|
||
© The Rockefeller University Press,
0021-9525/2003/2/505 $5.00
The Journal of Cell Biology, Volume 160, Number 4, 505-516
Article |
Targeting of U4/U6 small nuclear RNP assembly factor SART3/p110 to Cajal bodies
k1Address correspondence to Karla Neugebauer, Ph.D., Max Planck Institute of Molecular Cell Biology and Genetics, Pfotenhauerstrasse 108, 01307 Dresden, Germany. Tel.: 49-351-2102589. Fax: 49-351-2101209. E-mail: neugebauer{at}mpi-cbg.de
| Abstract |
|---|
|
|
|---|
The spliceosomal small nuclear RNAs (snRNAs) are distributed throughout the nucleoplasm and concentrated in nuclear inclusions termed Cajal bodies (CBs). A role for CBs in the metabolism of snRNPs has been proposed but is not well understood. The SART3/p110 protein interacts transiently with the U6 and U4/U6 snRNPs and promotes the reassembly of U4/U6 snRNPs after splicing in vitro. Here we report that SART3/p110 is enriched in CBs but not in gems or residual CBs lacking coilin. The U6 snRNP Sm-like (LSm) proteins, also involved in U4/U6 snRNP assembly, were localized to CBs as well. The levels of SART3/p110 and LSm proteins in CBs were reduced upon treatment with the transcription inhibitor
-amanitin, suggesting that CB localization reflects active processes dependent on transcription/splicing. The NH2-terminal HAT domain of SART3/p110 was necessary and sufficient for specific protein targeting to CBs. Overexpression of truncation mutants containing the HAT domain had dominant negative effects on U6 snRNP localization to CBs, indicating that endogenous SART3/p110 plays a role in targeting the U6 snRNP to CBs. We propose that U4 and U6 snRNPs accumulate in CBs for the purpose of assembly into U4/U6 snRNPs by SART3/p110.
Key Words: RNA splicing; coiled (Cajal) body; U4/U6 small nuclear ribonucleoprotein; small nuclear RNA; nuclear proteins
| Introduction |
|---|
|
|
|---|
The U1, U2, U4, and U5 snRNAs are synthesized by RNA polymerase II, capped at their 5' ends, and transported to the cytoplasm where they are bound by snRNP-specific Sm proteins (for reviews see Will and Luhrmann, 2001; Paushkin et al., 2002). These snRNAs are hypermethylated at their 5' ends, producing their characteristic 2,2,7 trimethylguanosine (TMG) caps and providing an important signal for snRNP import into the nucleus (Hamm et al., 1990). Because snRNP-specific proteins appear to concentrate in CBs before accumulating in the nucleoplasm, a role for CBs in the maturation of snRNPs has been proposed (Sleeman and Lamond, 1999; Sleeman et al., 2001; Ogg and Lamond, 2002). The recent identification of RNAs that guide base modification of snRNAs and localization of these guide RNAs to CBs suggest that snRNA base modification may take place in CBs (Carmo-Fonseca, 2002; Darzacq et al., 2002; Kiss, 2002; Kiss et al., 2002). However, these results do not explain why the U6 snRNA, which is synthesized by RNA polymerase III, is not capped or exported to the cytoplasm, and undergoes base modification in the nucleolus (Tycowski et al., 1998; Ganot et al., 1999; Lange and Gerbi, 2000), is present in CBs. The U6 snRNA is present in at least three distinct snRNPs, the U6 snRNP, the U4/U6 snRNP, and the U4/U6
U5 tri-snRNP. Formation of all of these snRNP species must occur in the nucleus, but little is known about the subnuclear location of these processes.
After assembly, the U1, U2, and U4/U6
U5 snRNPs perform essential functions in spliceosome formation and catalysis. During a process termed the spliceosomal cycle, each snRNP is thought to participate in subsequent rounds of splicing, which then requires the regeneration of snRNPs that have undergone rearrangement during splicing (Staley and Guthrie, 1998). In particular, the U4/U6 snRNP, which contains two snRNAs base paired with each other, unwinds during splicing as U6 establishes new base-pairing interactions with U2 and the pre-mRNA. Therefore, U4 and U6 must reanneal after splicing to regenerate functional U4/U6 snRNPs. In yeast, the essential protein Prp24 catalyzes this reaction (Raghunathan and Guthrie, 1998; Rader and Guthrie, 2002). In the absence of Prp24p, splicing extracts are depleted of the U4/U6 snRNP, demonstrating the importance of snRNP recycling for continuing rounds of pre-mRNA splicing (Raghunathan and Guthrie, 1998).
Recently, the tumor rejection antigen SART3/p110 was identified as the human homologue of Prp24p (Bell et al., 2002; Rader and Guthrie, 2002) and was shown to be required for U4/U6 snRNP recycling in vitro (Bell et al., 2002). SART3/p110 binds specifically and directly to the U6 snRNA and is detectable in the U6 and U4/U6 snRNPs (Bell et al., 2002). Unlike other U4, U5, and U6 snRNPspecific proteins, SART3/p110 is not detectable in the U4/U6
U5 tri-snRNP (Bell et al., 2002; Schneider et al., 2002), indicating that SART3/p110 dissociates from its U4 and U6 snRNP substrates once they are annealed. In addition to SART3/p110, the Sm-like (LSm) proteins LSm28, which assemble on the 3' end of the U6 snRNA as a stable heteromer and persist in the U4/U6 and U4/U6
U5 snRNPs (Seraphin, 1995; Gottschalk et al., 1999; Salgado-Garrido et al., 1999; Vidal et al., 1999; Schneider et al., 2002), have been implicated in U4/U6 snRNP assembly (Achsel et al., 1999; Mayes et al., 1999). The LSm proteins bind directly to Prp24 in yeast (Fromont-Racine et al., 2000; Rader and Guthrie, 2002; Ryan et al., 2002), providing a second mode of interaction with the U6 snRNP. In vitro, Prp24p anneals U4 and U6 snRNAs more efficiently in the context of snRNPs (Raghunathan and Guthrie, 1998), making it likely that the combination of SART3/p110/Prp24p and LSm proteins enables efficient assembly of the U4/U6 snRNP in vivo. Because the role of SART3/p110 in U4/U6 recycling is uniquely transient, the subnuclear distribution of SART3/p110 has the potential to reveal the sites of U4/U6 snRNP assembly.
In this study, we report that SART3/p110 and the LSm proteins, LSm4 and LSm8, are localized in the cell nucleus and concentrated in CBs. We studied the association of SART3/p110 and snRNPs with CBs after transcription inhibition and run-on treatment and in the absence of the CB component coilin. SnRNP and SART3/p110 localizations in CBs were correlated in each of these experimental conditions. Mutant analysis revealed that the HAT domain of SART3/p110 represents the major determinant for specific targeting of SART3/p110 to CBs. Overexpression of mutants lacking the snRNP-binding COOH-terminal domains reduced the concentration of both endogenous SART3/p110 and LSm4 in CBs, suggesting that SART3/p110 is required for U6 snRNP targeting to CBs.
| Results |
|---|
|
|
|---|
|
|
|
|
|
|
To determine whether SART3/p110 concentration in CBs is dependent on RNA synthesis, cells were treated with the transcription inhibitor
-amanitin. After treatment, all cells had rounded splicing factor compartments (SFCs) labeled with SC-35 (Fig. 6, A and B), an indication of RNA polymerase II inhibition (Carmo-Fonseca et al., 1992). Neither SART3/p110 nor LSm4 was enriched in SFCs. The latter result was unexpected, because other snRNPs (U1, U2, U4, and U5) have been shown to concentrate in SFCs after
-amanitin treatment (Carmo-Fonseca et al., 1992; Blencowe et al., 1993). After
-amanitin treatment, two types of coilin-positive CBs were observed: normal-looking CBs (indistinguishable from CBs in nontreated cells in size and morphology) and enlarged "ring-shaped" CBs, as reported previously (Carmo-Fonseca et al., 1992; Haaf and Ward, 1996; Frey et al., 1999). This change in CB morphology is not likely to reflect cell death because
95% of the cells were viable, according to a standard viability test (see Material and methods). In contrast to control untreated cells (Figs. 1 and 5), we did not detect any specific enrichment of SART3/p110 or LSm4 in any of the coilin-labeled CBs (Fig. 6, C and D). Quantitation of the fluorescence intensities within normal-looking CBs relative to the nucleoplasmic signal revealed that SART3/p110 levels in CBs decreased threefold (P < 0.0001) and LSm4 levels in CBs decreased twofold (P < 0.0001) after
-amanitin treatment. These results indicate that SART3/p110 and LSm4 association with CBs is transcription/splicing dependent and not likely due to the storage of inactive molecules.
|
|
CT10) or both CT-10 and the two RNA recognition motifs (
CT10
RRM) resulted in similar localization patterns as full-length SART3/p110. In contrast, truncation of the NH2-terminal portion of the protein containing seven HAT repeats (
HAT) had strong effects on protein localization. The
HATEGFP protein was found in the nucleoplasm and concentrated in nucleoli, but was only weakly detectable in CBs. Because EGFP conjugated to an NLS (EGFPNLS) was also concentrated in nucleoli and faintly detectable in CBs, the simplest interpretation of the data is that the concentration of
HATEGFP in nucleoli and weak detectability in CBs is nonspecific. To further investigate the role of the NH2 terminus, we created a mutant containing only the HAT domain and the endogenous NLS (HAT). This construct was specifically targeted to CBs. In contrast, the extreme NH2-terminal region of SART3/p110 (N-TERM), lacking the HAT domain and conjugated to EGFP plus a heterologous NLS, was not specifically localized to CBs (compare N-TERM with EGFPNLS localizations). Interestingly, the N-TERM mutant was not highly concentrated in nucleoli, in contrast to EGFPNLS alone. Although the function of the extreme NH2-terminal region of SART3/p110 is currently unknown, these results suggest that it may interact with a nucleoplasmic component. We conclude from this analysis that the HAT domain of SART3/p110 is necessary and sufficient for the specific targeting of SART3/p110 to CBs.
The highly conserved CT10 domain was previously shown to interact with LSm proteins (Rader and Guthrie, 2002). To determine whether overexpression of SART3/p110 mutants lacking the COOH-terminal region affects the localization of endogenous SART3/p110 and/or LSm4, we transfected HeLa cells with WT,
HAT,
CT10, and
CT10
RRMEGFP mutants and determined the localization patterns of endogenous SART3/p110 and LSm4 by immunofluorescence (Fig. 8, WTEGFP and
CT10
RRMEGFP constructs shown only). Quantitation of fluorescence intensities within CBs relative to the nucleoplasm revealed that the localization of endogenous SART3/p110 was significantly reduced in
CT10- and
CT10
RRM-expressing cells, compared with untransfected controls (Table I). This indicates that both mutant proteins effectively compete for SART3/p110 binding sites within CBs. Moreover, if SART3/p110 plays a role in U6 snRNP localization to CBs, then expression of
CT10 and/or
CT10
RRM mutants may have dominant negative effects on LSm4 localization in CBs. Indeed, LSm4 concentration in CBs was significantly reduced upon overexpression of
CT10 or
CT10
RRM mutants by
30% (Table I). The expression of WTEGFP also influenced the concentration of LSm4 in CBs, but the effect was less pronounced than in the case of
CT10 or
CT10
RRM mutant (Table I). We noticed that CBs were disrupted in some cells expressing high levels of
CT10 or
CT10
RRM mutant (unpublished data). The
HATEGFP mutant, which is aberrantly localized to nucleoli, did not show any effects on a localization of LSm4 (unpublished data). These data suggest that SART3/p110 plays a role in U6 snRNP targeting to CBs, largely through the CT10 domain of SART3/p110.
|
| Discussion |
|---|
|
|
|---|
U5 tri-snRNP and spliceosomes (Bell et al., 2002; Rappsilber et al., 2002; Zhou et al., 2002) and further suggesting that SART3/p110 is not recruited to snRNPs cotranscriptionally.
To address how SART3/p110 is specifically targeted to CBs, we constructed and expressed EGFP fusion proteins containing distinct domains of SART3/p110. We found that the SART3/p110 HAT domain with NLS is necessary and sufficient to specifically localize EGFP-tagged constructs to CBs. CstF77, a protein containing 10 HAT repeats, was not concentrated in CBs (unpublished data), indicating that the SART3/p110 HAT domain, and not all HAT domains in general, can target proteins to CBs. Although all constructs containing the HAT domain were specifically targeted to CBs, mutants lacking the COOH-terminal region (
CT10,
CT10
RRM, and HAT) showed less intense signal than the full-length protein. Thus, although the COOH-terminal half of SART3/p110 was not specifically localized in CBs, the RRMs and/or CT-10 domain may enhance SART3/p110 retention in CBs by promoting binding to snRNPs (Shannon and Guthrie, 1991; Rader and Guthrie, 2002).
Because SART3/p110 acts during snRNP assembly, we wanted to test the hypothesis that gems, a nuclear structure often associating with CBs, are the sites of snRNP regeneration after splicing, as previously suggested (Pellizzoni et al., 1998). In HeLa cells and primary human fibroblasts, where gems are often separated from CBs, we found that SART3/p110 was not concentrated in gems, as judged by double immunofluorescence with anti-SMN (Fig. 2). Moreover, mouse embryonic fibroblasts, which lack the CB-specific protein coilin, also contain gems separate from residual CBs (Tucker et al., 2001), and these gems lacked SART3/p110 as well (Fig. 3). Therefore, our data suggest that steps in U4/U6 snRNP assembly or regeneration involving SART3/p110 are unlikely to occur in gems.
Correlation of SART3/p110 and snRNP accumulation in CBs
The spliceosomal snRNPs are concentrated in CBs even though CBs are not thought to be sites of pre-mRNA splicing (Matera, 1999). Because newly synthesized snRNPs transit CBs en route to the nucleoplasm (Sleeman and Lamond, 1999; Sleeman et al., 2001), and because snRNPs are depleted from CBs upon inhibition of transcription, a role for CBs in snRNP assembly and regeneration has been proposed (Carmo-Fonseca et al., 1992; Matera, 1999; Ogg and Lamond, 2002). If this is true, then assembly factors like SART3/p110 might interact with snRNPs in CBs. In this study, three independent lines of evidence demonstrate a correlation between SART3/p110 and snRNP accumulation in CBs, suggesting that SART3/p110 associates with CBs in a complex with snRNPs.
First, we show that SART3/p110 accumulation in CBs is dependent on the expression of the CB-specific protein coilin. In an embryonic fibroblast cell line established from a coilin-/- mouse, the CB components fibrillarin and Nopp140 remain concentrated in so-called residual CBs, which fail to recruit snRNPs (Tucker et al., 2001). We found that SART3/p110 was detectable in the nucleoplasm of these coilin-/- cells but, like snRNPs, was absent from residual CBs (Fig. 3). Thus, coilin is required for snRNP assembly into CBs (Bauer et al., 1994; Tucker et al., 2001) along with factors involved in their metabolism, such as SART3/p110.
Second, we show that SART3/p110 and snRNPs are depleted from CBs by nuclear run-on treatment, in which the activity of RNA polymerase II is preserved. In contrast, fibrillarin, coilin, and SMN remained associated with CBs after run-on treatment. The loss of SART3/p110 and snRNPs under these conditions suggests that SART3/p110 and snRNPs associate weakly with CBs and are not stable structural components of CBs. In light of recent efforts to characterize the proteomic environment of a variety of subnuclear structures (Mintz et al., 1999; Andersen et al., 2002; Lam et al., 2002), these results indicate that at least some important nuclear body components may be removed during purification and therefore subsequently escape detection. In this regard, it is noteworthy that a number of known nucleolar proteins were indeed absent in the proteomic analysis of isolated nucleoli (Andersen et al., 2002; Dundr and Misteli, 2002).
Third, we show that SART3/p110 and LSm4, which are normally concentrated in CBs (Figs. 1 and 5), are not specifically concentrated in CBs after
-amanitin treatment, indicating that SART3/p110 and LSm4 association with CBs is transcription/splicing dependent. These results coincide with previous findings (Carmo-Fonseca et al., 1992), which describe the depletion of snRNPs from CBs after
-amanitin treatment. However, in contrast to other snRNPs, the U6 snRNP component LSm4 and SART3/p110 were not concentrated in SFCs after RNA polymerase II inhibition. The dependence of SART3/p110 and snRNP accumulation in CBs on transcription and splicing is consistent with the hypothesis that CBs play an active role in snRNP metabolism and do not represent storage sites for snRNPs or SART3/p110.
CBs: sites of snRNP assembly?
The observations described here suggest that specific steps in snRNP biogenesis, namely the binding of SART3/p110 to its U4 and U6 snRNP substrates and possibly U4/U6 snRNA annealing itself, occur in CBs. We propose a model in which CBs are the sites of U4/U6 snRNP assembly (Fig. 9). This may occur after snRNP nuclear import and/or after each round of splicing, although direct evidence that snRNPs cycle repeatedly through CBs is currently lacking. This working hypothesis is consistent with the detection of U4 and U6 snRNAs as well as TMG cap, Sm, and LSm proteins in CBs (Carmo-Fonseca et al., 1991, 1992; Raska et al., 1991; Matera and Ward, 1993) (Fig. 5), the latter indicating that mature snRNPs are present (Matera, 1999). Importantly, newly synthesized snRNPs imported from the cytoplasm first concentrate in CBs (Sleeman and Lamond, 1999; Sleeman et al., 2001). The model is further supported by our data, which correlate snRNP and SART3/p110 association with CBs under the conditions of coilin knockout, run-on treatment, and transcription inhibition (see above). The fact that SART3/p110 associates with U6 and U4/U6 snRNPs only transiently and is not detectable in the U4/U6
U5 tri-snRNP (Bell et al., 2002; Schneider et al., 2002) is a key point in the proposal that the SART3/p110 concentration in CBs reflects its function there.
|
The presence of SART3/p110 in the nucleoplasm indicates that SART3/p110 binding to its substrates and/or U4/U6 annealing may also occur outside CBs. In cells lacking morphologically defined CBs, U4/U6 assembly and recycling likely takes place in the nucleoplasm, although it is currently unknown whether other CB components, such as nucleoplasmic coilin, also participate. The other possibility is that besides snRNP regeneration, nucleoplasmic SART3/p110 may be involved in other nuclear processes, as suggested by others (Harada et al., 2001; Liu et al., 2002).
Splicing involves not only unwinding of U4 and U6 snRNAs but also rearrangements within other snRNPs (Staley and Guthrie, 1998). We speculate that CBs could be involved in the assembly and/or recycling of snRNPs other than U4/U6, for example the U4atac/U6atac snRNP, the U4/U6
U5 tri-snRNP, and/or the U2 snRNP. This proposal is supported by the recent finding that a 61-kD protein involved in formation of the U4/U6
U5 and the U4atac/U6atac
U5 tri-snRNPs is also present in CBs (Makarova et al., 2002; Schneider et al., 2002). Interestingly, the U4atac/U6atac snRNP also contains LSm proteins (Schneider et al., 2002), suggesting that SART3/p110 may also promote annealing of the U4atac/U6atac snRNP. The concentration of these processes in CBs might represent an efficient pathway for the assembly and recycling of transcription and splicing factors in highly active cells with elevated levels of transcription and splicing (Boudonck et al., 1998; Gall et al., 1999; Pena et al., 2001).
| Materials and methods |
|---|
|
|
|---|
ka, Institute of Experimental Medicine, Prague, Czech Republic), mAb SC-35 (Fu and Maniatis, 1990), rat mAb anti-BrdU (Harlan Sera Lab), and a rabbit antibody against LSm4 (provided by T. Achsel and R. Luhrmann, Max Planck Institute for Biophysical Chemistry, Göttingen, Germany; Achsel et al., 1999).
SART3/p110 cloning and protein tagging
The SART3/p110 gene was amplified from 293 cell RNA by RT-PCR in two pieces, using DNA oligonucleotides A (GAATTCGCCACCATGGCGACTGCGGCCGAAACCTCGGC) and B (GCTATCCCAGAGTTCCCGGGCTTTCTGC) for the 5' portion (nt 11474) and C (GCAGAAAGCCCGGGAACTCTGGGATAGC) and D (GGAGATCTGACTTTCTCAGAAACA-GCTTGGCAAAATCGGCATTGG) for the 3' portion (nt 14662889). Oligonucleotide A contained an EcoRI restriction site as well as a Kozak sequence, oligos B and C contained an XmaI site, and D contained a BglII site. Reverse transcription was performed using MMLV reverse transcriptase (GIBCO BRL), and PCR was performed using Pfu polymerase (Stratagene) according to the manufacturer's instructions. The two fragments were sequentially ligated into the BglII, XmaI, and EcoRI sites of plasmid pTYB4 (New England Biolabs, Inc.), and the entire EcoRIBglII fragment was subcloned into the EcoRIBamHI sites of pBOS-H2BGFP (BD Biosciences). Three independent bacterial transformants were sequenced (at the University of California San Francisco Biological Resource Center), revealing two silent mutations (A127G and C2815T) as well as a G507C mutation that results in a Gly
Ala change relative to the sequence in GenBank/EMBL/DDBJ (accession no. D63879). Full-length SART3/p110 as well as deletion mutants (
CT10 aa 1950;
CT10
RRM aa 1702,
HAT aa 581963, and HAT aa 119702) were amplified by Expand long template PCR system (Roche) and cloned into EGFP-N1 and -C3 vectors (CLONTECH Laboratories, Inc.) using BglII and EcoRI sites. The N-TERM (aa 1127) fusion construct was cloned using HindIII and KpnI sites into EGFP-N2 vector (CLONTECH Laboratories, Inc.) containing at the COOH terminus three tandem repeats of the NLS from simian virus large T-antigen (gift of W. Haubensak, Max Planck Institute of Molecular Cell Biology and Genetics). The NLS signal was cloned from EYFP-Nuc vector (CLONTECH Laboratories, Inc.) using BsrGI and AflII sites.
The mouse LSm8 cDNA was obtained from R. Luhrmann and T. Achsel. The mouse LSm8 protein has the same amino acid sequence as its human homologue (Achsel et al., 1999). The full-length cDNA was amplified by Expand long template PCR and cloned into EYFP-N1 vector using BglII and KpnI restriction sites.
All fusion constructs were confirmed by sequencing. Fugene 6 (Roche) was used for transfection of cells with the SART3/p110EGFP and LSm8EYFP constructs.
Indirect immunofluorescence
Cells were fixed in 4% paraformaldehyde (Sigma-Aldrich) for 10 min, permeabilized for 5 min with 0.2% Triton X-100 (Sigma-Aldrich), and incubated with the indicated antibodies. Secondary antimouse antibodies conjugated with TRITC or FITC, antirat antibody conjugated with FITC, and antirabbit antibodies conjugated with TRITC, FITC, or Cy5 (Jackson ImmunoResearch Laboratories) were used. Immunodetection of SART3/p110 or LSm4 in cells expressing EGFP constructs was done 2448 h after transfection. Images were collected using the DeltaVision microscope system (Applied Precision) coupled with Olympus IX70 microscope. Stacks of 25 z-sections with 200-nm z-step were collected per sample and subjected to mathematical deconvolution (SoftWorx; Applied Precision). If not indicated otherwise, the images shown here are single sections of the resulting three-dimensional reconstructions.
Run-on transcription assay
Cells were permeabilized and RNA was labeled by BrUTP as previously described (Wansink et al., 1993; Neugebauer and Roth, 1997). In brief, cells were incubated in glycerol buffer (20 mM Tris-Cl, pH 7.4, 5 mM MgCl2, 25% glycerol, 0.5% PMSF, 0.5% EGTA) for 2 min at 37°C, overlaid with BTB buffer (100 mM KCl, 50 mM Tris-Cl, pH 7.4, 5 mM MgCl2, 0.5 mM EGTA, 25% glycerol, 2.5% PVA, and 0.1% Triton X-100) containing 0.5 mM ATP, GTP, and CTP and 0.2 mM BrUTP, incubated for 10 min at 37°C, fixed with 4% paraformaldehyde, and processed for immunofluorescence.
Transcription inhibition
-Amanitin treatment was performed as previously described (Carmo-Fonseca et al., 1992). HeLa cells were placed in fresh medium, and
-amanitin (Sigma) was added to a final concentration of 50 µg/ml. Cells were incubated for 5 h and prepared for immunofluorescence as described above. To test cell viability after
-amanitin treatment, the dye FM 464 (Molecular Probes) was added to culture medium (final concentration 16 nM). The dye incorporation into living cells was observed after 10 min and compared with untreated control cells.
Measurement of fluorescence intensities
Fluorescence intensities were quantified with MetaVue software (Universal Imaging Corp.) using deconvolved images (see above). The optical sections were merged, and the intensities in random regions of the nucleoplasm divided by the region area were taken as the values to which the intensities within the CBs were compared. CB area was defined by SART3/p110EGFP constructs or by coilin labeling; intensities of SART3/p110 or LSm4 were measured within the CB and divided by the CB area. Data were collected from 2050 normal-looking CBs (Fig. 6) after
-amanitin treatment and CBs in control cells, and 100160 CBs in cells expressing different SART3/p110EGFP mutants or control untransfected cells (Table I).
| Footnotes |
|---|
| Acknowledgments |
|---|
This work was supported by a Research Project grant (RPG-00-110-01-MGO) from the American Cancer Society, the Max Planck Gesellschaft, and National Institutes of Health grant GM21119. S.D. Rader was supported by a National Institutes of Health postdoctoral fellowship (grant 5 F32 GM18312) and by an American Heart Association postdoctoral fellowship.
Note added in proof. The cytoplasmic distribution of LSm proteins 17 and their colocalization with mRNA-degrading enzymes has been recently published (Ingelfinger, D., D.J. Arndt-Jovin, R. Lührmann, and T. Achsel. 2002. RNA. 8:14891501).
Submitted: 15 October 2002
Revised: 13 January 2003
Accepted: 13 January 2003
| References |
|---|
|
|
|---|
Achsel, T., H. Brahms, B. Kastner, A. Bachi, M. Wilm, and R. Luhrmann. 1999. A doughnut-shaped heteromer of human Sm-like proteins binds to the 3'-end of U6 snRNA, thereby facilitating U4/U6 duplex formation in vitro. EMBO J. 18:57895802.[CrossRef][Medline]
Almeida, F., R. Saffrich, W. Ansorge, and M. Carmo-Fonseca. 1998. Microinjection of anti-coilin antibodies affects the structure of coiled bodies. J. Cell Biol. 142:899912.
Andersen, J.S., C.E. Lyon, A.H. Fox, A.K. Leung, Y.W. Lam, H. Steen, M. Mann, and A.I. Lamond. 2002. Directed proteomic analysis of the human nucleolus. Curr. Biol. 12:111.[CrossRef][Medline]
Andrade, L.E., E.K. Chan, I. Raska, C.L. Peebles, G. Roos, and E.M. Tan. 1991. Human autoantibody to a novel protein of the nuclear coiled body: immunological characterization and cDNA cloning of p80-coilin. J. Exp. Med. 173:14071419.
Bauer, D.W., C. Murphy, Z. Wu, C.H. Wu, and J.G. Gall. 1994. In vitro assembly of coiled bodies in Xenopus egg extract. Mol. Biol. Cell. 5:633644.[Abstract]
Bell, M., S. Schreiner, A. Damianov, R. Reddy, and A. Bindereif. 2002. p110, a novel human U6 snRNP protein and U4/U6 snRNP recycling factor. EMBO J. 21:27242735.[CrossRef][Medline]
Blencowe, B.J., M. Carmo-Fonseca, S.E. Behrens, R. Luhrmann, and A.I. Lamond. 1993. Interaction of the human autoantigen p150 with splicing snRNPs. J. Cell Sci. 105:685697.[Abstract]
Boudonck, K., L. Dolan, and P.J. Shaw. 1998. Coiled body numbers in the Arabidopsis root epidermis are regulated by cell type, developmental stage and cell cycle parameters. J. Cell Sci. 111:36873694.[Medline]
Bouveret, E., G. Rigaut, A. Shevchenko, M. Wilm, and B. Seraphin. 2000. An Sm-like protein complex that participates in mRNA degradation. EMBO J. 19:16611671.[CrossRef][Medline]
Carmo-Fonseca, M. 2002. New clues to the function of the Cajal body. EMBO Rep. 3:726727.[CrossRef][Medline]
Carmo-Fonseca, M., R. Pepperkok, B.S. Sproat, W. Ansorge, M.S. Swanson, and A.I. Lamond. 1991. In vivo detection of snRNP-rich organelles in the nuclei of mammalian cells. EMBO J. 10:18631873.[Medline]
Carmo-Fonseca, M., R. Pepperkok, M.T. Carvalho, and A.I. Lamond. 1992. Transcription-dependent colocalization of the U1, U2, U4/U6, and U5 snRNPs in coiled bodies. J. Cell Biol. 117:114.
Carvalho, T., F. Almeida, A. Calapez, M. Lafarga, M.T. Berciano, and M. Carmo-Fonseca. 1999. The spinal muscular atrophy disease gene product, SMN: a link between snRNP biogenesis and the Cajal (coiled) body. J. Cell Biol. 147:715728.
Darzacq, X., B.E. Jady, C. Verheggen, A.M. Kiss, E. Bertrand, and T. Kiss. 2002. Cajal body-specific small nuclear RNAs: a novel class of 2'-O-methylation and pseudouridylation guide RNAs. EMBO J. 21:27462756.[CrossRef][Medline]
Dundr, M., and T. Misteli. 2002. Nucleolomics: an inventory of the nucleolus. Mol. Cell. 9:57.[CrossRef][Medline]
Fischer, U., Q. Liu, and G. Dreyfuss. 1997. The SMN-SIP1 complex has an essential role in spliceosomal snRNP biogenesis. Cell. 90:10231029.[CrossRef][Medline]
Frey, M.R., A.D. Bailey, A.M. Weiner, and A.G. Matera. 1999. Association of snRNA genes with coiled bodies is mediated by nascent snRNA transcripts. Curr. Biol. 9:126135.[CrossRef][Medline]
Fromont-Racine, M., A.E. Mayes, A. Brunet-Simon, J.C. Rain, A. Colley, I. Dix, L. Decourty, N. Joly, F. Ricard, J.D. Beggs, and P. Legrain. 2000. Genome-wide protein interaction screens reveal functional networks involving Sm-like proteins. Yeast. 17:95110.[CrossRef][Medline]
Fu, X.D., and T. Maniatis. 1990. Factor required for mammalian spliceosome assembly is localized to discrete regions in the nucleus. Nature. 343:437441.[CrossRef][Medline]
Gall, J.G. 2000. Cajal bodies: the first 100 years. Annu. Rev. Cell Dev. Biol. 16:273300.[CrossRef][Medline]
Gall, J.G., M. Bellini, Z. Wu, and C. Murphy. 1999. Assembly of the nuclear transcription and processing machinery: Cajal bodies (coiled bodies) and transcriptosomes. Mol. Biol. Cell. 10:43854402.
Ganot, P., B.E. Jady, M.L. Bortolin, X. Darzacq, and T. Kiss. 1999. Nucleolar factors direct the 2'-O-ribose methylation and pseudouridylation of U6 spliceosomal RNA. Mol. Cell. Biol. 19:69066917.
Gottschalk, A., G. Neubauer, J. Banroques, M. Mann, R. Luhrmann, and P. Fabrizio. 1999. Identification by mass spectrometry and functional analysis of novel proteins of the yeast [U4/U6.U5] tri-snRNP. EMBO J. 18:45354548.[CrossRef][Medline]
Gu, J., S. Shimba, N. Nomura, and R. Reddy. 1998. Isolation and characterization of a new 110 kDa human nuclear RNA- binding protein (p110nrb). Biochim. Biophys. Acta. 1399:19.[Medline]
Haaf, T., and D.C. Ward. 1996. Inhibition of RNA polymerase II transcription causes chromatin decondensation, loss of nucleolar structure, and dispersion of chromosomal domains. Exp. Cell Res. 224:163173.[CrossRef][Medline]
Hamm, J., E. Darzynkiewicz, S.M. Tahara, and I.W. Mattaj. 1990. The trimethylguanosine cap structure of U1 snRNA is a component of a bipartite nuclear targeting signal. Cell. 62:569577.[CrossRef][Medline]
Harada, K., A. Yamada, D. Yang, K. Itoh, and S. Shichijo. 2001. Binding of a SART3 tumor-rejection antigen to a pre-mRNA splicing factor RNPS1: a possible regulation of splicing by a complex formation. Int. J. Cancer. 93:623628.[CrossRef][Medline]
Kiss, A.M., B.E. Jady, X. Darzacq, C. Verheggen, E. Bertrand, and T. Kiss. 2002. A Cajal body-specific pseudouridylation guide RNA is composed of two box H/ACA snoRNA-like domains. Nucleic Acids Res. 30:46434649.
Kiss, T. 2002. Small nucleolar RNAs: an abundant group of noncoding RNAs with diverse cellular functions. Cell. 109:145148.[CrossRef][Medline]
Lam, Y.W., C.E. Lyon, and A.I. Lamond. 2002. Large-scale isolation of cajal bodies from HeLa cells. Mol. Biol. Cell. 13:24612473.
Lange, T.S., and S.A. Gerbi. 2000. Transient nucleolar localization Of U6 small nuclear RNA in Xenopus laevis oocytes. Mol. Biol. Cell. 11:24192428.
Liu, Q., and G. Dreyfuss. 1996. A novel nuclear structure containing the survival of motor neurons protein. EMBO J. 15:35553565.[Medline]
Liu, Y., J. Li, B.O. Kim, B.S. Pace, and J.J. He. 2002. HIV-1 Tat protein-mediated transactivation of the HIV-1 long terminal repeat promoter is potentiated by a novel nuclear Tat-interacting protein of 110 kDa, Tip110. J. Biol. Chem. 277:2385423863.
Makarova, O.V., E.M. Makarov, S. Liu, H.P. Vornlocher, and R. Luhrmann. 2002. Protein 61K, encoded by a gene (PRPF31) linked to autosomal dominant retinitis pigmentosa, is required for U4/U6*U5 tri-snRNP formation and pre-mRNA splicing. EMBO J. 21:11481157.[CrossRef][Medline]
Massenet, S., L. Pellizzoni, S. Paushkin, I.W. Mattaj, and G. Dreyfuss. 2002. The SMN complex is associated with snRNPs throughout their cytoplasmic assembly pathway. Mol. Cell. Biol. 22:65336541.
Matera, A.G. 1999. Nuclear bodies: multifaceted subdomains of the interchromatin space. Trends Cell Biol. 9:302309.[CrossRef][Medline]
Matera, A.G., and D.C. Ward. 1993. Nucleoplasmic organization of small nuclear ribonucleoproteins in cultured human cells. J. Cell Biol. 121:715727.
Mayes, A.E., L. Verdone, P. Legrain, and J.D. Beggs. 1999. Characterization of Sm-like proteins in yeast and their association with U6 snRNA. EMBO J. 18:43214331.[CrossRef][Medline]
Mintz, P.J., S.D. Patterson, A.F. Neuwald, C.S. Spahr, and D.L. Spector. 1999. Purification and biochemical characterization of interchromatin granule clusters. EMBO J. 18:43084320.[CrossRef][Medline]
Neugebauer, K.M. 2002. On the importance of being co-transcriptional. J. Cell Sci. 115:38653871.
Neugebauer, K.M., and M.B. Roth. 1997. Distribution of pre-mRNA splicing factors at sites of RNA polymerase II transcription. Genes Dev. 11:11481159.
Ogg, S.C., and A.I. Lamond. 2002. Cajal bodies and coilinmoving towards function. J. Cell Biol. 159:1721.
Paushkin, S., A.K. Gubitz, S. Massenet, and G. Dreyfuss. 2002. The SMN complex, an assemblyosome of ribonucleoproteins. Curr. Opin. Cell Biol. 14:305312.[CrossRef][Medline]
Pellizzoni, L., N. Kataoka, B. Charroux, and G. Dreyfuss. 1998. A novel function for SMN, the spinal muscular atrophy disease gene product, in pre-mRNA splicing. Cell. 95:615624.[CrossRef][Medline]
Pellizzoni, L., B. Charroux, J. Rappsilber, M. Mann, and G. Dreyfuss. 2001. A functional interaction between the survival motor neuron complex and RNA polymerase II. J. Cell Biol. 152:7585.
Pena, E., M.T. Berciano, R. Fernandez, J.L. Ojeda, and M. Lafarga. 2001. Neuronal body size correlates with the number of nucleoli and Cajal bodies, and with the organization of the splicing machinery in rat trigeminal ganglion neurons. J. Comp. Neurol. 430:250263.[CrossRef][Medline]
Preker, P.J., and W. Keller. 1998. The HAT helix, a repetitive motif implicated in RNA processing. Trends Biochem. Sci. 23:1516.[CrossRef][Medline]
Rader, S.D., and C. Guthrie. 2002. A conserved Lsm-interaction motif in Prp24 required for efficient U4/U6 di-snRNP formation. RNA. 8:13781392.[Abstract]
Raghunathan, P.L., and C. Guthrie. 1998. A spliceosomal recycling factor that reanneals U4 and U6 small nuclear ribonucleoprotein particles. Science. 279:857860.
Rappsilber, J., U. Ryder, A.I. Lamond, and M. Mann. 2002. Large-scale proteomic analysis of the human spliceosome. Genome Res. 12:12311245.
Raska, I., R.L. Ochs, L.E. Andrade, E.K. Chan, R. Burlingame, C. Peebles, D. Gruol, and E.M. Tan. 1990. Association between the nucleolus and the coiled body. J. Struct. Biol. 104:120127.[CrossRef][Medline]
Raska, I., L.E. Andrade, R.L. Ochs, E.K. Chan, C.M. Chang, G. Roos, and E.M. Tan. 1991. Immunological and ultrastructural studies of the nuclear coiled body with autoimmune antibodies. Exp. Cell Res. 195:2737.[CrossRef][Medline]
Ryan, D.E., S.W. Stevens, and J. Abelson. 2002. The 5' and 3' domains of yeast U6 snRNA: Lsm proteins facilitate binding of Prp24 protein to the U6 telestem region. RNA. 8:10111033.[Abstract]
Salgado-Garrido, J., E. Bragado-Nilsson, S. Kandels-Lewis, and B. Seraphin. 1999. Sm and Sm-like proteins assemble in two related complexes of deep evolutionary origin. EMBO J. 18:34513462.[CrossRef][Medline]
Schneider, C., C.L. Will, O.V. Makarova, E.M. Makarov, and R. Luhrmann. 2002. Human U4/U6.U5 and U4atac/U6atac.U5 tri-snRNPs exhibit similar protein compositions. Mol. Cell. Biol. 22:32193229.
Seraphin, B. 1995. Sm and Sm-like proteins belong to a large family: identification of proteins of the U6 as well as the U1, U2, U4 and U5 snRNPs. EMBO J. 14:20892098.[Medline]
Shannon, K.W., and C. Guthrie. 1991. Suppressors of a U4 snRNA mutation define a novel U6 snRNP protein with RNA-binding motifs. Genes Dev. 5:773785.
Sleeman, J.E., and A.I. Lamond. 1999. Newly assembled snRNPs associate with coiled bodies before speckles, suggesting a nuclear snRNP maturation pathway. Curr. Biol. 9:10651074.[CrossRef][Medline]
Sleeman, J.E., P. Ajuh, and A.I. Lamond. 2001. snRNP protein expression enhances the formation of Cajal bodies containing p80-coilin and SMN. J. Cell Sci. 114:44074419.[Medline]
Staley, J.P., and C. Guthrie. 1998. Mechanical devices of the spliceosome: motors, clocks, springs, and things. Cell. 92:315326.[CrossRef][Medline]
Tharun, S., W. He, A.E. Mayes, P. Lennertz, J.D. Beggs, and R. Parker. 2000. Yeast Sm-like proteins function in mRNA decapping and decay. Nature. 404:515518.[CrossRef][Medline]
Tomasevic, N., and B.A. Peculis. 2002. Xenopus LSm proteins bind U8 snoRNA via an internal evolutionarily conserved octamer sequence. Mol. Cell. Biol. 22:41014112.
Tucker, K.E., M.T. Berciano, E.Y. Jacobs, D.F. LePage, K.B. Shpargel, J.J. Rossire, E.K. Chan, M. Lafarga, R.A. Conlon, and A.G. Matera. 2001. Residual Cajal bodies in coilin knockout mice fail to recruit Sm snRNPs and SMN, the spinal muscular atrophy gene product. J. Cell Biol. 154:293307.
Tuma, R.S., J.A. Stolk, and M.B. Roth. 1993. Identification and characterization of a sphere organelle protein. J. Cell Biol. 122:767773.
Tycowski, K.T., Z.H. You, P.J. Graham, and J.A. Steitz. 1998. Modification of U6 spliceosomal RNA is guided by other small RNAs. Mol. Cell. 2:629638.[CrossRef][Medline]
Vidal, V.P., L. Verdone, A.E. Mayes, and J.D. Beggs. 1999. Characterization of U6 snRNA-protein interactions. RNA. 5:14701481.[Abstract]
Wansink, D.G., W. Schul, I. van der Kraan, B. van Steensel, R. van Driel, and L. de Jong. 1993. Fluorescent labeling of nascent RNA reveals transcription by RNA polymerase II in domains scattered throughout the nucleus. J. Cell Biol. 122:283293.
Will, C.L., and R. Luhrmann. 2001. Spliceosomal UsnRNP biogenesis, structure and function. Curr. Opin. Cell Biol. 13:290301.[CrossRef][Medline]
Yang, J.M., S.J. Baserga, S.J. Turley, and K.M. Pollard. 2001. Fibrillarin and other snoRNP proteins are targets of autoantibodies in xenobiotic-induced autoimmunity. Clin. Immunol. 101:3850.[CrossRef][Medline]
Young, P.J., T.T. Le, N. thi Man, A.H. Burghes, and G.E. Morris. 2000. The relationship between SMN, the spinal muscular atrophy protein, and nuclear coiled bodies in differentiated tissues and cultured cells. Exp. Cell Res. 256:365374.[CrossRef][Medline]
Zhou, Z., L.J. Licklider, S.P. Gygi, and R. Reed. 2002. Comprehensive proteomic analysis of the human spliceosome. Nature. 419:182185.[CrossRef][Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|