|
||
© The Rockefeller University Press,
0021-9525/2002/6/909 $5.00
The Journal of Cell Biology, Volume 157, Number 6, June 10, 2002 909-914
Report |
Np95 is regulated by E1A during mitotic reactivation of terminally differentiated cells and is essential for S phase entry
Address correspondence to Pier Paolo Di Fiore, The FIRC Institute for Molecular Oncology, Via Serio 21, 20134 Milan, Italy. Tel.: 39-02-57489855. Fax: 39-02-57489851. E-mail: difiore{at}ifom-firc.it
| Abstract |
|---|
|
|
|---|
Terminal differentiation exerts a remarkably tight control on cell proliferation. However, the oncogenic products of DNA tumor viruses, such as adenovirus E1A, can force postmitotic cells to proliferate, thus representing a powerful tool to study progression into S phase. In this study, we identified the gene encoding Np95, a murine nuclear phosphoprotein, as an early target of E1A-induced transcriptional events. In terminally differentiated (TD) cells, the activation of Np95 was specifically induced by E1A, but not by overexpression of E2F-1 or of the cyclin E (cycE)cyclin-dependent kinase 2 (cdk2) complex. In addition, the concomitant expression of Np95 and of cycEcdk2 was alone sufficient to induce S phase in TD cells. In NIH-3T3 cells, the expression of Np95 was tightly regulated during the cell cycle, and its functional ablation resulted in abrogation of DNA synthesis. Thus, expression of Np95 is essential for S phase entry. Previous evidence suggested that E1A, in addition to its well characterized effects on the pRb/E2F-1 pathway, activates a parallel and complementary pathway that is also required for the reentry in S phase of TD cells (Tiainen, M., D. Spitkousky, P. Jansen-Dürr, A. Sacchi, and M. Crescenzi. 1996. Mol. Cell. Biol. 16:53025312). From our results, Np95 appears to possess all the characteristics to represent the first molecular determinant identified in this pathway.
Key Words: Np95; cell cycle; E1A; pRb; cycEcdk2
| Introduction |
|---|
|
|
|---|
The E1A region of human adenovirus 5 produces two major mRNAs, 12S and 13S, which encode nuclear proteins of 243 and 289 amino acids, respectively. The 12S variant of E1A (hereafter referred to as E1A) is sufficient to promote cell cycle reentry and S phase in TD myotubes (Tiainen et al., 1996b) by a mechanism that is only partially elucidated. E1A displays multiple interactions with key components of cellular growth-regulatory pathways, including retinoblastoma protein (pRb)-family proteins (the so-called pocket proteins) and the transcriptional coactivators p300 and CBP (Arany et al., 1994, 1995). Although these interactions are required for the ability of E1A to immortalize and transform cells (Eckner, 1996), its capacity to reactivate the cell cycle segregates with binding to pocket proteins, whereas binding to p300 is not required (Stein et al., 1990; Tiainen et al., 1996b; Puri et al., 1997).
Binding of E1A to pocket proteins releases transcription factors of the E2F family (Nevins, 1990) that are master regulators of the G1/S transition and are able to induce DNA synthesis in a variety of quiescent, non-TD cells (Johnson et al., 1993; Lukas et al., 1996). E2Fs act in part by transcriptionally up-regulating the kinase activity of the cycEcdk2 complex (Müller and Helin, 2000). However, neither the overexpression of several E2Fs nor that of cycEcdk2 could force the reentry into S phase of TD myotubes (Pajalunga et al., 1999; Latella et al., 2001). Thus, E1A must be activating complementary pathways that contribute to the G1/S transition of TD myotubes. An investigation of such pathways is warranted by both their central role in the control of cell proliferation and their possible alterations in neoplastic cells. The present studies were undertaken in an attempt to elucidate this issue.
| Results and discussion |
|---|
|
|
|---|
7080% (Fig. 1 A). To select for genes induced by E1A at early stages, mRNAs from infected cells were harvested at 14, 15, 16, 18, 20, and 24 h after infection. These time points precede (by at least 6 h) the onset of DNA replication (occurring
30 h after infection). Pooled mRNAs were used for the cDNA subtraction procedures (see Materials and methods).
|
1516 h after infection, and continued to increase until the last time points were checked (2024 h after infection; Fig. 1 C). Because the expression of the E1A mRNA was first detectable at 15 h after infection (unpublished data), as also previously reported (Tiainen et al., 1996a), we concluded that Np95 is an early E1A-induced gene.
Np95 is specifically induced by E1A and complements cycEcdk2 in the induction of reentry in the cell cycle of TD myotubes
To establish a role for Np95 in the sequence of events activated by E1A, we performed a series of experiments. First, we investigated the induction of Np95 by different stimuli. As shown in Fig. 2 A, overexpression of E1A (dl520 lane) potently induced the expression of Np95. Stimulation with serum, or overexpression of either E2F-1 or of cycEcdk2, only exerted minute effects (Fig. 2 A), possibly attributable to a small percentage of myoblasts contaminating the myotube cultures. As a control, we checked the levels of cycE and the phosphorylation status of pRb. As expected, both E1A and E2F-1 induced the expression of cycE (Tiainen et al., 1996b; Pajalunga et al., 1999), whereas both E1A and cycEcdk2, but not E2F-1, induced hyperphosphorylation of pRb (Tiainen et al., 1996b; Pajalunga et al., 1999; Mal et al., 2000; Latella et al., 2001; Fig. 2 A). Thus, in TD myotubes Np95 expression depends essentially on the activation by E1A of pathways besides those relying on the stimulation of the activity of the cycEcdk2 complex or the presence of high levels of free E2F-1.
|
20% of the myotubes entered S phase within 60 h after infection (Fig. 2 B and Table I). Conversely, no reentry in the cell cycle was induced by expression of Np95 alone, by the cycEcdk2 combination, or several other negative controls (Fig. 2 B and Table I).
|
|
|
Many important questions remain to be addressed. How is the transcription of Np95 regulated under physiological conditions? What is the physiological function of Np95? How does it signal downstream? With regard to the first question, we note that overexpression of cycDcdk4 was recently shown to induce S phase entry of TD myotubes (Latella et al., 2001). Thus, it is possible that Np95 is a transcriptional target of a pathway that includes the kinase activity of this complex, a possibility that we are currently testing.
As far as the function of Np95 is concerned, a human gene (ICBP90) that displays remarkable similarity to mouse Np95 (74% identity and 84% overall similarity at the amino acid level), was recently isolated in a one-hybrid system as an inverted CCAAT boxinteracting protein of the topoisomerase II
promoter (Hopfner et al., 2000), and shown to be involved in the transcriptional control of this gene. Although it remains to be established whether ICBP90 and Np95 are orthologues, our results suggest the possibility that Np95 acts in transcriptional control. In addition, the presence in Np95 of many structural and functional domains, including a ubiquitin-like domain, a PHD finger, pRb-binding motifs, and a RING domain, suggests that Np95 might control several proteinprotein interactions and enzymatic activities required for S phase entry. The absolute requirement for Np95 in this critical phase of the cell cycle warrants further investigations on its possible role in malignant transformation.
| Materials and methods |
|---|
|
|
|---|
For microinjections, morpholino-modified oligonucleotides (Gene-Tools Inc.) were prepared at a concentration of 0.5 µM. The following oligos were used in Fig. 4: antisense, 5'CATGATGCCGATGTACTCTCTCACG3' (the antisense codon corresponding to ATG is underlined); and control (bearing four mismatches), 5'CAAGATCCCGATGTACTGTCTGACGCAAGATGCCGATGTACTGTCTGACG3'. Microinjection was performed with a microinjector (model Axiovert 100; ZEISS).
Adenoviruses
The dl520 and dl312 adenoviruses have been described previously (Haley et al., 1984; Zerler et al., 1987; Wang et al., 1993). The Ad-cdk2 and Ad-cycE recombinant adenoviruses have also been described previously (Latella et al., 2001). Ad-E2F-1 was a gift of J. Nevins (Howard Hughes Medical Institute, Duke University Medical Center, Durham, NC; DeGregori et al., 1997). The Ad-Np95 adenovirus was generated according to He et al. (1998) by placing the cDNA for Np95 (Fujimori et al., 1998) under the control of the cytomegalovirus immediate-early promoter enhancer. This virus also expressed the green fluorescent protein under the control of a second copy of the cytomegalovirus promoter. All adenoviruses were grown and titrated in the permissive 293 cell line (Harrison et al., 1977). The multiplicity of infection (MOI) for all biological experiments is expressed as plaque-forming unit (pfu), as established by titration on 293 cells per infected cells.
RNA extraction, Northern blotting, and cDNA subtraction
Total RNAs were prepared by guanidine-cesium chloride gradient according to published methods (Sambrook et al., 1989). Poly(A)+ RNA was prepared with a commercial kit (Amersham Pharmacia Biotech), based on the oligo-dT method, according to the manufacturer's instructions. The cDNA subtraction was performed with the PCR select cDNA subtraction kit (CLONTECH Laboratories, Inc.) according to the manufacturer's instructions (Diatchenko et al., 1996).
Protein studies
Preparation of cellular lysates, immunoprecipitation, and immunoblotting were performed as described previously (Fazioli et al., 1993). Immunofluorescence procedures were also as described previously (Tiainen et al., 1996b; Latella et al., 2001). Antibodies used were as follows: rabbit antiserum to cycE (Santa Cruz Biotechnology, Inc.), mAb clone G3245 to pRb (BD PharMingen; pRb in all figures), rabbit antiserum to pRb phosphorylated on serine 807/811 (Cell Signaling; ph-pRb in all figures), mAb against E2F-1 (a gift of K. Helin, European Institute of Oncology, Milan Italy), goat antiserum against lamin B (Santa Cruz Biotechnology, Inc.), rat Th-10a mAb to Np95 (Muto et al., 1995), mouse mAb to BrdU (Becton Dickinson), and rabbit antiserum to muscle-specific myosin heavy chain (a gift of G. Cossu, Stem Cell Research Institute, Rome, Italy). In immunofluorescence experiments, mAbs were detected either with donkey antimouse Cy3 (red) or donkey antimouse FITC (green) secondary antibodies. The Np95 mAb was detected with a goat antirat Cy3 (red). pAbs were detected with donkey antirabbit FITC (green). Pictures were acquired with a color-chilled camera (model 3CCD-C5810; Hamamatsu Corporation). Blots were digitalized with an AGFA scan system. All images were managed with Adobe Photoshop®.
| Footnotes |
|---|
| Acknowledgments |
|---|
We thank J. Nevins, G. Cossu, and K. Helin for reagents.
This work was supported by grants from Associazione Italiana Ricerca sul Cancro (AIRC), Telethon Italy (Grant D-90), Consiglio Nazionale delle Ricerche (target project Biotechnology) and European Community (V Framework) to P.P. Di Fiore, and from AIRC, Telethon Italy (Grant GP0293/01), and the Italian Ministry of Health to M. Crescenzi. R. Papait and A. Sacco were supported by fellowships from the Associazione per la Promozione della Ricerca Medico-BiologicaBrescia and AIRC, respectively.
Submitted: 4 January 2002
Revised: 24 April 2002
Accepted: 6 May 2002
| References |
|---|
|
|
|---|
Alevizopoulos, K., B. Catarin, J. Vlach, and B. Amati. 1998. A novel function of adenovirus E1A is required to overcome growth arrest by the CDK2 inhibitor p27(Kip1). EMBO J. 17:59875997.[CrossRef][Medline]
Alevizopoulos, K., B. Sanchez, and B. Amati. 2000. Conserved region 2 of adenovirus E1A has a function distinct from pRb binding required to prevent cell cycle arrest by p16INK4a or p27Kip1. Oncogene. 19:20672074.[CrossRef][Medline]
Arany, Z., W.R. Sellers, D.M. Livingston, and R. Eckner. 1994. E1A-associated p300 and CREB-associated CBP belong to a conserved family of coactivators. Cell. 77:799800.[CrossRef][Medline]
Arany, Z., D. Newsome, E. Oldread, D.M. Livingston, and R. Eckner. 1995. A family of transcriptional adaptor proteins targeted by the E1A oncoprotein. Nature. 374:8184.[CrossRef][Medline]
Crescenzi, M., S. Soddu, and F. Tatò. 1995. Mitotic cycle reactivation in terminally differentiated cells by adenovirus infection. J. Cell. Physiol. 162:2635.[CrossRef][Medline]
Dahiya, A., M.R. Gavin, R.X. Luo, and D.C. Dean. 2000. Role of the LXCXE binding site in Rb function. Mol. Cell. Biol. 20:67996805.
DeGregori, J., G. Leone, A. Miron, L. Jakoi, and J.R. Nevins. 1997. Distinct roles for E2F proteins in cell growth control and apoptosis. Proc. Natl. Acad. Sci. USA. 94:72457250.
Diatchenko L, Y.F. Lau, A.P. Campbell, A. Chenchik, F. Moqadam, B. Huang, S. Lukyanov, K. Lukyanov, N. Gurskaya, E.D. Sverdlov, and P.D. Siebert. 1996. Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc. Natl. Acad. Sci. USA. 93:60256030.
Eckner, R. 1996. p300 and CBP as transcriptional regulators and targets of oncogenic events. Biol. Chem. 377:685688.[Medline]
Fazioli, F., L. Minichiello, V. Matoska, P. Castagnino, T. Miki, W.T. Wong, and P.P. Di Fiore. 1993. Eps8, a substrate for the epidermal growth factor receptor kinase, enhances EGF-dependent mitogenic signals. EMBO J. 12:37993808.[Medline]
Fujimori, A., Y. Matsuda, Y. Takemoto, Y. Hashimoto, E. Kubo, R. Araki, R. Fukumura, K. Mita, K. Tatsumi, and M. Muto. 1998. Cloning and mapping of Np95 gene which encodes a novel nuclear protein associated with cell proliferation. Mamm. Genome. 9:10321035.[CrossRef][Medline]
Haley, K.P., J. Overhauser, L.E. Babiss, H.S. Ginsberg, and N.C. Jones. 1984. Transformation properties of type 5 adenovirus mutants that differentially express the E1A gene products. Proc. Natl. Acad. Sci. USA. 81:57345738.
Harrison, T., F.L. Graham, and J. Williams. 1977. Host-range mutant of adenovirus type 5 defective for growth in HeLa cells. Virology. 77:319329.[CrossRef][Medline]
He, T.C., S. Zhou, L.T. da Costa, J. Yu, K.W. Kinzler, and B. Vogelstein. 1998. A simplified system for generating recombinant adenoviruses. Proc. Natl. Acad. Sci. USA. 95:25092514.
Hopfner, R., M. Mousli, J.M. Jeltsch, A. Voulgaris, Y. Lutz, C. Marin, J.P. Bellocq, P. Oudet, and C. Bronner. 2000. ICBP90, a novel human CCAAT binding protein, involved in the regulation of topoisomerase IIalpha expression. Cancer Res. 60:121128.
Johnson, D.G., J.K. Schwartz, W.D. Cress, and J.R. Nevins. 1993. Expression of transcription factor E2F-1 induces quiescent cells to enter S phase. Nature. 365:349352.[CrossRef][Medline]
Jones, N., and T. Shenk. 1979. Isolation of adenovirus type 5 host range deletion mutants defective for transformation of rat embryo cells. Cell. 17:683689.[CrossRef][Medline]
Latella, L., A. Sacco, D. Pajalunga, M. Tiainen, D. Macera, M. D'Angelo, A. Felici, A. Sacchi, and M. Crescenzi. 2001. Reconstitution of cyclin D1-associated kinase activity drives terminally differentiated cells into the cell cycle. Mol. Cell. Biol. 16:56315643.
Lukas, J., B.O. Petersen, K. Holm, J. Bartek, and K. Helin. 1996. Deregulated expression of E2F family members induces S-phase entry and overcomes p16INK4A-mediated growth suppression. Mol. Cell. Biol. 16:10471057.
Mal, A., D. Chattopadhyay, M.K. Ghosh, R.Y. Poon, T. Hunter, and M.L. Harter. 2000. p21 and retinoblastoma protein control the absence of DNA replication in terminally differentiated muscle cells. J. Cell Biol. 149:281292.
Miura, M., H. Watanabe, T. Sasaki, K. Tatsumi, and M. Muto. 2001. Dynamic changes in subnuclear Np95 location during the cell cycle and its spatial relationship with DNA replication foci. Exp. Cell Res. 263:202208.[CrossRef][Medline]
Müller, H., and K. Helin. 2000. The E2F transcription factors: key regulators of cell proliferation. Biochim. Biophys. Acta. 1470:M1M12.[Medline]
Muto, M., M. Utsuyama, T. Horiguchi, E. Kubo, T. Sado, and K. Hirokawa. 1995. The characterization of the monoclonal antibody Th-10a, specific for a nuclear protein appearing in the S phase of the cell cycle in normal thymocytes and its unregulated expression in lymphoma cell lines. Cell Prolif. 12:645657.
Nevins, J.R. 1990. Adenovirus E1A-dependent trans-activation of transcription. Semin. Cancer Biol. 1:5968.[Medline]
Okazaki, K., and H. Holtzer. 1966. Myogenesis: fusion, myosin synthesis, and the mitotic cycle. Proc. Natl. Acad. Sci. USA. 56:14841490.
Pajalunga, D., D. Tognozzi, M. Tiainen, M. D'Angelo, F. Ferrantelli, K. Helin, A. Sacchi, and M. Crescenzi. 1999. E2F activates late-G1 events but cannot replace E1A in inducing S phase in terminally differentiated skeletal muscle cells. Oncogene. 18:50545062.[CrossRef][Medline]
Puri, P.L., V. Sartorelli, X.J. Yang, Y. Hamamori, V.V. Ogryzko, B.H. Howard, L. Kedes, J.Y. Wang, A. Graessmann, Y. Nakatani, and M. Levrero. 1997. Differential roles of p300 and PCAF acetyltransferases in muscle differentiation. Mol. Cell. 1:3545.[CrossRef][Medline]
Puri, P.L., L. Cimino, M. Fulco, C. Zimmerman, N.B. La Thangue, A. Giordano, A. Graessmann, and M. Levrero. 1998. Regulation of E2F4 mitogenic activity during terminal differentiation by its heterodimerization partners for nuclear translocation. Cancer Res. 58:13251331.
Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory. Cold Spring Harbor, NY.
Stein, R.W., M. Corrigan, P. Yaciuk, J. Whelan, and E. Moran. 1990. Analysis of E1A-mediated growth regulation functions: binding of the 300-kilodalton cellular product correlates with E1A enhancer repression function and DNA synthesis-inducing activity. J. Virol. 64:44214427.
Tiainen, M., D. Pajalunga, F. Ferrantelli, S. Soddu, G. Salvatori, A. Sacchi, and M. Crescenzi. 1996a. Terminally differentiated skeletal myotubes are not confined to G0 but can enter G1 upon growth factor stimulation. Cell Growth Differ. 7:10391050.[Abstract]
Tiainen, M., D. Spitkovsky, P. Jansen-Dürr, A. Sacchi, and M. Crescenzi. 1996b. Expression of E1A in terminally differentiated muscle cells reactivates the cell cycle and suppresses tissue-specific genes by separable mechanisms. Mol. Cell. Biol. 16:53025312.
Uemura, T., E. Kubo, Y. Kanari, T. Ikemura, K. Tatsumi, and M. Muto. 2000. Temporal and spatial localization of novel nuclear protein NP95 in mitotic and meiotic cells. Cell Struct. Funct. 25:149159.[CrossRef][Medline]
Wang, H.-G.H., Y. Rikitake, M.C. Carter, P. Yaciuk, S.E. Abraham, B. Zerler, and E. Moran. 1993. Identification of specific adenovirus E1A N-terminal residues critical to the binding of cellular proteins and to the control of cell growth. J. Virol. 67:476488.
Yaffe, D., and O. Saxel. 1977. Serial passaging and differentiation of myo-genic cells isolated from dystrophic mouse muscle. Nature. 270:725727.[CrossRef][Medline]
Zerler, B., R.J. Roberts, M.B. Mathews, and E. Moran. 1987. Different functional domains of the adenovirus E1A gene are involved in regulation of host cell cycle products. Mol. Cell. Biol. 7:821829.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|