|
||
© The Rockefeller University Press,
0021-9525/2002/10/255 $5.00
The Journal of Cell Biology, Volume 159, Number 2, 255-266
Article |
Assembly of centrosomal proteins and microtubule organization depends on PCM-1
Address correspondence to Andreas Merdes, Wellcome Trust Centre for Cell Biology, Institute of Cell and Molecular Biology, University of Edinburgh, King's Buildings, Mayfield Rd., Edinburgh EH9 3JR, UK. Tel.: 44-131-650-7075. Fax: 44-131-650-7360. E-mail: a.merdes{at}ed.ac.uk
| Abstract |
|---|
|
|
|---|
The protein PCM-1 localizes to cytoplasmic granules known as "centriolar satellites" that are partly enriched around the centrosome. We inhibited PCM-1 function using a variety of approaches: microinjection of antibodies into cultured cells, overexpression of a PCM-1 deletion mutant, and specific depletion of PCM-1 by siRNA. All approaches led to reduced targeting of centrin, pericentrin, and ninein to the centrosome. Similar effects were seen upon inhibition of dynactin by dynamitin, and after prolonged treatment of cells with the microtubule inhibitor nocodazole. Inhibition or depletion of PCM-1 function further disrupted the radial organization of microtubules without affecting microtubule nucleation. Loss of microtubule organization was also observed after centrin or ninein depletion. Our data suggest that PCM-1containing centriolar satellites are involved in the microtubule- and dynactin-dependent recruitment of proteins to the centrosome, of which centrin and ninein are required for interphase microtubule organization.
Key Words: centrosome; microtubules; pericentriolar material; RNAi; dynein
| Introduction |
|---|
|
|
|---|
0.2 µm and are each composed of nine triplets of short microtubules, arranged to form the wall of the cylinder. In addition to various tubulin isoforms (McKean et al., 2001), centrin, a member of a larger calcium-binding protein superfamily, has been found associated with the centrioles (Paoletti et al., 1996). However, 95% of centrin in human cells is not bound to the centrioles, but fractionates with the cytoplasm or with nuclei in biochemical experiments (Baron et al., 1994; Paoletti et al., 1996). A large variety of proteins is attached to the periphery of the centrioles as part of the pericentriolar material (Kalt and Schliwa, 1993). Some of the proteins in this matrix have been characterized in recent years (for review see Doxsey, 2001). The primary function of the pericentriolar material is to nucleate microtubules, which are radially arranged from the centrosomal surface or subsequently released and anchored in other places of the cell (Mogensen, 1999). The initial step of microtubule nucleation is dependent on the function of 25S ring complexes of the protein
-tubulin and associated proteins (Zheng et al., 1995). However, for stable anchoring of microtubules, another protein (ninein) is required (Bouckson-Castaing et al., 1996; Mogensen et al., 2000; Piel et al., 2000; Ou et al., 2002). Ninein is also found at noncentrosomal sites in specialized cell types such as polarized epithelial cells that undergo a change from a radial microtubule organization into an arrangement of fibers from the apical to the basal pole (Bacallao et al., 1989; Mogensen et al., 1989; Mogensen, 1999). To facilitate microtubule nucleation, it has been proposed that
-tubulin complexes are embedded in the pericentriolar material, in a lattice formed by pericentrin (Dictenberg et al., 1998). Pericentrin is a large protein of which two isoforms have been described: a 220-kD form (pericentrin A; Doxsey et al., 1994), as well as a newly identified 350-kD form (pericentrin B; Li et al., 2001). It is transported to the centrosome by the microtubule-dependent motor dynein, a process apparently mediated through direct binding of pericentrin to the dynein light intermediate chain (Purohit et al., 1999; Tynan et al., 2000). Pericentrin has recently been found to bind to PCM-1, a 228-kD protein that localizes to small 70100-nm granules in the cytoplasm of interphase cells (Balczon et al., 1994; Kubo et al., 1999; Li et al., 2001). These granules can move along microtubules in a dynein-dependent way and often concentrate near the microtubule organizing center (Balczon et al., 1999; Kubo et al., 1999). Detailed morphological analysis revealed that these PCM-1 containing granules are identical to structures previously described as "centriolar satellites" (Kubo et al., 1999). Although centriolar satellites have been extensively studied by electron microscopy (Rattner, 1992), their function is so far unknown. In this paper, we test the potential role of their component protein PCM-1 in centrosome assembly and the organization of microtubule networks. | Results |
|---|
|
|
|---|
-tubulin (Fig. 1, B and C). Although this is in agreement with data from Kubo et al. (1999), it contrasts with immunofluorescence data initially provided by Balczon et al. (1994), showing a concentrated staining of PCM-1 at the centrosome of CHO cells. Testing various cell lines, we found that the amount and localization of cytoplasmic granules varied between different cell types (unpublished data).
|
We used affinity-purified rabbit antibodies for microinjection into the cytoplasm of cultured Xenopus A6 cells. 2448 h after microinjection, we found that PCM-1 granules were no longer detectable in 89% of the cells (n = 88), using a mouse antibody against PCM-1 for immunofluorescence (Fig. 2 B). Instead, only a weak staining in the centrosomal area remained. This could mean that the PCM-1 epitopes were masked by the microinjected antibody, and therefore, no longer detectable by immunofluorescence, or that the PCM-1 granules were dispersed upon microinjection. No apparent morphological defect was seen in injected cells, but when examining the distribution of other proteins, we observed large cytoplasmic aggregates of the centrosomal protein centrin, in addition to centrosome staining, in 67% of the cells (n = 284; Fig. 2, DF). In 10% of the injected cells, these aggregates had acquired a filamentous or ribbonlike structure (Fig. 2, E and F). Further, there was a weak effect on pericentrin, with 17% of cells (n = 283) exhibiting small pericentriolar aggregates in addition to centrosome staining (Fig. 2 H). By contrast, the localization of
-tubulin was not significantly affected by microinjection of PCM-1 antibodies (Fig. 2 J). Microinjection of control antibodies had no significant effect on the localization of centrosomal proteins or PCM-1 (Fig. 2, A, C, G, and I).
|
|
-tubulin, on the other hand, was not significantly altered by mutant PCM-1 (Fig. 3, I and J). Next, we tested whether any of the protein aggregates induced by the PCM-1 deletion mutant 11468 represented newly replicated centrosomes. Therefore, we stained cells with an antibody against acetylated tubulin, a marker that labels stable microtubules, including those that form the 9 x 3 filaments of the centriolar cylinders. We found that cells expressing mutant PCM-1 stained for acetylated tubulin indistinguishably from controls; generally, acetylated tubulin was enriched at a double-dot representing one pair of centrioles, and at cytoplasmic fibers representing stable microtubules (Fig. 3, M and N). However, the large protein aggregates of mutant PCM-1 did not show any enriched staining of acetylated tubulin, indicating that no new centrioles, and therefore no additional centrosomes, had been formed in these cells. Overexpression of a control protein, ß-galactosidase, had no effect on PCM-1 or the centrosome (Fig. 3, A and B).
RNA silencing of PCM-1 leads to reduced assembly of centrin, pericentrin, and ninein at the centrosome
Because antibody microinjections and overexpression of PCM-1 mutants could have dominant secondary effects on other proteins in the cell by steric hindrance or by segregation of interacting components, we tested the role of PCM-1 in an approach based on depletion rather than inhibition of this protein. A recently published technique using transfection of double-stranded RNA oligomers of 21 base pairs has demonstrated that depletion of specific mRNAs is possible (Elbashir et al., 2001). Using oligomer pairs from two different regions of human PCM-1, as well as control oligomers (see Materials and methods), we reached transfection levels of 95% (n = 522; as judged using labeled control oligomers) and were able to remove 34% (siRNA PCM-1.1) or 82% (siRNA PCM-1.2) of the original amounts of PCM-1 in cultures of HeLa cells, U-2 OS human osteosarcoma cells, and C2C4 mouse myoblasts.
We proceeded with the RNA oligomer pair PCM-1.2 that had the strongest effect on PCM-1 depletion, corresponding to nucleotides 14641484 in human PCM-1 cDNA. Efficient depletion of PCM-1 was observed at time points longer than 90 h (Fig. 4 K), which required prolonged culturing and retransfection with siRNA at 48 h. This may reflect a slow turnover rate of PCM-1 in the cells. When analyzing individual cells, we found that PCM-1 depletion removed centriolar satellite staining almost completely, with a few PCM-1 granules occasionally remaining near the centrosome or in the cytoplasm (Fig. 4, B, D, F, H, and J). Photometric analysis of PCM-1 fluorescence revealed that the depletion levels in individual cells ranged from 69 to 99%, with an average depletion of 89% of PCM-1 protein. As a consequence of PCM-1 depletion, we again saw an effect on the assembly of centrin, pericentrin, and ninein, but no significant effect on
-tubulin (Fig. 4, AH). In all cell types examined, we found that the amounts of centrin, pericentrin, and ninein at the centrosome were significantly reduced after PCM-1 depletion. We quantified the fluorescence intensity of these proteins in the centrosomal region of U-2 OS cells (see Materials and methods), and determined that only 39% of centrin, 36% of pericentrin, and 38% of ninein remained localized at the centrosome as compared with control cells. In contrast, the levels of
-tubulin remained largely constant (99%). Because previous work has indicated an interaction between PCM-1 and dynactin (Balczon et al., 1999), we also measured the centrosomal levels of the dynactin component p150/glued, which remained largely unaffected after PCM-1 depletion (82%; Fig. 4, I and J). Culturing of cells in the presence of PCM-1 siRNA for periods longer than 120 h led to extensive cell death.
|
79% of cytoplasmic granules of centrin-3 colocalized with PCM-1 (n = 518). We noticed that in specialized cell types, such as mouse myoblasts, the centrosomal proteins ninein and pericentrin could also be seen in small satellites surrounding the centrosome. As with centrin, these also partly colocalized with PCM-1 (Fig. 5 B).
|
-tubulin (Fig. 6, G and H). Interestingly, a fraction of dynein also colocalized with PCM-1 granules in untreated cells (Fig. 6, K and L, arrows). We then addressed the question whether assembly of these centrosomal proteins could be directly inhibited by destabilizing the dynein activating complex of dynactin. For this purpose, we microinjected CHO cells with purified p50/dynamitin, a dynactin subunit that sequesters other dynactin components and leads to dynactin disassembly when added in excess (Echeverri et al., 1996; Quintyne et al., 1999). We noticed that dynamitin led to the dispersion of most PCM-1 in injected cells (Fig. 6, M and N), and caused similar defects in centrosomal protein assembly as observed with PCM-1 inhibition or depletion; centrin, pericentrin, and ninein were dispersed or formed small cytoplasmic aggregates, whereas
-tubulin localization was unaffected (Fig. 6, OX).
|
|
|
| Discussion |
|---|
|
|
|---|
To understand the role of PCM-1, it is important to note that the distribution of centrin, pericentrin and PCM-1 is very dynamic (Baron et al., 1994; Kubo et al., 1999; Young et al., 2000) and dependent on the action of dyneindynactin motor complexes (Balczon et al., 1999; Kubo et al., 1999; Purohit et al., 1999). Intriguingly, small granules of GFP-tagged PCM-1 have been directly followed by video microscopy, shuttling along microtubules between the cytoplasm and the centrosome (Kubo et al., 1999). Therefore, a possible function of PCM-1 could be to mediate the transport of centrosome components from the cytoplasm to the centrosome, along microtubules. PCM-1 may serve as a carrier that associates with centrin, pericentrin, or ninein, and docks onto dyneindynactin. Consistent with this idea is our observation that depolymerization of microtubules, as well as dynactin inhibition, led to dispersion of centrosomal proteins and cytoplasmic protein aggregates that contain centrin, pericentrin and ninein, as well as dynein and PCM-1. Transport complexes would contain only a small proportion of cellular centrin, pericentrin, or ninein, explaining why most cell types do not show significant centriolar satellite staining of these proteins. Specific cell types such as PtK2 or mouse myoblasts do exhibit recognizable cytoplasmic granules of these proteins, and we show that they colocalize with PCM-1. Centrin granules are very dynamic structures that can rapidly fuse with the pericentriolar material (Baron et al., 1994), consistent with our transport model. A role of PCM-1 in facilitating transport of centrosomal proteins could be important for the duplication of centrosomes during the cell cycle, when new pericentriolar material is recruited to the centrosomal surface, and to increase the potential of centrosomes to organize microtubules into mitotic spindles. This would explain why PCM-1 staining before mitosis is particularly concentrated at the centrosomes, with fewer cytoplasmic granules visible than in interphase, and why the signal becomes again more dispersed in metaphase, after spindle poles have fully formed.
Another explanation of our data could be that PCM-1 granules in the cytoplasm represent sites at which centrosomal proteins associate temporarily to undergo proper folding, or to assemble into complexes with other proteins. The two interpretations on PCM-1 function are not mutually exclusive. Several centrosomal proteins are not simply confined to the centrosome, but are also present in a large cytoplasmic pool (Moudjou et al., 1996; Paoletti et al., 1996). Cytoplasmic factors that support folding and assembly as well as factors that aid transport would contribute to a dynamic equilibrium between centrosome-bound and free protein (Baron et al., 1994).
As shown in this paper, not all centrosomal proteins follow a PCM-1dependent assembly pathway. In particular, we show that recruitment of
-tubulin to the centrosome is independent of PCM-1, and apparently of dyneindynactin-dependent transport. Our data are further consistent with previous reports by Khodjakov and Rieder (1999), Hannak et al. (2001), as well as earlier biochemical studies by Klotz et al. (1990), Felix et al. (1994), Moritz et al. (1995), and Schnackenberg et al. (1998), that centrosomal targeting of
-tubulin and other potential microtubule nucleation factors is independent of microtubules. In contrast, work by Quintyne et al. (1999) and Young et al. (2000) clearly demonstrates a requirement for dynactin in
-tubulin assembly. These seemingly contradictory findings may be reconciled by the existence of different pools of
-tubulin at the centrosome with different rates of exchange with the cytoplasm, as shown by Khodjakov and Rieder (1999). If only the slowly exchanging pool of
-tubulin required dynactin function, for example, as a microtubule anchor rather than as a transporter, then effects on
-tubulin localization would only be observed after prolonged treatment of cells with dynactin inhibitors, as in the experiments of Quintyne et al. (1999) and Young et al. (2000), and not over the shorter time frame of a few hours in our experiments. There may also be differences in the dynamics of centrosomal components between different cell types and cell cycle stages, and these may explain the observation of dynactin-independent pericentrin assembly by Quintyne et al. (1999), in contrast to data from this study and Young et al. (2000).
Consistent with our finding of
-tubulin assembly independent of PCM-1, microtubule nucleation at the centrosome is not affected when PCM-1 is inhibited. Our data highlight the notion that microtubule nucleation and the organization of the microtubule network are distinct events. Earlier studies by Keating et al. (1997) provided direct evidence for microtubule release from the centrosome. In addition, Mogensen et al. (2000) have shown that in polarized cell types, microtubules can be transferred after nucleation from the centrosome to apical regions of the cell. It has been suggested that a protein involved in microtubule anchorage at these sites is ninein, previously identified as a component of the pericentriolar material (Bouckson-Castaing et al., 1996). It has further been shown in a paper by Piel et al. (2000) that immature daughter centrioles, lacking ninein localization, are able to nucleate microtubules, but fail to anchor them. Here, we provide direct evidence for a role of ninein in microtubule anchorage to the centrosome by demonstrating that depletion of ninein causes loss of centrosomal microtubule organization. Our data further suggest that the effects of PCM-1 or centrin depletion on the microtubule network organization are mediated through ninein, because ninein levels at the centrosome decrease when PCM-1 or centrin are depleted.
Therefore, the potential of the centrosome to anchor microtubules may depend on the correct assembly of a subset of proteins; PCM-1 may be involved in targeting centrin to the centrosome, where it would be necessary for the assembly of ninein, and thereby regulate microtubule anchorage. As discussed above, this targeting of microtubule-anchoring factors appears to be mediated by dyneindynactin-dependent transport, consistent with observations by Quintyne et al. (1999) and Clark and Meyer (1999), who showed that dynactin inhibition interferes with microtubule organization at the centrosome. Pericentrin was also found to assemble at the centrosome in a PCM-1dependent manner, but in contrast to ninein or centrin, its absence did not interfere with radial microtubule organization. Instead, the density of microtubules in the cell decreased after pericentrin depletion, indicating that pericentrin either stabilizes microtubules or aids microtubule nucleation, as suggested by Dictenberg et al. (1998), due to its close association with
-tubulin. Additional factors may be involved in the regulation of microtubule anchorage, such as the microtubule-severing protein katanin (Hartman et al., 1998), the dynactin component p150/glued (Quintyne et al., 1999), or Cep 135 and MIR1, two recently identified novel centrosomal proteins (Ohta et al., 2002; Stein et al., 2002). Further studies of microtubule-anchoring proteins should provide valuable insights in the remodeling of the cytoskeleton during cell differentiation and morphogenesis.
| Materials and methods |
|---|
|
|
|---|
Cloning of chicken PCM-1 cDNA and construction of expression vectors
An EST clone containing the middle 3.5-kb fragment of the chicken homologue of PCM-1 was obtained from a Bursal EST collection then managed by Dr. Jean-Marie Buerstedde (University of Hamburg, Hamburg Germany; clone 4d19r1, GenBank/EMBL/DDBJ accession no. AJ398048 [now obtainable through RZPD]). Clones containing the 5' and 3' ends of PCM-1 were obtained by screening a DU249
ZAP cDNA library (provided by S. Kandels-Lewis, University of Edinburgh, Edinburgh UK) with hybridization probes derived from this EST, and the full-length cDNA (GenBank/EMBL/DDBJ accession no. AJ508717) assembled in the cloning vector pBluescript® in a series of cloning steps.
A full-length PCM-1GFP expression construct was then generated by modifying the cDNA insert at its 3' end by PCR to remove the stop codon, and cloning it in frame into the multiple cloning site of pEGFP-N (CLONTECH Laboratories, Inc.). The deletion construct 11468, containing nucleotides 14423 after the start codon, was generated by PCR, and the GFP tag removed by cutting the vector with SmaI and NotI, blunting, and religating. A control vector for the expression of ß-galactosidase was obtained from Dr. Adrian Bird (University of Edinburgh, Edinburgh UK).
Antibodies, immunofluorescence, and immunoblotting
The COOH terminus of human PCM-1 comprising nucleotides 49936095 after the start codon was amplified by PCR from a HeLa cDNA library (provided by S. Kandels-Lewis, University of Edinburgh, UK) using primers CTGAAAGACTGTGGAGAAGATC and GATGTCTTCAGAGGCTCATC, and cloned into the vector pGEM-T (Promega). The insert was then excised using PstI and NcoI and cloned into the bacterial expression vector pRSET-C (Invitrogen). Bacterial fusion protein was isolated using 8 M urea and purified over Nickel Sepharose (Amersham Biosciences) and hydroxyapatite (Bio-Rad Laboratories) columns, concentrated, and dialyzed against PBS before injection into two rabbits.
Affinity-purified antibody was obtained by passing serum over a column of the same antigen coupled to a CNBr-activated Sepharose column (Amersham Biosciences). The same antigen was also used to raise pAbs in mice. Chicken-specific pAbs were further generated in mice against the amino terminus of the chicken PCM-1 protein. For this, nucleotides 1342 after the start codon were amplified by PCR from the chicken cDNA using primers AAGGATCCATGGCAACAGGAGGCG and AGAATTCACTGATCCAGATCACTGAAGTT, and cloned directly into the bacterial expression vector pRSET-A. Bacterial fusion protein was then purified as described above and injected into mice.
Mouse antibodies were raised against nucleotides 40026263 after the start codon of human pericentrin-B, a region common to both pericentrin-A and -B. This fragment was obtained by excision with BglII and NcoI from a partial cDNA clone provided by Dr. Harish Joshi (Emory University, Atlanta, GA), cloned into pRSET-C (Invitrogen), and expressed as above. All pAbs were used at a dilution of 1:100. Affinity-purified PCM-1 antibody was used at a concentration of 1 µg/ml for both immunofluorescence and immunoblotting. mAbs against dynein intermediate chain, NuMA, and ß-galactosidase were obtained from CHEMICON International, Calbiochem, and Promega, respectively. mAbs against
-tubulin and acetylated tubulin were from Sigma-Aldrich. Other antibodies were used as described previously; pAbs against
-tubulin were a gift from Dr. Rebecca Heald (University of California, Berkeley, CA; Heald et al., 1997).
mAb 20H5 against centrin (Sanders and Salisbury, 1994) was a gift from Dr. Jeffrey Salisbury (Mayo Clinic, Rochester, MN). Rabbit pAbs against centrin-3 (anti-HsCen3p; Laoukili et al., 2000) and against ninein (Mogensen et al., 2000) were gifts from Dr. Michel Bornens (Institut Curie, Paris, France). Rabbit antibody against pericentrin-B (Li et al., 2001) was a gift from Dr. Harish Joshi (Emory University, Atlanta, GA), mouse antibody against human ninein (Ou et al., 2002) was a gift from Dr. Gordon Chan (Alberta Cancer Board, Canada), and mAb against ß-tubulin was a gift from Dr. Don Cleveland (Ludwig Institute for Cancer Research, San Diego, CA). For immunofluorescence, cells were fixed for 10 min in methanol at -20°C, and processed and imaged using conventional fluorescence microscopy as described previously (Merdes et al., 2000). Cos-7 and PtK2 cells were fixed with 3.7% formaldehyde in 100 mM NaCl, 300 mM sucrose, 3 mM MgCl2, 10 mM Pipes, pH 6.8, to preserve microtubule integrity. Gel electrophoresis and immunoblotting were performed according to standard protocols.
siRNA experiments
RNA oligomers containing 21 nucleotides were synthesized in sense and antisense directions corresponding to human PCM-1 (Balczon et al., 1994) at nucleotides 21902208 (GGGCUCUAAACGUGCCUCC; PCM-1.1) and 14651483 (UCAGCUUCGUGAUUCUCAG; PCM-1.2) with dTdT overhangs at each 3' terminus, deprotected, and desalted (Xeragon). Oligomers against centrin-3 (UGAAGUUGUGACAGACUGG), pericentrin (recognizing both pericentrin-A and -B; GCAGCUGAGCUGAAGGAGA), and ninein (UAUGAGCAUUGAGGCAGAG) were prepared accordingly. All oligomers were identical to both human and mouse sequences, except for PCM-1.1, which was human-specific. For annealing of siRNAs, 20-µM single strands were incubated in annealing buffer (100 mM potassium acetate, 2 mM magnesium acetate, 30 mM Hepes-KOH, pH 7.4) for 1 min at 90°C, followed by 1 h at 37°C (Elbashir et al., 2001).
Transfections were performed using OligofectamineTM (Invitrogen) with 3 µg siRNA on HeLa, U-2 OS, or C2C4 cells grown overnight on 6-well dishes at 3 x 104 cells/well. For time points beyond 60 h, cells were split 48 h after the first transfection and then immediately subjected to a second treatment with siRNA. 3' Rhodamine-labeled and unlabeled control oligonucleotides (CGUACGCGGAAUACUUCGA plus 3' dTdT overhangs; control) were used to optimize transfection efficiency and to control for nonspecific effects due to the presence of siRNAs in cells, respectively. The level of protein depletion due to RNA silencing was determined by quantitative immunoblotting of cell extracts using 125I-labeled secondary antibody (Amersham Biosciences). Equal amounts of protein extracts were separated by SDS-PAGE, and quantification was performed on immunoblots using a PhosphorImager. Photometric quantification of immunofluorescence signals was performed from digital image files taken with a 40x/0.75-NA lens that allowed a large depth of focus. Mean pixel values of 12-µm2 areas were calculated using Adobe Photoshop®. Control cells stained with nonimmune serum and cells treated with control RNA, stained with the respective centrosomal antibodies, were used to calculate background levels and average control protein levels.
Microinjection experiments
Affinity-purified PCM-1 antibody was injected into Xenopus A6 cells cultured on glass coverslips at 2 mg/ml in injection buffer (100 mM KCl, 10 mM potassium phosphate, pH 7.4). At 24 or 48 h after injection, coverslips were fixed with methanol at -20°C and processed for immunofluorescence as above. Control injections were performed using rabbit IgG (Sigma-Aldrich) at the same concentration in injection buffer. Purified dynamitin (Wittmann and Hyman, 1999) at a concentration of 9 mg/ml was injected into CHO cells. After 24 h of incubation, cells were fixed and processed for immunofluorescence. Control cells were injected with fluorescently labeled secondary antibody.
Centrin copurification experiments
Human centrin-3 was obtained by PCR from a HeLa cDNA library (provided by S. Kandels-Lewis, University of Edinburgh, UK) using primers ATGGATCCATGAGTTTAGCTCTGAGAAGTGAGC and TAGAATTCTTAAATGTCACCAGTCATAATAGCA and cloned into the bacterial expression vector pGEX4T2 (Amersham Biosciences) using BamH1 and EcoR1. Sequencing confirmed it to be identical to the previously published human centrin-3 sequence (Middendorp et al., 1997). Bacterial fusion protein in PBS was loaded on a glutathione Sepharose 4B column and purified using reduced glutathione according to the manufacturer's instructions (Amersham Biosciences), and dialyzed against PBS.
HeLa cell extracts were prepared by resuspending cell pellets from 6 near-confluent 10-cm plates (
6 x 107 cells) in 1 ml PBS using a Dounce homogenizer. Xenopus egg extracts were prepared as described by Murray (1991). Protein concentrations of the extracts prepared varied between 25 mg/ml for HeLa cell extracts and 40100 mg/ml for Xenopus egg extracts. In each copurification experiment, 200 µg GST-centrin-3 or GST alone was added to 1 mg HeLa extract or 10 mg Xenopus egg extract, diluted to 1 ml total volume in PBS, and incubated for 1 h at 4°C. GST fusion protein and associated interactors were then recovered by incubating the mixture with 100 µl glutathione Sepharose beads for 30 min at 4°C. After extensive washes with PBS, bound protein was eluted with 10 mM reduced glutathione, pH 8.0, followed by TCA precipitation and boiling for 5 min in gel loading buffer containing SDS and mercaptoethanol. Recovery of the GST fusion protein was confirmed by SDS-PAGE and Coomassie staining, and the copurification of PCM-1 tested by immunoblotting.
| Acknowledgments |
|---|
We thank our colleagues F. Gardiner, L. Haren, and X. Fant (University of Edinburgh) for technical help and for critically reading this manuscript. We thank Drs. C. Rabouille, K. Sawin, W.C. Earnshaw, M. Heck, and members of their groups (University of Edinburgh) for their help throughout this work, and Drs. M. Bornens, J. Salisbury, H. Joshi, G. Chan, R. Heald, D. Cleveland, and A. Bird for the gift of antibodies and plasmids.
This work was supported by a Wellcome 4-year studentship to A. Dammermann, and a Wellcome senior research fellowship to A. Merdes.
Submitted: 4 April 2002
Revised: 12 September 2002
Accepted: 18 September 2002
| References |
|---|
|
|
|---|
Bacallao, R., C. Antony, C. Dotti, E. Karsenti, E.H.K. Stelzer, and K. Simons. 1989. The subcellular organization of Madin-Darby canine kidney cells during the formation of a polarized epithelium. J. Cell Biol. 109:28172832.
Balczon, R., L. Bao, and W.E. Zimmer. 1994. PCM-1, a 228-kD centrosome autoantigen with a distinct cell cycle distribution. J. Cell Biol. 124:783793.
Balczon, R., C.E. Varden, and T.A. Schroer. 1999. Role for microtubules in centrosome doubling in chinese hamster ovary cells. Cell Motil. Cytoskeleton. 42:6072.[CrossRef][Medline]
Balczon, R., C. Simerly, D. Takahashi, and G. Schatten. 2002. Arrest of cell cycle progression during first interphase in murine zygotes microinjected with anti-PCM-1 antibodies. Cell Motil. Cytoskeleton. 52:183192.[CrossRef][Medline]
Baron, A.T., V.J. Suman, E. Nemeth, and J.L. Salisbury. 1994. The pericentriolar lattice of PtK2 cells exhibits temperature and calcium-modulated behavior. J. Cell Sci. 107:29933003.[Abstract]
Bouckson-Castaing, V., M. Moudjou, D.J. Ferguson, S. Mucklow, Y. Belkaid, G. Milon, and P.R. Crocker. 1996. Molecular characterization of ninein, a new coiled-coil protein of the centrosome. J. Cell Sci. 109:179190.[Abstract]
Clark, I.B., and D.I. Meyer. 1999. Overexpression of normal and mutant Arp1
(centractin) differentially affects microtubule organization during mitosis and interphase. J. Cell Sci. 112:35073518.[Abstract]
Dictenberg, J.B., W. Zimmerman, C.A. Sparks, A. Young, C. Vidair, Y. Zheng, W. Carrington, F.S. Fay, and S.J. Doxsey. 1998. Pericentrin and
-tubulin form a protein complex and are organized into a novel lattice at the centrosome. J. Cell Biol. 141:163174.
Doxsey, S. 2001. Re-evaluating centrosome function. Nat. Rev. Mol. Cell Biol. 2:688698.[CrossRef][Medline]
Doxsey, S.J., P. Stein, L. Evans, P.D. Calarco, and M. Kirschner. 1994. Pericentrin, a highly conserved centrosome protein involved in microtubule organization. Cell. 76:639650.[CrossRef][Medline]
Echeverri, C.J., B.M. Paschal, K.T. Vaughan, and R.B. Vallee. 1996. Molecular characterization of the 50-kD subunit of dynactin reveals function for the complex in chromosome alignment and spindle organization during mitosis. J. Cell Biol. 132:617633.
Elbashir, S.M., J. Harborth, W. Lendeckel, A. Yalcin, K. Weber, and T. Tuschl. 2001. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature. 411:494498.[CrossRef][Medline]
Felix, M.A., C. Antony, M. Wright, and B. Maro. 1994. Centrosome assembly in vitro: role of
-tubulin recruitment in Xenopus sperm aster formation. J. Cell Biol. 124:1931.
Hannak, E., M. Kirkham, A.A. Hyman, and K. Oegema. 2001. Aurora-A kinase is required for centrosome maturation in Caenorhabditis elegans. J. Cell Biol. 155:11091116.
Hartman, J.J., J. Mahr, K. McNally, K. Okawa, A. Iwamatsu, S. Thomas, S. Cheesman, J. Heuser, R.D. Vale, and F.J. McNally. 1998. Katanin, a microtubule-severing protein, is a novel AAA ATPase that targets to the centrosome using a WD40-containing subunit. Cell. 93:277287.[CrossRef][Medline]
Heald, R., R. Tournebize, A. Habermann, E. Karsenti, and A. Hyman. 1997. Spindle assembly in Xenopus egg extracts: respective roles of centrosomes and microtubule self-organization. J. Cell Biol. 138:615628.
Kalt, A., and M. Schliwa. 1993. Molecular components of the centrosome. Trends Cell Biol. 3:118128.[CrossRef][Medline]
Keating, T.J., J.G. Peloquin, V.I. Rodionov, D. Momcilovic, and G.G. Borisy. 1997. Microtubule release from the centrosome. Proc. Natl. Acad. Sci. USA. 94:50785083.
Khodjakov, A., and C.L. Rieder. 1999. The sudden recruitment of
-tubulin to the centrosome at the onset of mitosis and its dynamic exchange throughout the cell cycle, do not require microtubules. J. Cell Biol. 146:585596.
Klotz, C., M.C. Dabauvalle, M. Paintrand, T. Weber, M. Bornens, and E. Karsenti. 1990. Parthenogenesis in Xenopus eggs requires centrosomal integrity. J. Cell Biol. 110:405415.
Kubo, A., H. Sasaki, A. Yuba-Kubo, S. Tsukita, and N. Shiina. 1999. Centriolar satellites: molecular characterization, ATP-dependent movement toward centrioles and possible involvement in ciliogenesis. J. Cell Biol. 147:969979.
Laoukili, J., E. Perret, S. Middendorp, O. Houcine, C. Guennou, F. Marano, M. Bornens, and F. Tournier. 2000. Differential expression and cellular distribution of centrin isoforms during human ciliated cell differentiation in vitro. J. Cell Sci. 113:13551364.[Abstract]
Li, Q., D. Hansen, A. Killilea, H.C. Joshi, R.E. Palazzo, and R. Balczon. 2001. Kendrin/pericentrin-B, a centrosome protein with homology to pericentrin that complexes with PCM-1. J. Cell Sci. 114:797809.[Abstract]
McKean, P.G., S. Vaughan, and K. Gull. 2001. The extended tubulin superfamily. J. Cell Sci. 114:27232733.
Merdes, A., R. Heald, K. Samejima, W.C. Earnshaw, and D.W. Cleveland. 2000. Formation of spindle poles by dynein/dynactin-dependent transport of NuMA. J. Cell Biol. 149:851862.
Middendorp, S., A. Paoletti, E. Schiebel, and M. Bornens. 1997. Identification of a new mammalian centrin gene, more closely related to Saccharomyces cerevisiae CDC31 gene. Proc. Natl. Acad. Sci. USA. 94:91419146.
Mogensen, M.M. 1999. Microtubule release and capture in epithelial cells. Biol. Cell. 91:331341.[CrossRef][Medline]
Mogensen, M.M., J.B. Tucker, and H. Stebbings. 1989. Microtubule polarities indicate that nucleation and capture of microtubules occurs at cell surfaces in Drosophila. J. Cell Biol. 108:14451452.
Mogensen, M.M., A. Malik, M. Piel, V. Bouckson-Castaing, and M. Bornens. 2000. Microtubule minus-end anchorage at centrosomal and non-centrosomal sites: the role of ninein. J. Cell Sci. 113:30133023.[Abstract]
Moritz, M., M.B. Braunfeld, J.C. Fung, J.W. Sedat, B.M. Alberts, and D. Agard. 1995. Three-dimensional structural characterization of centrosomes from early Drosophila embryos. J. Cell Biol. 130:11491159.
Moudjou, M., N. Bordes, M. Paintrand, and M. Bornens. 1996.
-Tubulin in mammalian cells: the centrosomal and the cytosolic forms. J. Cell Sci. 109:875887.[Abstract]
Murray, A.W. 1991. Cell cycle extracts. In Methods in Cell Biology, vol. 36. B.K. Kay and H.B. Peng, editors. Academic Press, Inc., San Diego, CA. 581605.
Ohta, T., R. Essner, J.H. Ryu, R.E. Palazzo, Y. Uetake, and R. Kuriyama. 2002. Characterization of Cep135, a novel coiled-coil centrosomal protein involved in microtubule organization in mammalian cells. J. Cell Biol. 156:8799.
Ou, Y.Y., G.J. Mack, M. Zhang, and J.B. Rattner. 2002. CEP110 and ninein are located in a specific domain of the centrosome associated with centrosome maturation. J. Cell Sci. 115:18251835.
Paoletti, A., M. Moudjou, M. Paintrand, J.L. Salisbury, and M. Bornens. 1996. Most of centrin in animal cells is not centrosome-associated and centrosomal centrin is confined to the distal lumen of centrioles. J. Cell Sci. 109:30893102.[Abstract]
Piel, M., P. Meyer, A. Khodjakov, C.L. Rieder, and M. Bornens. 2000. The respective contributions of the mother and daughter centrioles to centrosome activity and behavior in vertebrate cells. J. Cell Biol. 149:317330.
Purohit, A., S.H. Tynan, R. Vallee, and S.J. Doxsey. 1999. Direct interaction of pericentrin with cytoplasmic dynein light intermediate chain contributes to mitotic spindle organization. J. Cell Biol. 147:481492.
Quintyne, N.J., S.R. Gill, D.M. Eckley, C.L. Crego, D.A. Compton, and T.A. Schroer. 1999. Dynactin is required for microtubule anchoring at centrosomes. J. Cell Biol. 147:321334.
Rattner, J.B. 1992. Ultrastructure of centrosome domains and identification of their protein components. In The Centrosome. V.I. Kalnins, editor. Academic Press, Inc., San Diego, CA. 4569.
Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular Cloning. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
Sanders, M.A., and J.L. Salisbury. 1994. Centrin plays an essential role in microtubule severing during flagellar excision in Chlamydomonas reinhardtii. J. Cell Biol. 124:795805.
Schnackenberg, B.J., A. Khodjakov, C.L. Rieder, and R.E. Palazzo. 1998. The disassembly and reassembly of functional centrosomes in vitro. Proc. Natl. Acad. Sci. USA. 95:92959300.
Stein, P.A., C.P. Toret, A.N. Salic, M.M. Rolls, and T. Rapoport. 2002. A novel centrosome-associated protein with affinity for microtubules. J. Cell Sci. 115:33893402.
Tynan, S.H., A. Purohit, S.J. Doxsey, and R.B. Vallee. 2000. Light intermediate chain 1 defines a functional subfraction of cytoplasmic dynein which binds to pericentrin. J. Biol. Chem. 275:3276332768.
Wittmann, T., and T. Hyman. 1999. Recombinant p50/dynamitin as a tool to examine the role of dynactin in intracellular processes. Methods Cell Biol. 61:137143.[Medline]
Young, A., J.B. Dictenberg, A. Purohit, R. Tuft, and S.J. Doxsey. 2000. Cytoplasmic dynein-mediated assembly of pericentrin and
tubulin onto centrosomes. Mol. Biol. Cell. 11:20472056.
Zheng, Y., M.L. Wong, B. Alberts, and T. Mitchison. 1995. Nucleation of microtubule assembly by a
-tubulin-containing ring complex. Nature. 378:578583.[CrossRef][Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|