard, L. Kedes, J.Y. Wang, A. Graessmann, Y. Nakatani, and M. Levrero. 1997. Differential roles of p300 and PCAF acetyltransferases in muscle differentiation. Mol. Cell. 1:35–45.[CrossRef][Medline]

Puri, P.L., L. Cimino, M. Fulco, C. Zimmerman, N.B. La Thangue, A. Giordano, A. Graessmann, and M. Levrero. 1998. Regulation of E2F4 mitogenic activity during terminal differentiation by its heterodimerization partners for nuclear translocation. Cancer Res. 58:1325–1331.[Abstract/Free Full Text]

Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory. Cold Spring Harbor, NY.

Stein, R.W., M. Corrigan, P. Yaciuk, J. Whelan, and E. Moran. 1990. Analysis of E1A-mediated growth regulation functions: binding of the 300-kilodalton cellular product correlates with E1A enhancer repression function and DNA synthesis-inducing activity. J. Virol. 64:4421–4427.[Abstract/Free Full Text]

Tiainen, M., D. Pajalunga, F. Ferrantelli, S. Soddu, G. Salvatori, A. Sacchi, and M. Crescenzi. 1996a. Terminally differentiated skeletal myotubes are not confined to G0 but can enter G1 upon growth factor stimulation. Cell Growth Differ. 7:1039–1050.[Abstract]

Tiainen, M., D. Spitkovsky, P. Jansen-Dürr, A. Sacchi, and M. Crescenzi. 1996b. Expression of E1A in terminally differentiated muscle cells reactivates the cell cycle and suppresses tissue-specific genes by separable mechanisms. Mol. Cell. Biol. 16:5302–5312.[Abstract/Free Full Text]

Uemura, T., E. Kubo, Y. Kanari, T. Ikemura, K. Tatsumi, and M. Muto. 2000. Temporal and spatial localization of novel nuclear protein NP95 in mitotic and meiotic cells. Cell Struct. Funct. 25:149–159.[CrossRef][Medline]

Wang, H.-G.H., Y. Rikitake, M.C. Carter, P. Yaciuk, S.E. Abraham, B. Zerler, and E. Moran. 1993. Identification of specific adenovirus E1A N-terminal residues critical to the binding of cellular proteins and to the control of cell growth. J. Virol. 67:476–488.[Abstract/Free Full Text]

Yaffe, D., and O. Saxel. 1977. Serial passaging and differentiation of myo-genic cells isolated from dystrophic mouse muscle. Nature. 270:725–727.[CrossRef][Medline]

Zerler, B., R.J. Roberts, M.B. Mathews, and E. Moran. 1987. Different functional domains of the adenovirus E1A gene are involved in regulation of host cell cycle products. Mol. Cell. Biol. 7:821–829.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 357K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JCB
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bonapace, I. M.
Right arrow Articles by Di Fiore, P. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bonapace, I. M.
Right arrow Articles by Di Fiore, P. P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?


  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents