JCB logo
Quantitative Colocalization Analysis Software
  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

Published online 21 October 2002. doi:10.1083/jcb.200206096
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 300K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JCB
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Arredondo, J.
Right arrow Articles by Grando, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Arredondo, J.
Right arrow Articles by Grando, S. A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CALCIUM COMPOUNDS
*CALCIUM, ELEMENTAL
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

© The Rockefeller University Press, 0021-9525/2002/10/325 $5.00
The Journal of Cell Biology, Volume 159, Number 2, 325-336


Article

Central role of {alpha}7 nicotinic receptor in differentiation of the stratified squamous epithelium



Juan Arredondo1, Vu Thuong Nguyen1, Alexander I. Chernyavsky1, Dani Bercovich2,3, Avi Orr-Urtreger4, Wolfgang Kummer5, Katrin Lips5, Douglas E. Vetter6 and Sergei A. Grando1

1 Department of Dermatology, University of California, Davis, Sacramento, CA 95817
2 Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030
3 Department of Molecular Genetics, Migal-Galilee Technology Center
4 Genetic Institute, Tel Aviv Sourasky Medical Center, and Tel Aviv University, 64239 Tel Aviv, Israel
5 Institut für Anatomie und Zellbiologie, Justus-Liebig-Universität Giessen, Giessen D-35385, Germany
6 Neuroscience Department, Tufts University, School of Medicine, Boston, MA 02111

Address correspondence to Sergei A. Grando, Dept. of Dermatology, University of California, Davis, UC Davis Medical Center, 4860 Y Street, #3400, Sacramento, CA 95817. Tel.: (916) 734-6057. Fax: (916) 734-6793. E-mail: sagrando{at}ucdavis.edu


   Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 

Several ganglionic nicotinic acetylcholine receptor (nAChR) types are abundantly expressed in nonneuronal locations, but their functions remain unknown. We found that keratinocyte {alpha}7 nAChR controls homeostasis and terminal differentiation of epidermal keratinocytes required for formation of the skin barrier. The effects of functional inactivation of {alpha}7 nAChR on keratinocyte cell cycle progression, differentiation, and apoptosis were studied in cell monolayers treated with {alpha}-bungarotoxin or antisense oligonucleotides and in the skin of Acra7 homozygous mice lacking {alpha}7 nAChR channels. Elimination of the {alpha}7 signaling pathway blocked nicotine-induced influx of 45Ca2+ and also inhibited terminal differentiation of these cells at the transcriptional and/or translational level. On the other hand, inhibition of the {alpha}7 nAChR pathway favored cell cycle progression. In the epidermis of {alpha}7-/- mice, the abnormalities in keratinocyte gene expression were associated with phenotypic changes characteristic of delayed epidermal turnover. The lack of {alpha}7 was associated with up-regulated expression of the {alpha}3 containing nAChR channels that lack {alpha}5 subunit, and both homomeric {alpha}9- and heteromeric {alpha}9{alpha}10-made nAChRs. Thus, this study demonstrates that ACh signaling through {alpha}7 nAChR channels controls late stages of keratinocyte development in the epidermis by regulating expression of the cell cycle progression, apoptosis, and terminal differentiation genes and that these effects are mediated, at least in part, by alterations in transmembrane Ca2+ influx.

Key Words: cell cycle; differentiation; {alpha}7 acetylcholine receptor; epidermis; knockout mouse


   Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Recent progress in the identification of genes encoding new members of the neuronal nicotinic acetylcholine receptor (nAChR)* subunit gene superfamily and developing in vivo models for specific subunit gene deletions has revealed that the expression of the acetylcholine (ACh)-gated ion channels is not limited to neurons (Grando, 1997; Lindstrom, 1997). On the other hand, recent results with receptor subunit knockout (KO) mice indicated that certain ganglionic nAChR subtypes are not essential for normal neurological function (Orr-Urtreger et al., 1997; Paylor et al., 1998). These unexpected findings suggested that one of the major biological functions of neuronal-type nAChRs is to subserve trophic, hormone-like effects of ACh in both neuronal and nonneuronal locations. Elucidation of the nonneuronal function of nAChRs, therefore, may lead to better understanding of a complex signaling mechanism mediating interactions of the peripheral nervous system with the surrounding tissues, wherein different cell types use ACh as a common messenger, or a pacemaker.

ACh is a ubiquitous chemical in life that, although is best known for its role in neurotransmission, is produced by practically all types of live cells and is remarkably abundant in the epidermis and other types of the surface epithelium (Grando et al., 1993b; Wessler et al., 1999). It has become evident that ACh can regulate tissue homeostasis in an autocrine and paracrine fashions by exhibiting a plethora of biological effects on different cell types (Wessler et al., 1998). The level of free tissue ACh is controlled by the cholinergic enzymes choline acetyltransferase and acetylcholinesterase that are present in nonneuronal cells lining the cutaneous, respiratory and alimentary tracts, and blood vessels. In these nonneuronal locations, ACh signaling can be mediated by muscarinic and nicotinic receptors. Binding of ACh to the cell membrane receptors elicits several diverse and simultaneous biochemical events, the "biological sum" of which, together with cumulative effects of other hormonal and environmental stimuli, determines a distinct change in the cell cycle.

The nAChRs are classic representatives of the Cys loop superfamily of ligand-gated ion channel proteins or ionotropic receptors, mediating the influx of Na+ and Ca2+ and efflux of K+ (Steinbach, 1990). The differences in subunit composition of nAChRs determine the functional and pharmacological characteristics of the ion channels formed. 12 nAChR subunit genes encoding a pentameric protein have been identified and designated {alpha}2–{alpha}10 and three ß2–ß4, and each subunit has four putative transmembrane-spanning domains (M1–M4) and a similar topological structure. Each of {alpha}7, {alpha}8, and {alpha}9 subunits is capable of forming functional homomeric nAChR channels, which are {alpha}-bungarotoxin ({alpha}-BTX) sensitive. RT-PCR has amplified {alpha}3, {alpha}5, {alpha}7, {alpha}9, {alpha}10, ß2, and ß4 subunits from human keratinocytes (Grando et al., 1995, 1996; Nguyen et al., 2000a, 2001; Sgard et al., 2002), indicating that keratinocytes express both heteromeric and homomeric nAChR channels on their cell membrane. The differences in subunit composition of nAChRs determine the functional and pharmacological characteristics of the ion channels formed.

Current research results indicate that biological effects of ACh in the skin are finely tuned to regulation of each phase of the cell cycle via the intracellular signaling pathways coupled by each particular type of nAChRs (Grando, 1997, 2001). In keratinocytes, nAChRs control cell viability, proliferation, differentiation, adhesion, and motility, and constant stimulation of keratinocyte nAChRs with endogenously secreted ACh produced by these cells is essential for cell survival. We have demonstrated recently that programmed cell death of keratinocytes culminates in apoptotic secretion of a humectant upon secretagogue action of ACh and that activation of ACh signaling through the {alpha}7 nAChR, which is predominantly expressed by mature keratinocytes, is essential for a sustained turnover of the epidermis in humans (Nguyen et al., 2001).

This study was designed to ultimately determine the role for {alpha}7 nAChR in mediating physiologic control of keratinocyte differentiation by endogenous ACh. Alterations in the nicotinergic regulation of keratinocyte cycle progression, differentiation, and apoptosis were investigated in three independent models of functionally inactivated {alpha}7 nAChR: in cultured human keratinocytes treated with {alpha}-BTX or antisense oligonucleotides (AsOs) and epidermal keratinocytes grown from and residing in the skin of KO mice with homozygous-null mutation of the gene-encoding {alpha}7 nAChR subunit. We found that pharmacological blockage of {alpha}7 nAChR with {alpha}-BTX inhibits nicotine (Nic)-induced influx of 45Ca2+ in human keratinocytes, which is associated with an inhibition of Nic-induced terminal differentiation of these cells. Functional inactivation of {alpha}7 nAChRs in cultured human keratinocytes with AsOs abolished high extracellular Ca2+-induced up-regulated synthesis of the terminal differentiation proteins. Terminal differentiation gene expression was found to be down-regulated in the epidermis of {alpha}7 KO mice whose keratinocytes demonstrated profound alterations in the normal cell cycle progression and apoptosis when grown in culture. The {alpha}7-/- keratinocytes also demonstrated changes in the gene expression of {alpha}3, {alpha}5, {alpha}9, and {alpha}10 nAChR subunits, suggesting that ACh signaling in these cells is rerouted to alternative nicotinergic pathways.


   Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
The {alpha}-BTX–sensitive component of nicotinergic control of keratinocyte differentiation
Nicotinergic agents have been demonstrated to affect the rate of keratinocyte differentiation. It has been shown that Nic accelerates the rate of keratinocyte differentiation which can be abolished by mecamylamine (Grando et al., 1996), an antagonist of the "neuronal" types of the nAChRs expressed in epidermal keratinocytes (Grando et al., 1995). Since keratinocytes express both the heteromeric nAChRs containing {alpha}3 subunit, which are not sensitive to {alpha}-BTX, and the homomeric {alpha}7 nAChR, which is highly sensitive to {alpha}-BTX (Levandoski et al., 1999), we investigated effects of {alpha}-BTX on the Nic-induced keratinocyte differentiation in confluent monolayers of the second passage human foreskin keratinocytes incubated in the medium containing 0.09 mM Ca2+, in which both test drugs were dissolved. As seen in Fig. 1, after 14 d of exposure to both Nic (10 µM) and {alpha}-BTX (1 µM) the number of keratinocytes that stained for the differentiation markers cytokeratin 10, transglutaminase, involucrin, or filaggrin, or spontaneously formed cornified envelopes was significantly (P < 0.01) diminished compared with that found in the positive control cultures exposed to 10 µM Nic alone and did not significantly differ from the control values (P > 0.05). After shorter incubation periods, i.e., 4, 8, or 10 d, the changes were less pronounced (unpublished data). The cellular staining patterns produced by antibodies to the differentiation markers were similar in experimental and control cultures. Thus, the ability of {alpha}-BTX to abolish Nic-induced differentiation of keratinocytes indicated that the differentiation-inducing effect of Nic is predominantly mediated by activation of {alpha}7 nAChR.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 1. {alpha}-BTX blocks Nic-induced differentiation of human keratinocytes. The number of differentiation marker-positive keratinocytes (percentage of total cells) after incubation with 10 µM Nic alone (black bar), 10 µM Nic plus 1 µM {alpha}BTX (hatched bar), or without any additions (white bar) (control). The cells were either fixed and stained for the differentiation markers cytokeratin 10 (CK 10), human keratinocyte transglutaminase type I (Trgl), involucrin (Invn), or filaggrin (Flgrn) or used in the assay of cornified envelopes (CE). Data are means ± SD of two independent experiments. In each immunocytochemical experiment, the numbers of cells stained for a differentiation-associated protein using avidin–biotin complex/alkaline phosphatase technique (as described in Material and methods) were counted in at least three different microscopic fields.

 
The {alpha}-BTX–sensitive component of the nicotinergic control of transmembrane 45Ca2+ influx in keratinocytes
Previously, we have shown that Nic increases 45Ca2+ influx into keratinocytes freshly dissociated from human epidermis, which could be abolished by mecamylamine (Grando et al., 1996). Using the same cell preparation, we tested the effects of {alpha}-BTX on 45Ca2+ influx. The presence of {alpha}-BTX in the solution diminished both basal (Fig. 2 A) and Nic (10 µM)-elicited (Fig. 2 B) 45Ca2+ influx. However, these effects did not reach significant levels at either of three (0.1, 1.0, and 10 µM) {alpha}-BTX concentrations tested (P > 0.05). Since incubation of keratinocytes in the presence of high extracellular Ca2+ up-regulates expression of the gene coding for {alpha}7 subunit (Zia et al., 2000), we hypothesized that preincubation of keratinocytes at high (1.2 mM) Ca2+ before the 45Ca2+ influx assay might increase the sensitivity of Nic-elicited 45Ca2+ influx to a blockage with {alpha}-BTX. As expected, in pretreated cells {alpha}-BTX inhibited 45Ca2+ influx in a dose-dependent manner (Fig. 2). To directly address the role of {alpha}7-made nAChR channels in mediating these {alpha}-BTX effects, we measured effects of short (15 min) and long (60 min) term preincubations at 1.2 mM Ca2+ on the relative amount of {alpha}-BTX binding to the cell membrane of keratinocytes and total amount of the {alpha}7 protein present in these cells, using ELISA with FITC-labeled {alpha}-BTX and Western blot with rabbit anti-{alpha}7 antibody, respectively. We found that a short term preincubation moderately and a long term preincubation significantly (P < 0.05) increased both cell surface expression of {alpha}7 nAChR and total amount of the receptor protein in the cells (Fig. 2, C and D). Together, these results indicated that {alpha}7-made nicotinic channels may be a major contributor to transmembrane influx of 45Ca2+ in epidermal keratinocytes at increased extracellular Ca2+ levels.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 2. Role of {alpha}7 nAChRs in mediating spontaneous and Nic-induced 45Ca2+ influx into human keratinocytes. (A and B) Effects of {alpha}-BTX on transmembrane 45Ca2+ influx. {alpha}-BTX decreased in a dose-dependent manner both spontaneous (A) and Nic-induced (B) influx of 45Ca2+ into keratinocytes freshly isolated from human neonatal foreskins. The effects of test concentrations of {alpha}-BTX on baseline 45Ca2+ influx were measured in cell aliquots suspended in KGM without Nic. The inhibitory effects of {alpha}-BTX on Nic-induced 45Ca2+ influx into keratinocytes were measured in aliquots of keratinocyte suspensions in KGM containing 10 µM Nic. Cell aliquots were resuspended in serum-free keratinocyte medium (KGM) containing either 0.09 (black bar) or 1.2 (white bar) mM Ca2+, incubated for 15 min in a humid 5% CO2 incubator, washed, and used in the 45Ca2+ influx assay as described in Materials and methods. Data are means ± SD of representative experiments in which triplicate samples were measured. The concentrations of {alpha}-BTX are shown at the bottom of each graph. Asterisks indicate that the experimental data significantly (P < 0.05) differ from controls. (C and D) Effects of extracellular Ca2+ on expression of {alpha}7 nAChR in human keratinocytes. The level of {alpha}7 expression on the cell membrane was measured using the FITC-labeled {alpha}-BTX binding assay detailed in Materials and methods, and the total amount of cellular {alpha}7 protein was measured by Western blotting using rabbit anti-{alpha}7 antibody characterized in the past (Zia et al., 2000). Both 15- and 60-min preincubations increased cell surface binding of {alpha}-BTX (C). An increase of fluorescence intensity ratio (FIR) became statistically significant after 60 min of incubation (P < 0.05; denoted with an asterisk). By this point in time, the total amount of {alpha}7 protein increased by 32% (D). The {alpha}7 band appeared at the expected mol wt of 60 kD.

 
{alpha}7 AsOs alters terminal differentiation of cultured keratinocytes
Having found that pharmacological inactivation of {alpha}7 nAChR with {alpha}-BTX abolishes Nic-induced differentiation, we asked if elimination of {alpha}7-coupled pathway can block terminal differentiation of keratinocytes. To inhibit {alpha}7 expression, we used phosphorothioated AsOs targeted to mRNA for the {alpha}7 nAChR subunit (Table I). In keratinocytes lacking {alpha}7 nAChR, terminal differentiation can be induced via a Nic-independent pathway mediated by other types of Ca2+-permeable ion channels due to increased concentration of extracellular Ca2+. Nuclear AsOs uptake of the FITC-tagged AsOs by keratinocytes was monitored using a fluorescence microscope (Fig. 3 A). Treatment protocol was optimized to allow maximal inhibition, i.e., >80%, as judged from the results of quantitative receptor protein analysis by Western blotting (Fig. 3 B). The specificity of antibody binding to the immunoblotting membranes was confirmed by (a) appearance of {alpha}7 protein band at the expected mol wt (Nguyen et al., 2000a) and (b) absence of this band in negative control experiments omitting primary antibody or replacing it with an irrelevant and species- and isotype-matching antibody (unpublished data).


View this table:
[in this window]
[in a new window]
 
Table I. Oligodeoxynucleotides (ODNs) used in this study

 


View larger version (36K):
[in this window]
[in a new window]
 
Figure 3. Anti-{alpha}7 AsOs prevents high extracellular Ca2+-induced terminal differentiation of human keratinocytes. (A) Intracellular accumulation of FITC-labeled {alpha}7 AsOs. FITC-labeled AsOs (Table I), 20 nM, was added to the second passage human keratinocytes. Localized FITC-labeled AsOs was viewed live via phase–contrast fluorescence microscopy after a 24-h incubation (x400). Note that anti-{alpha}7 AsOs is distributed into the nucleus and the cytoplasm. Control oligonucleotide was similarly distributed (unpublished data). (B) Effect of anti-{alpha}7 AsOs on the {alpha}7 nAChR subunit protein in human keratinocytes. The cells were seeded in 24-well plates at a density of 5 x 104/well and incubated in a 5% CO2 incubator for 72 h in KGM in the presence of Lipofectamine PlusTM alone (control), 20 nM of sense oligonucleotide, or 20 nM of each of five phosphorothioated AsOs (Table I). The anti-{alpha}7 AsOs dramatically reduced the intensity of the 60-kD receptor band in the immunoblot. Control (i.e., sense) oligonucleotide did not alter the total amount of {alpha}7 protein. (C) Alterations in the expression of differentiation markers in keratinocytes treated with anti-{alpha}7 AsOs. Relative amounts of filaggrin, loricrin, and cytokeratins (CK) 1 and 10 were analyzed by Western blotting of the total protein isolated from human keratinocytes transfected with anti-{alpha}7 AsOs or the control oligonucleotide described above, or intact keratinocytes after 96 h incubation of these cells in KGM containing 1.2 mM Ca2+, to induce terminal differentiation.

 
To determine the effect of inhibited {alpha}7 nAChR expression on the unfolding of the keratinocyte differentiation program, preconfluent monolayers of human keratinocytes were fed with serum-free keratinocyte growth medium (KGM) containing a differentiation-inducing concentration of Ca2+, 1.2 mM, and incubated in a humid 5% CO2 incubator at 37°C for 96 h in the presence (experiment) or absence (baseline) of a mixture of five phosphorothioated anti-{alpha}7 AsOs or the same concentration of sense oligonucleotide used as a negative control for AsOs (Table I). After incubation, relative amounts of differentiation marker proteins were measured in experimental and control cells and compared. As seen in Fig. 3 C, functional deletion of {alpha}7 nAChR resulted in characteristic changes in the differentiation gene expression. We found an ~50% decrease of the levels of filaggrin, loricrin, and cytokeratins 1 and 10, compared with the levels found in control, nonexposed cells. This effect of anti-{alpha}7 AsOs markedly differed from that of the control (sense) oligonucleotide, which produced only minor fluctuations of the protein levels of the differentiation markers under consideration (Fig. 3 C). Thus, {alpha}7 AsOs-treated keratinocytes showed resistance to Ca2+-induced cornification. These results indicated that inactivation of the {alpha}7 nAChR-coupled pathway of ACh signaling interferes with terminal differentiation of human keratinocytes.

Abnormal keratinocyte differentiation in the skin of {alpha}7 KO mice
To correlate changes in the cell cycle and differentiation gene expression resulting from inactivation of {alpha}7 nAChR-coupled signaling pathways in vitro with the in vivo phenotype caused by the absence {alpha}7 nAChR channels in the epidermis, we studied pups delivered by {alpha}7+/- mice, followed by genotyping (Fig. 4 A). Compared with wild-type {alpha}7+/+ mice aged from 1 to 3 wk, whose epidermis usually consists of one to two rows of live nucleated keratinocytes and a compact horny layer comprised of dead corneocytes (Fig. 4 B), {alpha}7-/- mice featured thickened, multilayered epidermis (Fig. 4 C). In addition to the lowermost basal layer, the epidermis in {alpha}7-/- mice contained an additional two to three suprabasilar rows of pale and enlarged keratinocytes and from one to three rows of granular keratinocytes located just below widened and loose horny layer. Thus, the phenotypic abnormalities in the epidermis of {alpha}7 KO mice were consistent with retention hyperkeratosis, which is a morphologic manifestation of delayed epidermal turnover.



View larger version (48K):
[in this window]
[in a new window]
 
Figure 4. Reduced rate of keratinocyte cornification in the epidermis of {alpha}7 KO mice. (A) Representative PCR profiles of the homozygous and heterozygous mice from a progeny of a heterozygous {alpha}7+/- mouse. Genomic DNA was extracted by a standard digestion method (Orr-Urtreger et al., 1997). The PCR primers were generated for intronic regions flanking exon 8 and 10 and used in experiments at the following concentrations: P1 (wild-type forward), CCTGGTCCTGCTGTGTTAAACTGCTTC (20 pmol); P2 (wild-type reverse), CTGCTGGGAAATCCTAGGCACACTTGAG (10 pmol); and P3 (KO), GACAAGACCGGCTTCCATCCGAGTAC (25 pmol). DMSO (1:20) was included in PCR reactions, and the annealing temperature was 56°C. The size of the gene product amplified from a wild-type mouse was 440 bp and that from {alpha}7-/- mouse was 750 bp. The PCR analysis identifies the {alpha}7 homozygous-null (-/-) and wild-type (+/+) animals and the heterozygous (+/-) mouse. (B and C) Comparative histology of the skin of {alpha}7+/+ (B) and {alpha}7-/- (C) mice. The epidermis of wild-type mouse is comprised of basal keratinocytes attached to the epidermal basal membrane and a single suprabasal cell layer. In marked contrast, the epidermis of {alpha}7-/- mouse, in addition to the basal layer, consists of several rows of suprabasal keratinocytes, including a superficially located layer of granular keratinocytes, and the uppermost stratum corneum, which is unusually loose and thick. Light microscopy of the hematoxylin and eosin stained 6-µm-thick cryostat sections of skin obtained from heads of 3-d-old {alpha}7+/+ and {alpha}7-/- mice. Magnification, x200. Bar, 25 µm. (D) Analysis of the expression of keratinocyte differentiation proteins cytokeratin (CK) 1, CK 10, and filaggrin by RT-PCR. The mRNA levels of the keratinocyte differentiation markers were determined using specific PCR primers (Table II) and cDNA template from the skin of neonatal {alpha}7 KO and wild-type mice as described in Materials and methods. Amplification yielded PCR products of the expected sizes: 534 bp for filaggrin, 461 bp for CK 1, and 364 bp for CK 10. Amplification of the GAPDH gene product (354 bp) was used to normalize the cDNA content in each sample and as a positive control for RT-PCR effectiveness. (E) Analysis of the expression of keratinocyte differentiation proteins CK 1 and 10 and filaggrin by Western blotting. These markers of terminal differentiation were visualized at the expected mol wt (shown in kD on the left side of the gels) in the 15% SDS-PAGE–resolved proteins, 10 µg per lane, extracted from the skin of {alpha}7 KO and wild-type mice using specific antibodies, and all appropriate negative controls. (F) Semiquantitative IF analysis of relative amounts of differentiation markers in the epidermis of {alpha}7 KO and wild-type neonatal mice. The cryostat sections of the skin from killed mice were stained with antibodies specific for the keratohyalin granule proteins filaggrin (Flgrn), and loricrin (Lrcn), and the CK proteins 1 and 6 (Table III), and the relative amounts of these keratinocyte proteins in the epidermis of {alpha}7+/+ (black bar) and {alpha}7-/- (white bar) mice were determined using computer-assisted analyses of the specific IF tissue staining as detailed in the Materials and methods section. The assay revealed that although the expression of filaggrin, loricrin, and CK 1 was significantly decreased, that of CK 6 was significantly increased in {alpha}7-/- compared with {alpha}7+/+ mice (P < 0.05).

 

View this table:
[in this window]
[in a new window]
 
Table II. Murine genes studied by RT-PCR

 

View this table:
[in this window]
[in a new window]
 
Table III. The primary antibodies used in IF assays

 
To relate changes in the skin development of {alpha}7 KO mice to {alpha}7 nAChR-mediated control of keratinocyte cell cycle and differentiation, we performed quantitative analysis of mRNA and protein levels of the genes encoding keratinocyte differentiation markers in {alpha}7 KO compared with wild-type {alpha}7+/+ mice. Gene-specific primers for murine filaggrin and cytokeratins 1 and 10 (Table II) amplified products of the expected sizes (Fig. 4 D). The Acra7 homozygous mutant mice showed decreased mRNA levels of all three terminal differentiation markers, ranging from 36 to 54%. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene amplification remained constant in each experiment (Fig. 4 D).

Findings of down-regulated expression of terminal differentiation genes in keratinocytes residing in the epidermis of {alpha}7-/- mice were corroborated by results of the Western blot assay (Fig. 4 E). The {alpha}7 deletion was associated with the decrease of the filaggrin and cytokeratin 1 and 10 proteins.

To ultimately determine changes in the differentiation proteins in epidermis of {alpha}7 KO mice, we measured the relative intensities of specific staining of keratinocytes produced by antibodies against the keratohyaline proteins filaggrin and loricrin and the intermediate filament proteins cytokeratin 1 and 6, using semiquantitative immunofluorescence (IF) assay. We found that in the epidermis of {alpha}7-/- mice, the abundance of terminally differentiated keratinocytes expressing filaggrin, loricrin, and cytokeratin 1 was significantly (P < 0.05) less than that in the epidermis of {alpha}7+/+ mice (Fig. 4 F). In marked contrast, the intensity of epidermal staining for cytokeratin 6, a marker of rapidly proliferating, immature keratinocytes (Foley et al., 1998; Gibbs et al., 2000), was significantly increased (P < 0.05), which is consistent with the appearance of the prolonged epidermal turnover phenotype in {alpha}7-/- mice.

Abnormalities in cell cycle regulation of {alpha}7 KO keratinocytes
When cell cycle and apoptosis gene expression in {alpha}7-/- keratinocytes was analyzed by RT-PCR, we found that Ki-67, cyclin D1, and PCNA were increased by 52, 77, and 52%, respectively, compared with {alpha}7+/+ cells (Fig. 5 A). The mRNA level of p53 also increased by 54%. By immunoblotting, we found that the relative amount of Ki-67, cyclin D1, PCNA, and p53 were increased in {alpha}7-/- keratinocytes (Fig. 5 B). On the other hand, the mRNA and protein levels of caspase-3 decreased 24 and 57%, respectively, whereas those of Bcl-2 both increased (Fig. 5).



View larger version (33K):
[in this window]
[in a new window]
 
Figure 5. Alterations in the cell cycle and apoptosis gene expression in {alpha}7 KO keratinocytes. (A) Analysis of the expression of keratinocyte cell cycle and apoptosis regulatory genes by RT-PCR. Total RNA was isolated from the second passage, ~75% confluent monolayers of neonatal {alpha}7 homozygous-null (-/-) and wild-type (+/+) keratinocytes and used in the RT-PCR assays described in Materials and methods. Gene-specific RT-PCR primers were designed to amplify the murine cell cycle regulation genes coding for p53, Ki-67, cyclin D1, and PCNA, antiapoptotic Bcl-2, and the cell apoptosis marker gene caspase 3 (Table II). Each primer set yielded PCR product of expected size: 499 bp for Ki-67, 482 bp for cyclin D1, 307 bp for PCNA, 389 bp for p53, 376 bp for Bcl-2, and 494 bp for caspase 3. (B) Analysis of the expression of keratinocyte cell cycle and apoptosis regulatory genes by Western blotting. Total protein was isolated from the same cells as in A and used in the Western blotting assay described in Materials and methods. The mol wt of each protein is shown in kD to the right of the gels. Each protein band was visualized at the expected mol wt. Changes in the gene expression of each of the cell cycle and apoptosis markers detectable by Western blots were consistent with those determined by RT-PCR. (C) Semiquantitative IF analysis of relative amounts of keratinocyte cell cycle and apoptosis markers in the epidermis of {alpha}7 KO and wild-type neonatal mice. The cryostat sections of skin from killed mice were stained with antibodies specific for the cell cycle progression regulators Ki-67, PCNA, cyclin D1 (CyD1), and p53, and the marker of cell apoptosis caspase 3 (Cs3) (Table III), and the relative amounts of these keratinocyte proteins in the epidermis of {alpha}7+/+ (black bar) and {alpha}7-/- (white bar) mice were computed based on the relative intensity of specific IF staining as detailed in Materials and methods.

 
The results of the semiquantitative IF assay confirmed the above findings (Fig. 5 C). As expected from the results of RT-PCR and immunoblotting assays, we found significant (P < 0.05) increases of the relative amounts of keratinocyte Ki-67, PCNA, cyclin D1, and p53 and a decrease of caspase 3 in keratinocytes residing in the epidermis of {alpha}7 KO mice compared with the epidermis of wild-type mice. These results suggested that in the absence of {alpha}7 nAChR, the nicotinergic pathway of autocrine and paracrine control of keratinocyte growth and differentiation is predominantly mediated by other type(s) of ACh-gated ion channels that are coupled to maintenance of the immature cell phenotype.

Altered expressions of nicotinic receptor subunits in {alpha}7 KO keratinocytes
To test a hypothesis that mutational deletion of Acra7 in keratinocytes evokes changes in the relative amounts of different nAChR channels, we investigated expression of the genes coding for {alpha}3, {alpha}5, {alpha}9, and {alpha}10 subunits in {alpha}7-/- versus {alpha}7+/+ keratinocytes. By RT-PCR, we found that the expression of the gene coding for {alpha}3 in {alpha}7-/- keratinocytes was up-regulated by 56%, whereas that of {alpha}5 was apparently unchanged (Fig. 6 A). Results of the Western blotting assay showed an 86% increase of the relative amount of {alpha}3 protein in {alpha}7-/- keratinocytes (Fig. 6 B). The protein level of {alpha}5 was found to be unchanged. These results indicated that although the total number of {alpha}3 containing nAChR increases in the epidermis of {alpha}7 KO mice, the proportion of the {alpha}3 nAChRs containing {alpha}5 subunit is actually less then in wild-type mice. The relative amounts of both mRNA and proteins of {alpha}9 and {alpha}10 subunits were elevated in {alpha}7-/- keratinocytes (Fig. 6). However, an increase of the protein level of {alpha}9 by 63% exceeded that of {alpha}10 subunit, indicating that both the heteromeric {alpha}9{alpha}10 and the homomeric {alpha}9-made ACh-gated ion channels were up-regulated in {alpha}7-/- keratinocytes.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 6. Alterations in the {alpha}3, {alpha}5, {alpha}9, and {alpha}10 nAChR subunit gene expression in {alpha}7 KO keratinocytes. (A) The levels of {alpha}3, {alpha}5, {alpha}9, and {alpha}10 nAChR subunit gene transcription in {alpha}7-/- keratinocytes. The detection of the nAChR subunit transcripts by RT-PCR was performed using gene specific primers for the murine {alpha}3, {alpha}5, {alpha}9, and {alpha}10 nAChR subunits (Table II) and cDNA from the second passage, ~75% confluent monolayers of neonatal {alpha}7 homozygous null (-/-) and wild-type (+/+) mice as template. Each pair of primers yielded a PCR product of the expected size: 485 bp for {alpha}3, 480 bp for {alpha}5, 458 bp for {alpha}9, and 463 bp for {alpha}10. (B) The levels of {alpha}3, {alpha}5, {alpha}9, and {alpha}10 nAChR subunit gene translation in {alpha}7-/- keratinocytes. The nAChR subunit proteins were visualized by Western blots of total proteins extracted from the same cells as in A. Results of a representative experiment showing protein bands recognized by rabbit polyclonal antibodies specific for {alpha}3, {alpha}5, {alpha}9, or {alpha}10 (Table III) resolved on 15% SDS-PAGE and immunoblotted as described in Materials and methods. The apparent mol wt of each receptor protein is shown in kD at the right side of the gel.

 

   Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
This study provides several lines of evidence that the {alpha}7 nAChR-mediated signaling is critical for normal epidermal differentiation. We used three independent approaches to inhibit this nicotinergic pathway of ACh signaling in keratinocytes and consistently identified reciprocal changes in the expression of the cell cycle progression and differentiation regulators. The keratinocytes treated with {alpha}-BTX or a mixture of phosphorothioated AsOs targeted to mRNA for the {alpha}7 nAChR subunit, and the Acra7 homozygous mice lacking {alpha}7 nAChR channels, all demonstrated considerable down-regulation of terminal differentiation gene expression at the transcriptional and/or translational levels. On the other hand, inhibition of the {alpha}7 nAChR pathway favored expression of the cell cycle progression regulators stimulating cell growth and decreased expression of the proapoptotic caspase 3. The {alpha}7 nAChR-related changes in the cell cycle and differentiation caused a transient delay in skin development observed in {alpha}7 KO mice during the first 3 wk of their lives. These alterations in the genetically determined unfolding of the keratinocyte differentiation program in {alpha}7 KO mice and phenotypic abnormalities consistent with delayed epidermal turnover were associated with changes in the repertoire of keratinocyte nAChR subtypes, suggesting that the nicotinergic pathways dominating in the {alpha}7-/- keratinocytes are coupled to maintenance of the immature cell phenotype.

Findings of the new and important biological function of "neuronal" {alpha}7 nAChR in a nonneuronal location such as the physiologic control of homeostasis and terminal differentiation of the stratified squamous epithelium was anticipated based on the following reasons. First, despite multiple morphological, biochemical, and electrophysiological studies, the functions of neuronal {alpha}-BTX binding sites in the mammalian brain remain largely unknown. Furthermore, a mutation deleting the last three exons of the gene for the {alpha}7 nAChR subunit that completely eliminates its potential for participation in an ion channel does not alter normal general appearance, growth, survival, gait, anatomy, and baseline behavioral responses (Orr-Urtreger et al., 1997; Paylor et al., 1998). Thus, although the Acra7 homozygous mutant mice demonstrated that the {alpha}7 subunit is not essential for normal development or for apparently normal neurological function, they proved to have phenotypic abnormalities in the epidermis, thus providing a valuable tool for defining the functional role of the keratinocyte {alpha}7 nAChR channel in the epidermis.

Second, in addition to modulation of neurotransmitter release the {alpha}7 nAChR has been implicated in regulating neuronal growth and differentiation via a large variety of genomic and nongenomic effects, including the promotion of neuronal proliferation (Quik et al., 1994; Plummer et al., 2000), neuroprotection (Gueorguiev et al., 2000; Li et al., 2000; Garrido et al., 2001), and induction of apoptosis (Renshaw et al., 1993; Hory-Lee and Frank, 1995; Berger et al., 1998). Neuronal {alpha}7 nAChR acts through different intracellular transduction pathways to protect or kill cells (Li et al., 1999). It has been proposed that {alpha}7 nAChR helps regulate neuronal development by modulating intracellular Ca2+ levels and thus affecting neuronal differentiation and synaptogenesis (Broide and Leslie, 1999). The genomic effects downstream of {alpha}7 nAChR are represented by activation of tyrosine hydroxylase and dopamine ß-hydroxylase gene expression in PC12 cells (Gueorguiev et al., 2000), whereas the nongenomic pathways involve regulation of protein phosphorylation (Schuller et al., 2000; Kihara et al., 2001).

Third, the {alpha}7 subunit is abundantly expressed in the epithelial cells lining skin, oral mucosa, esophagus, trachea, and bronchi, in which nicotinergic stimulation alters cellular metabolism of Ca2+ (Grando et al., 1996; Zia et al., 1997; Nguyen et al., 2000a), endothelial cells (Wang et al., 2001), and in cells surrounding large airways and blood vessels, alveolar type II cells, free alveolar macrophages, and pulmonary neuroendocrine cells (Sekhon et al., 1999). In the mammalian fetal lung, {alpha}7 nAChR may regulate neuropeptide release, collagen expression, and ultimately lung development (Sekhon et al., 1999). The expression of {alpha}7 nAChR channels on the cell membrane of nonneuronal cells is modulated by exposure to Nic (Zia et al., 1997; Arredondo et al., 2001), which may provide a mechanism for Nic-induced changes in gene expression (Arredondo et al., 2001; Zhang et al., 2001a, b), proliferation (Waggoner and Wang, 1994; Stone et al., 2001), apoptosis (LeSage et al., 1999; Heeschen et al., 2001), secretion (LeSage et al., 1999), and tumor growth (Heeschen et al., 2001) in nonneuronal locations.

The contribution of different nAChR subunits to formation of ACh-gated nicotinic ion channels in the plasma membrane of keratinocytes changes with keratinocyte maturation (Zia et al., 2000). Antibody mapping studies in human epidermis have shown that the bulk of {alpha}7 immunoreactivity is localized to the cell membranes of mature keratinocytes comprising the granular layer (Nguyen et al., 2001). In keratinocyte cultures, the abundant expression of {alpha}7 was observed on the cell membrane of mature cells, which required preincubation of cultures in KGM containing a differentiation-inducing concentration of Ca2+ or Nic (Zia et al., 2000). In contrast, the {alpha}3-containing nAChRs are present at the earliest stages of keratinocyte development (Nguyen et al., 2000a; Zia et al., 2000). Extracellular Ca2+ has been shown to regulate responses of both {alpha}3- and {alpha}7-containing nAChRs on chick ciliary ganglion neurons (Liu and Berg, 1999). Although both {alpha}3 and {alpha}7 subunits can contribute to the nAChRs that are permeable to Ca2+, the ACh-gated ion channels composed of the {alpha}7 subunits have the greatest Ca2+ permeability (Seguela et al., 1993). The results of this study demonstrated that the need to preincubate keratinocytes at differentiation-inducing concentrations of extracellular Ca2+ in order to increase the sensitivity of their response to Nic to a blockage with {alpha}-BTX in the 45Ca2+ influx assay is explained by up-regulated expression of {alpha}7 nAChRs.

Results of this study demonstrate that ACh signaling through {alpha}7 nAChR channels controls the maturation and the cornification stages of keratinocyte development in the epidermis. Downstream signaling from {alpha}7 nAChR regulates expression of cell cycle progression, apoptosis, and terminal differentiation regulators at the transcriptional and/or translational levels. These effects may be mediated, at least in part, by changes in Ca2+ metabolism. A "gain of function" mutation of the ACh-gated ion channels comprised by {alpha}7 subunits demonstrated that neurons expressing only mutant nAChRs are susceptible to abnormal apoptosis and degeneration, possibly due to increased Ca2+ influx (Treinin and Chalfie, 1995; Orr-Urtreger et al., 2000; Broide et al., 2001). We found that neither {alpha}-BTX could completely block Nic-induced differential of keratinocytes nor anti-{alpha}7 AsOs could completely abolish the process of cornification elicited by increasing the concentration of extracellular Ca2+ in KGM. Instead of using Nic to induce keratinocytes differentiation as in experiments with {alpha}-BTX, the differentiation of anti-{alpha}7 AsOs-treated keratinocytes was induced through alternative pathway(s) sensitive to high extracellular Ca2+, since in these cells the {alpha}7 nAChR pathway was inactivated due to treatment with anti-{alpha}7 AsOs. These findings suggest that the {alpha}7 nAChR-mediated pathway works together with other cholinergic and noncholinergic signaling pathways to sustain a constant advancement of a keratinocyte through its differentiation stages toward its programmed death. In acute experiments, such as treatment of cells with {alpha}-BTX or anti-{alpha}7 AsOs, the alternative pathway apparently could not get engaged fast enough to compensate for the missing function, which is illustrated by an approximately fivefold drop in the number of cells capable of spontaneous cornified envelope formation (Fig. 1). In marked contrast, in the epidermis of {alpha}7 KO mice the process of cornification, although delayed, proceeds via a normal path, surfacing skin of these mice with an impermeable barrier or the stratum corneum. Therefore, a lesser magnitude of changes of the gene expression in keratinocytes residing in the epidermis of {alpha}7 KO mice (Fig. 4 E) compared with keratinocytes treated with anti-{alpha}7 AsOs (Fig. 3 C), as judged from the results of the Western blotting assay, may be explained by putative physiologic backup mechanisms activated during the development of a KO mouse but lacking in the cells treated with AsOs in which the {alpha}7 AChRs are inactivated acutely at the posttranscriptional level.

To test a hypothesis that mutational deletion of {alpha}7 brings about changes in the repertoire of nAChR channels, we determined the ratios of different {alpha} subunit gene expression in {alpha}7-/- keratinocytes. We found alterations in the expression of {alpha}3, {alpha}9, and {alpha}10 nAChRs subunits, indicating that the nicotinergic signaling in the skin of {alpha}7 KO mice is predominantly mediated via a nAChR complex containing {alpha}3 without {alpha}5 and both homomeric {alpha}9- and heteromeric {alpha}9{alpha}10-made nAChRs. This switch in subunit composition of the nAChR-gated ion channels may, in turn, bring about a corresponding switch in the ionic properties of the ion channels formed because of shifting of the nicotinergic signaling to the nAChRs that differ in subunit composition, pharmacology, conductance, and kinetics and in their permeability to and modulation by Ca2+. For instance, it has been shown that {alpha}5 subunit increases Ca2+ permeability of {alpha}3 nAChR so that the Ca2+ permeability of {alpha}3ß2{alpha}5 nAChRs is comparable to that of {alpha}7 nAChRs (Gerzanich et al., 1998). Hence, a relative decrease of the proportion of {alpha}3 nAChRs containing {alpha}5 subunits, i.e., {alpha}3ß2{alpha}5, in {alpha}7-/- keratinocytes can bring about corresponding changes in the ionic properties of the channel, leading to a complex changes in cell cycle regulation, including proliferation-inducing effects, DNA repair and replication anomalies, and antiapoptotic gene activation. On the other hand, up-regulated expression of {alpha}9-containing nAChRs that mediate proapoptotic action of ACh at the granular cell–corneocyte transition, which culminates in programmed cell death within the epidermis (Nguyen et al., 2001), may compensate for a lacking component of the nicotinergic control of terminal differentiation of {alpha}7-/- keratinocytes, allowing formation of the functional epidermal barrier in {alpha}7 KO mice. The nAChR incorporating {alpha}9 subunits represents a novel ionotropic and metabotropic receptor/Ca2+ channel (Elgoyhen et al., 1994; Glowatzki et al., 1995; Wikstrom et al., 1998). Compared with homomeric {alpha}9 channels, the {alpha}9{alpha}10 nAChR channel displays faster and more extensive agonist-mediated desensitization, a distinct current-voltage relationship, and a biphasic response to changes in extracellular Ca2+ ions (Elgoyhen et al., 2001). Thus, although the use of KO mice is probably the most straightforward and rewarding approach to dissect biological function of each particular type of keratinocyte nAChRs, providing an unambiguous mechanistic insight into differential control of keratinocyte functions by ACh, the missing function may be partially compensated or obscured due to engagement of the alternative regulatory pathways.

In conclusion, the comprehensive analysis of the biological role of {alpha}7 nAChR in keratinocytes revealed its important role in sustaining normal unfolding of the genetically determined program of cell differentiation eventuating in cell death, or cornification, which is required for formation of the skin barrier. The ACh signaling through {alpha}7-made channels may evoke rapid and profound changes in the cellular metabolism of free Ca2+ due to modulation of its transmembrane flux. The downstream signaling apparently harbor both genomic and nongenomic effects, the biologic sum of which determines the rate of keratinocyte progression through the differential steps. In Acra7 homozygous mutant mice, the missing regulatory pathway causes transient changes in skin phenotype characteristic of delayed epidermal turnover. The changes are partially compensated due to redirection of the nicotinergic signaling via the {alpha}3-type keratinocyte nAChRs that in the past were found to be associated with immature cell phenotype (Zia et al., 2000), and the {alpha}9-type keratinocyte nAChRs that are coupled to regulation of keratinocyte apoptotic secretion (Nguyen et al., 2001).


   Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Human keratinocyte culture experiments
Human keratinocyte cultures were started from normal neonatal foreskins as we described in detail earlier (Grando et al., 1993a). The cells were grown in 75-cm2 flasks (Corning Glass Works) in KGM containing 0.09 mM Ca2+ (GIBCO BRL) at 37°C in a humid 5% CO2 incubator. To study nicotinergic effect on cell differentiation, keratinocytes were seeded into 6-well tissue culture plates (Falcon 3046; Becton Dickinson) at a cell density of 105/well, grown to ~75% confluence in 2 ml of KGM containing 0.09 mM Ca2+, after which the monolayers received KGM containing 10 µM Nic, 10 µM Nic plus 1 µM {alpha}-BTX (both from Sigma-Aldrich), or no additions (control), and the incubation was continued for additional periods of time (as described in Results) with replacing KGM every other day. After incubation, the monolayers were washed with prewarmed Ca2+- and Mg2+-free PBS (GIBCO BRL) and used either in immunocytochemical assay of differentiation marker expression (see below) or in a modification of the spontaneous cornified envelope formation assay (Rice and Green, 1979) as described in detail elsewhere (Grando et al., 1996).

{alpha}7 KO mice and murine keratinocyte cultures
The {alpha}7 KO mice used in experiments were Acra7-deficient ({alpha}7 null) mice generated as described previously (Orr-Urtreger et al., 1997). All control mice were {alpha}7+/+ littermates of {alpha}7+/- mice. The animals were killed, and skin samples were collected. The samples destined to RNA and protein extractions were fresh-frozen in liquid nitrogen or freshly embedded in the OCT Tissue Tek compound (Sakura) for use in IF experiments. All of the experiments were conducted by an experimenter that was blind to the genotype of the mice. The genotyping was performed by PCR and Southern analysis as detailed elsewhere (Orr-Urtreger et al., 1997). Cell cultures were grown at 37°C and 5% CO2 in 25 cm2 Falcon culture flasks using the cell culture techniques optimized for mouse keratinocytes (Li et al., 1995; Lee et al., 1997).

Immunocytochemical assay
Immunocytochemical analysis of nicotinergic effects on the expression of differentiation markers was performed in situ in keratinocyte monolayers as described previously (Grando et al., 1996). Stained monolayers were examined microscopically and photographed. The numbers of cytokeratin 10–, transglutaminase-, involucrin-, and filaggrin-positive cells were counted in at least three different microscopic fields at the magnification x200, and the results were expressed as a percentage of the total cells. At least 50 cell per each microscopic field were examined.

IF assay
The IF experiments with skin samples of {alpha}7-/- and {alpha}7+/+ mice were performed as detailed previously (Ndoye et al., 1998) using a computer-assisted image analysis with a software package purchased from Scanalytics. The intensity of fluorescence was calculated pixel by pixel by dividing the summation of the fluorescence intensity of all pixels by the area occupied by the pixels (i.e., segment) and then subtracting the mean intensity of fluorescence of a tissue-free segment (i.e., background).

45Ca2+ influx assay
The experiments were performed in triplicate samples according to our modification (Zia et al., 2000) of standard protocols (De Aizpurua et al., 1988). Briefly, freshly isolated human neonatal foreskin keratinocytes were counted with a hemocytometer and aliquoted in incubation buffers at a concentration of 3 x 106 cells per 50 µl per each Eppendorf tube. To measure basal and nicotinergic 45Ca2+ influx, we used Krebs buffer (Sigma-Aldrich) supplemented to contain 1.2 mM Ca2+ ("basal" buffer; pH 7.4). Cell aliquots were resuspended in 300 µl of basal buffer containing test nicotinergic agents and 45Ca2+ (specific activity 11.6 mCi/mmol; NEN) 1% of total Ca2+, and incubated for 1 min at 37°C. After washing three times by centrifugation at 250 g for 1 min in a Beckman Coulter microcentrifuge in ice-cold, radioactive calcium-free basal buffer, the cells were solubilized in 100 µl Triton X-100 (Sigma-Aldrich), transferred into scintillation vials containing 5.0 ml of a scintillation cocktail, and 45Ca2+ taken up by the cells was measured in a liquid scintillation counter. The amount of the ligand-dependent 45Ca2+ influx was expressed as a percentage of basal influx.

AsOs assay
The phosphorothioated and FITC-tagged AsOs and the phosphorothioated, equally sized sense oligonucleotide (control) were commercially synthesized by Operon. Following the protocol provided by the manufacturer, AsOs were mixed with LipofectAMINE PLUSTM reagent (GIBCO BRL) and transfected into second passage human foreskin keratinocytes grown to ~50% confluence in a standard 6-well tissue culture plate in 2.0 ml KGM. Each experimental culture received 20 nM of AsOs, and the control cultures received the same dose of control (sense) oligonucleotide, diluted in KGM containing 1.2 mM Ca2+, to induce keratinocyte differentiation (Hennings and Holbrook, 1983).

{alpha}7 nAChR expression assays
To assess the effects of changes in extracellular Ca2+ concentrations on the expression of keratinocyte {alpha}7 nAChRs, keratinocytes freshly isolated from human neonatal foreskins were incubated for 0, 15, or 60 min in KGM containing 1.2 mM Ca2+ in a humid 5% CO2 incubator after which the total amount of {alpha}7 protein was measured by Western blotting (as described below), and the membrane expression of this nAChR was evaluated using FITC-labeled {alpha}-BTX (Garcia-Borron et al., 1990). Briefly, quadruplicate of experimental, i.e., 1.2 mM Ca2+-treated, and control, i.e., 0.09 mM Ca2+-treated, keratinocytes were resuspended in ice-cold PBS containing 10 µM FITC-labeled {alpha}-BTX (Molecular Probes, Inc.), incubated for 1 h at 4°C, washed three times with PBS, loaded in standard 96-well ELISA plates (Costar Corporation) at a concentration of 5 x 104/well, and the fluorescence intensity ratio (at 494 nm excitation and 518-nm emission wavelengths) was measured using the Perkin Elmer HTS 7000 instrument.

Western blot assay
Proteins were isolated from the phenol-ethanol supernatant of homogenized human or murine keratinocytes or skin samples of neonatal mice by adding 1.5 ml of isopropyl alcohol per 1 ml of Trizol Reagent (GIBCO BRL) and analyzed essentially as described in our protocol of a quantitative immunoblot assay (Arredondo et al., 2001). The specificities and working concentrations of primary antibodies used are listed in Table III. The membranes were developed using the ECL + Plus chemiluminescent detection system (Amersham Biosciences). To visualize antibody binding, the membranes were scanned with StormTM/FluorImager (Molecular Dynamics), and band intensities were determined by area integration using ImageQuant software (Molecular Dynamics). To normalize for the protein content, the housekeeping protein actin was visualized in each sample with a mouse antiactin monoclonal antibody (Sigma-Aldrich). The ratios obtained in three independent experiments were averaged to obtain the mean value (n = 3). The protein content ratio in every control (or {alpha}7 +/+) sample is always equal to 1. The images represent typical results from a series of three independent experiments.

RT-PCR assay
Total RNA was extracted from cultured keratinocytes and murine skin using guanidinium thiocyanate phenol chloroform extraction procedure (Trizol Reagent; GIBCO BRL) as described elsewhere (Chomczynski and Sacchi, 1987). 1 µg of dried, DNase-treated RNA was reverse transcribed in 20 µl of RT-PCR mix (50 mM Tris, pH 8.3, 6 mM MgCl2, 40 mM KCl, 25 mM dNTPs, 1 µg Oligo-dt [GIBCO BRL], 1 mM DTT, 1 U RNase inhibitor [Boehringer] and 10 U SuperScript II [GIBCO BRL]) at 42°C for 2 h. The PCR was performed in a final volume of 50 µl containing 1 µl of the single strand cDNA product, 10 mM Tris-HCl (pH 9.0), 5 mM KCl, 5 mM MgCl2, 0.2 mM dATP, 0.2 mM dCTP, 0.2 mM dGTP, 0.2 mM dTTP, and 2.5 U Taq DNA polymerase (Perkin Elmer) and 20 pmol of each forward (5') and reverse (3') primers. To allow a quantitative determination of relative gene expression levels (Arredondo et al., 2001), the cDNA content of the samples was normalized, and the linear range of amplification was determined for each primer set. For each experiment, the housekeeping gene GAPDH was amplified with 20–30 cycles to normalize the cDNA content of the samples. The amplification was performed at 94°C (1 min), 60°C (2 min), and 72°C (3 min) for 24–30 cycles. The specific primers used in this study are shown in Table II. The reported ratios derived from the combination of the data obtained in three independent experiments (n = 3). The images represent typical results from a series of three independent experiments. To standardize the analysis, the gene expression ratio in the control (or {alpha}7+/+) sample is always equal to 1.

Statistics
The results of the quantitative assays were expressed as mean ± SD. Significance was determined using Student's t test.


   Footnotes
 
* Abbreviations used in this paper: ACh, acetylcholine; AsOs, antisense oligonucleotides; {alpha}-BTX, {alpha}-bungarotoxin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IF, immunofluorescence; KGM, serum-free keratinocyte growth medium; KO, knockout; nAChR, neuronal nicotinic acetylcholine receptor; Nic, nicotine. Back


   Acknowledgments
 
We thank Dr. Arthur L. Beaudet (Baylor College of Medicine, Houston, Texas) for making {alpha}7 KO mice available for experiments reported in this paper and for providing strong intellectual support throughout the study. We are also grateful to Arlene D. Gonzales (Biology & Biotechnology Research Program, Lawrence Livermore National Laboratory, Livermore, California) for help with experiments with antisense oligonucleotides. We thank Tamara E. Rees for her help with illustrations.

This work was supported by National Institutes of Health grants DE14173 and GM62136 and research grants from the Unilever Research-USA and Flight Attendant Medical Research Institute to S.A. Grando, and the grant SFB 547, project C2 to W. Kummer.

Submitted: 21 June 2002

Revised: 3 September 2002

Accepted: 3 September 2002


   References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 

Arredondo, J., V.T. Nguyen, A.I. Chernyavsky, D.L. Jolkovsky, K.E. Pinkerton, and S.A. Grando. 2001. A receptor-mediated mechanism of nicotine toxicity in oral keratinocytes. Lab. Invest. 81:1653–1668.[Medline]

Berger, F., F.H. Gage, and S. Vijayaraghavan. 1998. Nicotinic receptor-induced apoptotic cell death of hippocampal progenitor cells. J. Neurosci. 18:6871–6881.[Abstract/Free Full Text]

Broide, R.S., and F.M. Leslie. 1999. The {alpha}7 nicotinic acetylcholine receptor in neuronal plasticity. Mol. Neurobiol. 20:1–16.[Medline]

Broide, R.S., A. Orr-Urtreger, and J.W. Patrick. 2001. Normal apoptosis levels in mice expressing one {alpha}7 nicotinic receptor null and one L250T mutant allele. Neuroreport. 12:1643–1648.[CrossRef][Medline]

Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156–159.[Medline]

De Aizpurua, H.J., E.H. Lambert, G.E. Griesmann, B.M. Olivera, and V.A. Lennon. 1988. Antagonism of voltage-gated calcium channels in small cell carcinomas of patients with and without Lambert-Eaton myasthenic syndrome by autoantibodies omega-conotoxin and adenosine. Cancer Res. 48:4719–4724.[Abstract/Free Full Text]

Elgoyhen, A.B., D.S. Johnson, J. Boulter, D.E. Vetter, and S. Heinemann. 1994. {alpha}9: an acetylcholine receptor with novel pharmacological properties expressed in rat cochlear hair cells. Cell. 79:705–715.[CrossRef][Medline]

Elgoyhen, A.B., D.E. Vetter, E. Katz, C.V. Rothlin, S.F. Heinemann, and J. Boulter. 2001. {alpha}10: a determinant of nicotinic cholinergic receptor function in mammalian vestibular and cochlear mechanosensory hair cells. Proc. Natl. Acad. Sci. USA. 98:3501–3506.[Abstract/Free Full Text]

Foley, J., B.J. Longely, J.J. Wysolmerski, B.E. Dreyer, A.E. Broadus, and W.M. Philbrick. 1998. PTHrP regulates epidermal differentiation in adult mice. J. Invest. Dermatol. 111:1122–1128.[CrossRef][Medline]

Garcia-Borron, J.C., M.A. Chinchetru, and M. Martinez-Carrion. 1990. Selective labeling of {alpha}-bungarotoxin with fluorescein isothiocyanate and its use for the study of toxin-acetylcholine receptor interactions. J. Protein Chem. 9:683–693.[CrossRef][Medline]

Garrido, R., M.P. Mattson, B. Hennig, and M. Toborek. 2001. Nicotine protects against arachidonic-acid-induced caspase activation, cytochrome c release and apoptosis of cultured spinal cord neurons. J. Neurochem. 76:1395–1403.[CrossRef][Medline]

Gerzanich, V., F. Wang, A. Kuryatov, and J. Lindstrom. 1998. {alpha}5 subunit alters desensitization, pharmacology, Ca++ permeability and Ca++ modulation of human neuronal {alpha}3 nicotinic receptors. J. Pharmacol. Exp. Ther. 286:311–320.[Abstract/Free Full Text]

Gibbs, S., A.N.S. Pinto, S. Murli, M. Huber, D. Hohl, and M. Ponec. 2000. Epidermal growth factor and keratinocyte growth factor differentially regulate epidermal migration, growth, and differentiation. Wound Repair Regen. 8:192–203.[CrossRef][Medline]

Glowatzki, E., K. Wild, U. Braendle, G. Fakler, B. Fakler, H.P. Zenner, and J.P. Ruppersberg. 1995. Cell-specific expression of the {alpha}9 nACh receptor subunit in auditory hair cells revealed by single-cell RT-PCR. Proc. R Soc. Lond. B Biol. Sci. 262:141–147.[Medline]

Grando, S.A. 1997. Biological functions of keratinocyte cholinergic receptors. J. Investig. Dermatol. Symp. Proc. 2:41–48.[Medline]

Grando, S.A. 2001. Receptor-mediated action of nicotine in human skin. Int. J. Dermatol. 40:691–693.[CrossRef][Medline]

Grando, S.A., R. Cabrera, B.S. Hostager, P.L. Bigliardi, J.S. Blake, M.J. Herron, M.V. Dahl, and R.D. Nelson. 1993a. Computerized microassay of keratinocyte cell-plastic attachment and proliferation for assessing net stimulatory inhibitory and toxic effects of compounds on nonimmortalized cell lines. Skin Pharmacol. 6:135–147.[Medline]

Grando, S.A., D.A. Kist, M. Qi, and M.V. Dahl. 1993b. Human keratinocytes synthesize, secrete and degrade acetylcholine. J. Invest. Dermatol. 101:32–36.[CrossRef][Medline]

Grando, S.A., R.M. Horton, T.M. Mauro, D.A. Kist, T.X. Lee, and M.V. Dahl. 1996. Activation of keratinocyte nicotinic cholinergic receptors stimulates calcium influx and enhances cell differentiation. J. Invest. Dermatol. 107:412–418.[CrossRef][Medline]

Grando, S.A., R.M. Horton, E.F.R. Pereira, B.M. Diethelm-Okita, P.M. George, E.X. Albuquerque, and B.M. Conti-Fine. 1995. A nicotinic acetylcholine receptor regulating cell adhesion and motility is expressed in human keratinocytes. J. Invest. Dermatol. 105:774–781.[CrossRef][Medline]

Gueorguiev, V.D., R.J. Zeman, E.M. Meyer, and E.L. Sabban. 2000. Involvement of {alpha}7 nicotinic acetylcholine receptors in activation of tyrosine hydroxylase and dopamine ß-hydroxylase gene expression in PC12 cells. J. Neurochem. 75:1997–2005.[CrossRef][Medline]

Heeschen, C., J.J. Jang, M. Weis, A. Pathak, S. Kaji, R.S. Hu, P.S. Tsao, F.L. Johnson, and J.P. Cooke. 2001. Nicotine stimulates angiogenesis and promotes tumor growth and atherosclerosis. Nat. Med. 7:833–839.[CrossRef][Medline]

Hennings, H., and K.A. Holbrook. 1983. Calcium regulation of cell-cell contact and differentiation of epidermal cells in culture. An ultrastructural study. Exp. Cell Res. 143:127–142.[CrossRef][Medline]

Hory-Lee, F., and E. Frank. 1995. The nicotinic blocking agents d-tubocurare and {alpha}-bungarotoxin save motoneurons from naturally occurring death in the absence of neuromuscular blockade. J. Neurosci. 15:6453–6460.[Abstract/Free Full Text]

Kihara, T., S. Shimohama, H. Sawada, K. Honda, T. Nakamizo, H. Shibasaki, T. Kume, and A. Akaike. 2001. {alpha}7 nicotinic receptor transduces signals to phosphatidylinositol 3-kinase to block A ß-amyloid-induced neurotoxicity. J. Biol. Chem. 276:13541–13546.[Abstract/Free Full Text]

Lee, Y.S., A.A. Dlugosz, R. McKay, N.M. Dean, and S.H. Yuspa. 1997. Definition by specific antisense oligonucleotides of a role for protein kinase C alpha in expression of differentiation markers in normal and neoplastic mouse epidermal keratinocytes. Mol. Carcinog. 18:44–53.[CrossRef][Medline]

LeSage, G., D. Alvaro, A. Benedetti, S. Glaser, L. Marucci, L. Baiocchi, W. Eisel, A. Caligiuri, J.L. Phinizy, R. Rodgers, et al. 1999. Cholinergic system modulates growth, apoptosis, and secretion of cholangiocytes from bile duct-ligated rats. Gastroenterology. 117:191–199.[CrossRef][Medline]

Levandoski, M.M., Y. Lin, L. Moise, J.T. McLaughlin, E. Cooper, and E. Hawrot. 1999. Chimeric analysis of a neuronal nicotinic acetylcholine receptor reveals amino acids conferring sensitivity to alpha-bungarotoxin. J. Biol. Chem. 274:26113–26119.[Abstract/Free Full Text]

Li, L., R.W. Tucker, H. Hennings, and S.H. Yuspa. 1995. Chelation of intracellular Ca2+ inhibits murine keratinocyte differentiation in vitro. J. Cell. Physiol. 163:105–114.[CrossRef][Medline]

Li, Y., R.L. Papke, Y.J. He, W.J. Millard, and E.M. Meyer. 1999. Characterization of the neuroprotective and toxic effects of {alpha}7 nicotinic receptor activation in PC12 cells. Brain Res. 830:218–225.[CrossRef][Medline]

Li, Y., M.A. King, and E.M. Meyer. 2000. {alpha}7 nicotinic receptor-mediated protection against ethanol-induced oxidative stress and cytotoxicity in PC12 cells. Brain Res. 861:165–167.[CrossRef][Medline]

Lindstrom, J. 1997. Nicotinic acetylcholine receptors in health and disease. Mol. Neurobiol. 15:193–222.[Medline]

Liu, Q.S., and D.K. Berg. 1999. Extracellular calcium regulates responses of both {alpha}3- and {alpha}7-containing nicotinic receptors on chick ciliary ganglion neurons. J. Neurophysiol. 82:1124–1132.[Abstract/Free Full Text]

Ndoye, A., R. Buchli, B. Greenberg, V.T. Nguyen, S. Zia, J.G. Rodriguez, R.J. Webber, M.A. Lawry, and S.A. Grando. 1998. Identification and mapping of keratinocyte muscarinic acetylcholine receptor subtypes in human epidermis. J. Invest. Dermatol. 111:410–416.[CrossRef][Medline]

Nguyen, V.T., L.L. Hall, G. Gallacher, A. Ndoye, D.L. Jolkovsky, R.J. Webber, R. Buchli, and S.A. Grando. 2000a. Choline acetyltransferase, acetylcholinesterase, and nicotinic acetylcholine receptors of human gingival and esophageal epithelia. J. Dent. Res. 79:939–949.[Abstract/Free Full Text]

Nguyen, V.T., A. Ndoye, and S.A. Grando. 2000b. Novel human {alpha}9 acetylcholine receptor regulating keratinocyte adhesion is targeted by pemphigus vulgaris autoimmunity. Am. J. Pathol. 157:1377–1391.[Abstract/Free Full Text]

Nguyen, V.T., A. Ndoye, L.L. Hall, S. Zia, J. Arredondo, A.I. Chernyavsky, D.A. Kist, B.D. Zelickson, M.A. Lawry, and S.A. Grando. 2001. Programmed cell death of keratinocytes culminates in apoptotic secretion of a humectant upon secretagogue action of acetylcholine. J. Cell Sci. 114:1189–1204.[Abstract]

Orr-Urtreger, A., F.M. Goldner, M. Saeki, I. Lorenzo, L. Goldberg, M. De Biasi, J.A. Dani, J.W. Patrick, and A.L. Beaudet. 1997. Mice deficient in the {alpha}7 neuronal nicotinic acetylcholine receptor lack {alpha}-bungarotoxin binding sites and hippocampal fast nicotinic currents. J. Neurosci. 17:9165–9171.[Abstract/Free Full Text]

Orr-Urtreger, A., R.S. Broide, M.R. Kasten, H. Dang, J.A. Dani, A.L. Beaudet, and J.W. Patrick. 2000. Mice homozygous for the L250T mutation in the {alpha}7 nicotinic acetylcholine receptor show increased neuronal apoptosis and die within 1 day of birth. J. Neurochem. 74:2154–2166.[CrossRef][Medline]

Paylor, R., M. Nguyen, J.N. Crawley, J. Patrick, A. Beaudet, and A. Orr-Urtreger. 1998. {alpha}7 nicotinic receptor subunits are not necessary for hippocampal-dependent learning or sensorimotor gating: a behavioral characterization of Acra7-deficient mice. Learn. Mem. 5:302–316.[Abstract/Free Full Text]

Plummer, H.K., III, B.J. Sheppard, and H.M. Schuller. 2000. Interaction of tobacco-specific toxicants with nicotinic cholinergic regulation of fetal pulmonary neuroendocrine cells: implications for pediatric lung disease. Exp. Lung Res. 26:121–135.[CrossRef][Medline]

Quik, M., J. Chan, and J. Patrick. 1994. {alpha}-Bungarotoxin blocks the nicotinic receptor mediated increase in cell number in a neuroendocrine cell line. Brain Res. 655:161–167.[CrossRef][Medline]

Renshaw, G., P. Rigby, G. Self, A. Lamb, and R. Goldie. 1993. Exogenously administered {alpha}-bungarotoxin binds to embryonic chick spinal cord: implications for the toxin-induced arrest of naturally occurring motoneuron death. Neuroscience. 53:1163–1172.[CrossRef][Medline]

Rice, R.H., and H. Green. 1979. Presence in human epidermal cells of a soluble protein precursor of the cross-linked envelope: activation of the cross-linking by calcium ions. Cell. 18:681–694.[CrossRef][Medline]

Schuller, H.M., B.A. Jull, B.J. Sheppard, and H.K. Plummer. 2000. Interaction of tobacco-specific toxicants with the neuronal {alpha}7 nicotinic acetylcholine receptor and its associated mitogenic signal transduction pathway: potential role in lung carcinogenesis and pediatric lung disorders. Eur. J. Pharmacol. 393:265–277.[CrossRef][Medline]

Seguela, P., J. Wadiche, K. Dineley-Miller, J.A. Dani, and J.W. Patrick. 1993. Molecular cloning, functional properties, and distribution of rat brain {alpha}7: a nicotinic cation channel highly permeable to calcium. J. Neurosci. 13:596–604.[Abstract]

Sekhon, H.S., Y. Jia, R. Raab, A. Kuryatov, J.F. Pankow, J.A. Whitsett, J. Lindstrom, and E.R. Spindel. 1999. Prenatal nicotine increases pulmonary {alpha}7 nicotinic receptor expression and alters fetal lung development in monkeys. J. Clin. Invest. 103:637–647.[Medline]

Sgard, F., E. Charpantier, S. Bertrand, N. Walker, D. Caput, D. Graham, D. Bertrand, and F. Besnard. 2002. A novel human nicotinic receptor subunit, {alpha}10, that confers functionality to the {alpha}9-subunit. Mol. Pharmacol. 61:150–159.[Abstract/Free Full Text]

Steinbach, J.H. 1990. Mechanism of action of the nicotinic acetylcholine receptor. The Biology Of Nicotine Dependence. Vol. 152. G. Bock and J. Marsh, editors. John Wiley and Sons Ltd., New York. 53–61.

Stone, R.A., R. Sugimoto, A.S. Gill, J. Liu, C. Capehart, and J.M. Lindstrom. 2001. Effects of nicotinic antagonists on ocular growth and experimental myopia. Invest. Ophthalmol. Vis. Sci. 42:557–565.[Abstract/Free Full Text]

Treinin, M., and M. Chalfie. 1995. A mutated acetylcholine receptor subunit causes neuronal degeneration in C. elegans. Neuron. 14:871–877.[CrossRef][Medline]

Waggoner, S.E., and X. Wang. 1994. Effect of nicotine on proliferation of normal, malignant, and human papillomavirus-transformed human cervical cells. Gynecol. Oncol. 55:91–95.[CrossRef][Medline]

Wang, Y., E.F. Pereira, A.D. Maus, N.S. Ostlie, D. Navaneetham, S. Lei, E.X. Albuquerque, and B.M. Conti-Fine. 2001. Human branchial epithelial and endothelial cells express alpha7 nicotinic acetylcholine receptors. Mol. Pharmacol. 60:1201–1209.[Abstract/Free Full Text]

Wessler, I., C.J. Kirkpatrick, and K. Racke. 1998. Non-neuronal acetylcholine, a locally acting molecule, widely distributed in biological systems: expression and function in humans. Pharmacol. Ther. 77:59–79.[CrossRef][Medline]

Wessler, I., C.J. Kirkpatrick, and K. Racke. 1999. The cholinergic ‘pitfall’: acetylcholine, a universal cell molecule in biological systems, including humans. Clin. Exp. Pharmacol. Physiol. 26:198–205.[CrossRef][Medline]

Wikstrom, M.A., G. Lawoko, and E. Heilbronn. 1998. Cholinergic modulation of extracellular ATP-induced cytoplasmic calcium concentrations in cochlear outer hair cells. J. Physiol. (Paris). 92:345–349.

Zhang, S., I.N. Day, and S. Ye. 2001a. Microarray analysis of nicotine-induced changes in gene expression in endothelial cells. Physiol. Genomics. 5:187–192.[Abstract/Free Full Text]

Zhang, S., I. Day, and S. Ye. 2001b. Nicotine induced changes in gene expression by human coronary artery endothelial cells. Atherosclerosis. 154:277–283.[CrossRef][Medline]

Zia, S., A. Ndoye, V.T. Nguyen, and S.A. Grando. 1997. Nicotine enhances expression of the {alpha}3, {alpha}4, {alpha}5, and {alpha}7 nicotinic receptors modulating calcium metabolism and regulating adhesion and motility of respiratory epithelial cells. Res. Commun. Mol. Pathol. Pharmacol. 97:243–262.[Medline]

Zia, S., A. Ndoye, T.X. Lee, R.J. Webber, and S.A. Grando. 2000. Receptor-mediated inhibition of keratinocyte migration by nicotine involves modulations of calcium influx and intracellular concentration. J. Pharmacol. Exp. Ther. 293:973–981.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 300K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JCB
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Arredondo, J.
Right arrow Articles by Grando, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Arredondo, J.
Right arrow Articles by Grando, S. A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CALCIUM COMPOUNDS
*CALCIUM, ELEMENTAL
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?


  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents