|
||
© The Rockefeller University Press,
0021-9525/2003/4/21 $5.00
The Journal of Cell Biology, Volume 161, Number 1, 21-26
Report |
Myosin and the PAR proteins polarize microfilament-dependent forces that shape and position mitotic spindles in Caenorhabditis elegans
Address correspondence to Bruce Bowerman, Institute of Molecular Biology, 1370 Franklin Blvd., University of Oregon, Eugene, OR 97403-1229. Tel.: (541) 346-0853. Fax: (541) 346-5891. E-mail: bbowerman{at}molbio.uoregon.edu
| Abstract |
|---|
|
|
|---|
In Caenorhabditis elegans, the partitioning proteins (PARs), microfilaments (MFs), dynein, dynactin, and a nonmuscle myosin II all localize to the cortex of early embryonic cells. Both the PARs and the actomyosin cytoskeleton are required to polarize the anterior-posterior (a-p) body axis in one-cell zygotes, but it remains unknown how MFs influence embryonic polarity. Here we show that MFs are required for the cortical localization of PAR-2 and PAR-3. Furthermore, we show that PAR polarity regulates MF-dependent cortical forces applied to astral microtubules (MTs). These forces, which appear to be mediated by dynein and dynactin, produce changes in the shape and orientation of mitotic spindles. Unlike MFs, dynein, and dynactin, myosin II is not required for the production of these forces. Instead, myosin influences embryonic polarity by limiting PAR-3 to the anterior cortex. This in turn produces asymmetry in the forces applied to MTs at each pole and allows PAR-2 to accumulate in the posterior cortex of a one-cell zygote and maintain asymmetry.
Key Words: dynein ATPase; microfilaments; myosin type II; mitotic spindle apparatus; cell polarity
| Introduction |
|---|
|
|
|---|
|
| Results and discussion |
|---|
|
|
|---|
Centrosome flattening requires microfilaments
Disruption of MF assembly results in a-p polarity defects similar to those caused by mutations in par-2. In wild-type embryos treated with cytochalasin D (Hill and Strome, 1988) or latrunculin A (LatA; Fig. 2 c; eight out of nine embryos), neither centrosome flattened. The failure of either pole to flatten could result from mislocalized PAR-3 inhibiting flattening at both poles as in par-2 mutants (Cheng et al., 1995). Moreover, MFs might be required for cortical localization of the PAR proteins, with such localization being important for their function. Therefore, we examined the localization of PAR-2 and PAR-3 in embryos exposed to LatA. We found that PAR-2 and PAR-3 both require intact MFs to localize to the cortex. Both were undetectable at the cortex, or present at severely reduced levels, in the presence of LatA (Fig. 2, a and b; n
5 for each; see Materials and methods). PAR-2 accumulated around the centrosomes of LatA-treated embryos as was observed recently in pod mutants with defects in a-p polarity (Rappleye et al., 2002). We also examined centrosome flattening and PAR localization in embryos with reduced levels of the profilin PFN-1, which we have recently shown is required for the assembly of cortical MFs (Severson et al., 2002) (Fig. 2 g). Consistent with our findings in LatA-treated embryos, the posterior centrosome failed to flatten in embryos depleted of PFN-1 using dsRNA-mediated gene silencing, or RNAi (Fig. 2 g), and PAR-2 was undetectable at the cortex but instead localized around centrosomes (Fig. 2 f; 10 out of 12 embryos). Although PAR-3 was always detected at the cortex in PFN-1depleted embryos, it was present at much reduced levels compared with wild-type embryos fixed on the same slides (Fig. 2 e; six out of six embryos). The remaining cortical PAR-3 may simply reflect residual MF assembly because low levels of cortical F-actin still assemble in embryos with reduced levels of profilin (Severson et al., 2002). We conclude that centrosome flattening and the cortical localization of PAR-2 and PAR-3 all require an intact MF cytoskeleton.
|
We also tested whether MFs are required for spindle orientation in two-cell stage embryos. In wild-type, the centrosomes of both two-cell stage blastomeres initially are aligned orthogonal to the a-p axis. During mitotic prophase, the nucleus and its associated centrosomes (nucleocentrosomal complex [NCC]) in the posterior blastomere rotate 90°. A mitotic spindle subsequently assembles parallel to the a-p axis in this cell, whereas the spindle in the anterior cell remains transverse (Hyman and White, 1987) (Fig. 2 i). In par-3 mutants, both NCCs rotate (Fig. 2 k; eight out of ten embryos), whereas both remain transverse in par-2 mutants (Kemphues et al., 1988). However, both rotate in par-2 par-3 double mutant embryos, indicating that neither PAR protein is required for NCC rotation (Cheng et al., 1995). As shown previously in experiments using cytochalasin D (Hyman and White, 1987), we observed that the posterior NCC failed to rotate in wild-type two-cell stage embryos treated with LatA (Fig. 2 j; n = 6; see Materials and methods). Similarly, both NCCs failed to rotate in two-cell stage par-3 mutant embryos exposed to LatA (Fig. 2 l, n = 6). Thus, MFs mediate changes both in spindle pole shape at the one-cell stage and in spindle orientation at the two-cell stage, with PAR-2 and PAR-3 regulating where these changes occur.
Myosin II is not required for centrosome flattening
We next examined how myosin II influences the MF-dependent forces that flatten spindle poles. Depletion of the nonmuscle myosin II heavy chain (NMY)-2 or of the myosin II regulatory light chain (MLC)-4 (Guo and Kemphues, 1996; Shelton et al., 1999) results in embryonic polarity defects similar to those in LatA-treated embryos: the first mitotic spindle remains centrally positioned and both spindle poles remain spherical (Fig. 3, b and f). However, one difference is that PAR-3 accumulates around both the anterior and posterior cortex in embryos depleted of either myosin II subunit (Guo and Kemphues, 1996; Shelton et al., 1999), whereas PAR-3 is not present at the cortex in LatA-treated embryos (see above). In contrast to PAR-3, PAR-2 was usually present in a reduced cortical patch in mutant embryos depleted of NMY-2 or MLC-4, (Fig. 3, a and e; five out of eight nmy-2 and six out of eight mlc-4 embryos) or was undetectable at the cortex (three out of eight nmy-2 and two out of eight mlc-4 mutants) (Shelton et al., 1999). Thus, unlike MFs, neither NMY-2 nor MLC-4 are required for PAR-3 to associate with the cortex, but they are required for the polarized distribution of cortical PAR-3 and for the posterior cortical localization of PAR-2.
|
Myosin II restricts PAR-3 to the anterior cortex
As described above, PAR-3 accumulates around the cortex of myosin-depleted embryos, whereas PAR-2 and PAR-3 localize in mutually exclusive cortical domains in wild-type zygotes. Myosin II could influence the localization of PAR-2 and PAR-3 by facilitating expansion of the PAR-2 domain, thereby restricting PAR-3 to the anterior cortex. Alternatively, myosin might limit PAR-3 localization to the anterior hemisphere, thus permitting expansion of the PAR-2 domain. To distinguish between these two models, we examined the localization of PAR-2 in NMY-2depleted and in MLC-4depleted par-3 mutant embryos. In both cases, we found that PAR-2 was present throughout the cortex, suggesting that neither myosin II subunit is required for cortical localization or expansion of PAR-2 (Fig. 3, c and g; n
5 for each double mutant). Instead, myosin appears to restrict PAR-3 to the anterior, with ectopic PAR-3 preventing PAR-2 accumulation at the cortex in myosin IIdepleted embryos.
Centrosome flattening requires dynein and dynactin
The results described above suggest that MFs either recruit or activate a cortical motor protein that pulls on astral MTs to influence the shape and position of mitotic spindles. Both the dynactin complex and the minus enddirected MT motor dynein localize to the cortex of early embryos, and spindle rotation fails in two-cell stage embryos in which the dyneindynactin complex has been partially depleted by RNA interference (Skop and White, 1998; Gönczy et al., 1999). Further reducing dyneindynactin function disrupts pronuclear migration and the assembly and orientation of the first mitotic spindle (Gönczy et al., 1999). To determine whether dynein and dynactin are required for centrosome flattening in one-cell stage embryos, we partially depleted either the dynein heavy chain DHC-1 or a C. elegans orthologue of the dynactin component p150glued DNC-1 (see Materials and methods). The posterior centrosome remained spherical in all DNC-1depleted embryos in which the first mitotic spindle rotated to lie along the a-p axis (Fig. 4 b; n = 9). Similarly, we observed spherical centrosomes in some DHC-1depleted embryos (Fig. 4 c; 4 out of 20 embryos; 4 embryos exhibited defects in chromosome segregation and in centrosome flattening, whereas 16 embryos appeared wild type during the first mitotic division). Exposure of embryos to low doses of nocodazole that shorten but do not eliminate MTs also disrupted centrosome flattening (Fig. 4 d; five out of seven embryos). We conclude that both dynein function and contact between astral MTs and the cortex are required for centrosome flattening.
|
|
Recently, two models have been proposed to explain the establishment of asymmetry in the forces that position mitotic spindles in C. elegans zygotes. First, a DEP domain protein called LET-99 accumulates in a cortical stripe that is displaced toward the posterior pole, and high levels of LET-99 have been proposed to attenuate dynein-dependent forces applied to astral MTs that contact the cell cortex (Tsou et al., 2002). Properly positioned lateral attenuation would lower forces that normally oppose those applied to the spindle pole from the posterior-most cortex, producing a greater net force toward the posterior (see Fig. 7 in Tsou et al., 2002).
Alternatively, it has been suggested that MFs are unlikely to be involved in generating the cortical forces that act on spindle poles (Hill and Strome, 1988; Grill et al., 2001). This conclusion is based on experiments in which brief pulses of cytochalasin D, applied and washed out before anaphase, were sufficient to prevent posterior displacement of the first mitotic spindle during anaphase. Furthermore, cytochalasin D pulses applied during anaphase did not prevent posterior displacement (Hill and Strome, 1988). These findings suggest that MFs are not directly required for posterior displacement of the first mitotic spindle. Grill et al. (2001) therefore suggested that increased astral MT instability associated with the posterior cortex might account for the greater net posterior force. For example, such instability might facilitate pulling of the spindle pole toward the posterior cortex as astral MTs shorten.
Our findings support a role for MFs and the dyneindynactin motor complex in applying forces to spindle poles via astral MTs that contact the cell cortex. It is possible that the pulses of cytochalasin D used by Hill and Strome (1988) were sufficient to disrupt some aspects of polarity but not to disrupt dyneindynactin-mediated application of forces to astral MTs. Alternatively, cytochalasin D pulses may fully disrupt MF function, but two different force mechanisms could operate during spindle positioning. MT instability might account for posterior displacement, with dyneindynactin forces generating only lateral rocking and flattening of the posterior spindle pole. In support of this possibility, we sometimes observed an absence of spindle pole flattening even though the spindle was displaced normally toward the posterior pole (Fig. 4). MF function is not limited to spindle flattening and rocking though, because MFs, dynein, and dynactin also are required for spindle rotation at the two-cell stage in wild-type and par-3 mutant embryos. Finally, MT asters undergo abnormal lateral rocking movements early in mitosis in one-cell let-99 mutant embryos, and this abnormal rocking also requires dhc-1 (Tsou et al., 2002). We conclude that dyneindynactin-mediated forces exert an extensive influence on mitotic spindle positioning in early C. elegans embryos.
| Materials and methods |
|---|
|
|
|---|
Immunofluorescence and microscopy
Embryos were fixed and stained as described (Severson et al., 2000). Antibodies were diluted in PBS containing 3% BSA as follows: PAR-2, 1:20; PAR-3, 1:10; SPD-5, 1:1,000; and antiactin (ICN), 1:100. DNA was labeled with a 10-min incubation in 0.2 µM TOTO-3 (Molecular Probes). Images were acquired using a Radiance laser-scanning confocal microscope (Bio-Rad Laboratories). For observations of centrosome shape following dhc-1(RNAi), dnc-1(RNAi), and nocodazole treatment, embryos expressing a histoneGFP and a ß-tubulinGFP fusion (Praitis et al., 2001) were mounted on a 4% agarose cushion and observed using a spinning disc confocal microscope (PerkinElmer).
LatA and nocodazole exposure
For LatA treatment, embryos were permeabilized by laser ablation of the eggshell (Severson et al., 2002) or by gentle pressure (Hill and Strome, 1988). Embryos were permeabilized during pronuclear migration for observations of centrosome flattening or after the completion of cytokinesis I for observations of spindle orientation in two-cell embryos. Embryos were incubated for at least 10 min in culture medium containing 100 µM LatA (prepared from a 10 mM stock in DMSO) or in DMSO as a control and then observed by Nomarski microscopy or fixed and processed for immunocytochemistry. Centrosome flattening, spindle orientation, and PAR localization were normal in DMSO-treated embryos, and cell cycle progression continued normally in both LatA- and DMSO-treated embryos. For nocodazole treatment, prepronuclear migration stage embryos were mounted on a 4% agarose cushion under a coverslip and then bathed in 20 µg/ml nocodazole in M9 prepared from a 1 mg/ml stock solution in DMSO.
RNAi
Double stranded RNA was prepared and injected by standard methods (Fire et al., 1998). The following cDNA clones were used as templates: mlc-4, yk167f10; nmy-2, yk45d7; and pfn-1, yk402e3. Sequences corresponding to dhc-1 and dnc-1 were amplified from genomic DNA using the following primers: dhc-1: aaggaaggagctcaacgaca, cctttccttcctgggtcttc; and dnc-1: tcatcgaatccttccgtttc, gaagcacgcggttgatttat. PCR products were cloned into PCRII-TOPO (Invitrogen), and single stranded RNA was transcribed with T7 polymerase, injected at a concentration of 1 mg/ml, and embryos were analyzed 1820 h postinjection.
| Acknowledgments |
|---|
A.F. Severson and B. Bowerman were funded by the National Institutes of Health (R01GM049869).
Submitted: 30 October 2002
Revised: 28 February 2003
Accepted: 28 February 2003
| References |
|---|
|
|
|---|
Boyd, L., S. Guo, D. Levitan, D.T. Stinchcomb, and K.J. Kemphues. 1996. PAR-2 is asymmetrically distributed and promotes association of P granules and PAR-1 with the cortex in C. elegans embryos. Development. 122:30753084.[Abstract]
Brenner, S. 1974. The genetics of Caenorhabditis elegans. Genetics. 77:7194.
Doe, C.Q., and B. Bowerman. 2001. Asymmetric cell division: fly neuroblast meets worm zygote. Curr. Opin. Cell Biol. 13:6875.[CrossRef][Medline]
Cheng, N.N., C.M. Kirby, and K.J. Kemphues. 1995. Control of cleavage spindle orientation in Caenorhabditis elegans: the role of the genes par-2 and par-3. Genetics. 139:549559.[Abstract]
Etemad-Moghadam, B., S. Guo, and K.J. Kemphues. 1995. Asymmetrically distributed PAR-3 protein contributes to cell polarity and spindle alignment in early C. elegans embryos. Cell. 83:743752.[CrossRef][Medline]
Fire, A., S. Xu, M.K. Montgomery, S.A. Kostas, S.E. Driver, and C.C. Mello. 1998. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391:806811.[CrossRef][Medline]
Gönczy, P., S. Pichler, M. Kirkham, and A.A. Hyman. 1999. Cytoplasmic dynein is required for distinct aspects of MTOC positioning, including centrosome separation, in the one cell stage Caenorhabditis elegans embryo. J. Cell Biol. 147:135150.
Grill, S.W., P. Gönczy, E.H. Stelzer, and A.A. Hyman. 2001. Polarity controls forces governing asymmetric spindle positioning in the Caenorhabditis elegans embryo. Nature. 409:630633.[CrossRef][Medline]
Guo, S., and K.J. Kemphues. 1996. A non-muscle myosin required for embryonic polarity in Caenorhabditis elegans. Nature. 382:455458.[CrossRef][Medline]
Hamill, D.R., A.F. Severson, J.C. Carter, and B. Bowerman. 2002. Centrosome maturation and mitotic spindle assembly in C. elegans require SPD-5, a protein with multiple coiled-coil domains. Dev. Cell. 3:673684.[CrossRef][Medline]
Hill, D.P., and S. Strome. 1988. An analysis of the role of microfilaments in the establishment and maintenance of asymmetry in Caenorhabditis elegans zygotes. Dev. Biol. 125:7584.[CrossRef][Medline]
Hyman, A.A., and J.G. White. 1987. Determination of cell division axes in the early embryogenesis of Caenorhabditis elegans. J. Cell Biol. 105:21232135.
Keating, H.H., and J.G. White. 1998. Centrosome dynamics in early embryos of Caenorhabditis elegans. J. Cell Sci. 111:30273033.[Abstract]
Kemphues, K.J., J.R. Priess, D.G. Morton, and N.S. Cheng. 1988. Identification of genes required for cytoplasmic localization in early C. elegans embryos. Cell. 52:311320.[CrossRef][Medline]
Praitis, V., E. Casey, D. Collar, and J. Austin. 2001. Creation of low-copy integrated transgenic lines in Caenorhabditis elegans. Genetics. 157:12171226.
Rappleye, C.A., A. Tagawa, R. Lyczak, B. Bowerman, and R.V. Aroian. 2002. The anaphase-promoting complex and separin are required for embryonic anterior-posterior axis formation. Dev. Cell. 2:195206.[CrossRef][Medline]
Severson, A.F., D.R. Hamill, J.C. Carter, J. Schumacher, and B. Bowerman. 2000. The aurora-related kinase AIR-2 recruits ZEN-4/CeMKLP1 to the mitotic spindle at metaphase and is required for cytokinesis. Curr. Biol. 10:11621171.[CrossRef][Medline]
Severson, A.F., D.L. Baillie, and B. Bowerman. 2002. A formin homology protein and a profilin are required for cytokinesis and Arp2/3-independent assembly of cortical microfilaments in the early Caenorhabditis elegans embryo. Curr. Biol. 12:20662075.[CrossRef][Medline]
Shelton, C.A., J.C. Carter, G.C. Ellis, and B. Bowerman. 1999. The nonmuscle myosin regulatory light chain gene mlc-4 is required for cytokinesis, anterior-posterior polarity, and body morphology during Caenorhabditis elegans embryogenesis. J. Cell Biol. 146:439451.[CrossRef][Medline]
Skop, A.R., and J.G. White. 1998. The dynactin complex is required for cleavage plane specification in early Caenorhabditis elegans embryos. Curr. Biol. 8:11101116.[CrossRef][Medline]
Tsou, M.F., A. Hayashi, L.R. DeBella, G. McGrath, and L.S. Rose. 2002. LET-99 determines spindle position and is asymmetrically enriched in response to PAR polarity cues in C. elegans embryos. Development. 129:44694481.
Wodarz, A. 2002. Establishing cell polarity in development. Nat. Cell Biol. 4:E39E44.[CrossRef][Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|