JCB logo
amgmicro.com
  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

Published 21 July 2003. doi:10.1083/jcb.200212004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 185K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JCB
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bayer, M. J.
Right arrow Articles by Mayer, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bayer, M. J.
Right arrow Articles by Mayer, A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

© The Rockefeller University Press, 0021-9525/2003/7/211 $5.00
The Journal of Cell Biology, Volume 162, Number 2, 211-222


Article

Vacuole membrane fusion

: V0 functions after trans-SNARE pairing and is coupled to the Ca2+-releasing channel



Martin J. Bayer, Christoph Reese, Susanne Bühler, Christopher Peters and Andreas Mayer

Friedrich-Miescher-Laboratorium der Max-Planck-Gesellschaft, 72076 Tübingen, Germany

Address correspondence to Andreas Mayer, Friedrich-Miescher-Laboratorium der Max-Planck-Gesellschaft, Spemannstr. 37-39, 72076 Tübingen, Germany. Tel.: 49-7071-601850. Fax: 49-7071-601455. E-mail: Andreas.Mayer{at}Tuebingen.mpg.de


   Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 

Pore models of membrane fusion postulate that cylinders of integral membrane proteins can initiate a fusion pore after conformational rearrangement of pore subunits. In the fusion of yeast vacuoles, V-ATPase V0 sectors, which contain a central cylinder of membrane integral proteolipid subunits, associate to form a transcomplex that might resemble an intermediate postulated in some pore models. We tested the role of V0 sectors in vacuole fusion. V0 functions in fusion and proton translocation could be experimentally separated via the differential effects of mutations and inhibitory antibodies. Inactivation of the V0 subunit Vph1p blocked fusion in the terminal reaction stage that is independent of a proton gradient. {Delta}vph1 mutants were capable of docking and trans-SNARE pairing and of subsequent release of lumenal Ca2+, but they did not fuse. The Ca2+-releasing channel appears to be tightly coupled to V0 because inactivation of Vph1p by antibodies blocked Ca2+ release. Vph1 deletion on only one fusion partner sufficed to severely reduce fusion activity. The functional requirement for Vph1p correlates to V0 transcomplex formation in that both occur after docking and Ca2+ release. These observations establish V0 as a crucial factor in vacuole fusion acting downstream of trans-SNARE pairing.

Key Words: membrane fusion; vacuoles; SNAREs; V-ATPase; calcium


M.J. Bayer, C. Reese, and S. Bühler contributed equally to this paper.

* Abbreviations used in this paper: BCECF, 2'7'-bis-(2-carboxyethyl)-5-(and 6)-carboxyfluorescein; FCCP, carbonylcyanide-4-trifluormethoxyphenylhydrazon; pmf, proton motive force. Back


   Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
The fusion of intracellular membranes depends on a proteinaceous machinery which has been partially conserved in evolution. Homologous components act on different stations of membrane traffic in the secretory and endocytic pathways (Gotte et al., 2000; Chen and Scheller, 2001; Pelham, 2001). This led to the suggestion that all intracellular fusion reactions of eukaryotic cells might follow a universal reaction mechanism implemented by variations of the same core machinery, the SNARE proteins (Rothman, 1994). After activation by the ATPase Sec18p/NSF, cognate SNAREs from opposing membranes can form transcomplexes which are believed to force the membranes into close apposition and cause fusion. In line with this proposal, a basal fusion activity of SNAREs could be reconstituted from purified components inserted into liposomes (Weber et al., 1998).

The fusion of vacuoles from the yeast Saccharomyces cerevisiae shares many key features with other fusion reactions (Mayer, 2001). Thus, it can serve to test hypotheses about the fusion mechanism and about the role of specific conserved components. Vacuole fusion depends on the activation of t- and v-SNAREs by the ATPase Sec18p/NSF and its cofactor Sec17p/{alpha}-SNAP and on a Rab-GTPase, Ypt7p (Haas et al., 1995; Haas and Wickner, 1996; Mayer et al., 1996; Ungermann et al., 1999a). Ypt7p cooperates with the HOPS complex, an oligomeric assembly of tethering factors containing the class C Vps proteins (Price et al., 2000ab; Sato et al., 2000; Seals et al., 2000; Wurmser et al., 2000). During priming, ATP hydrolysis by Sec18p/NSF disrupts cis-SNARE complexes (Nichols et al., 1997; Ungermann et al., 1998a) and yields SNAREs in a labile, activated state which is stabilized by the LMA1 complex (Xu and Wickner, 1996; Slusarewicz et al., 1997; Xu et al., 1997, 1998). Priming also releases the armadillo repeat protein Vac8p from SNAREs and triggers its palmitoylation (Veit et al., 2001; Rohde et al., 2003), a modification that might be relevant to the function of Vac8p in later stages of fusion (Wang et al., 2000). Priming facilitates tethering, the initial and less stable attachment of the fusion partners that depends on Ypt7p and the HOPS complex (Mayer and Wickner, 1997; Ungermann et al., 1998b; Price et al., 2000a). Specific interactions between HOPS and SNAREs involve the NH2-terminal domain of the SNARE Vam3p (Laage and Ungermann, 2001; Wang et al., 2001a). Tethering is a prerequisite for subsequent docking, a tighter binding of vacuoles that requires SNAREs and might involve the formation of trans-SNARE complexes, i.e., complexes of cognate t- and v-SNAREs on the opposing membranes (Ungermann et al., 1998b; Laage and Ungermann, 2001). Tethering and docking are accompanied by a concentration of many fusion-relevant components around the contact zones between vacuoles (Wang et al., 2002). Trans-SNARE complexes accumulate to low abundance during the fusion reaction (Ungermann et al., 1998b; Rohde et al., 2003). An enormous advantage of the vacuole fusion system is that trans-SNARE pairing can be directly assayed as an intermediate which is well integrated into the reaction pathway, a property that distinguishes it from the other major systems used to study membrane fusion. Notably, trans-SNARE pairs between vacuoles can be disassembled after docking without blocking further progression of fusion (Ungermann et al., 1998b). This indicates that SNAREs are required at least up to the docking stage but that trans-SNARE pairing may be dispensable for completion of the reaction.

Priming and docking also show specific lipid requirements, in particular for phosphatidylinositol 4,5-bisphosphate (Mayer et al., 2000), ergosterol (Kato and Wickner, 2001), and phosphatidylinositol 3-phosphate (Cheever et al., 2001; Boeddinghaus et al., 2002). Like exocytosis (Adamo et al., 1999, 2001; Guo et al., 2001; Zhang et al., 2001), vacuole fusion requires more than one small GTPase. In addition to the Rab-GTPase Ypt7p, the Rho-GTPases Cdc42p and Rho1p are involved (Eitzen et al., 2001; Muller et al., 2001), probably by regulating the remodeling of vacuolar actin. Dynamic changes of vacuolar actin occur during fusion (Eitzen et al., 2002; Seeley et al., 2002).

Vacuole docking triggers an efflux of calcium from the lumen of the organelle which fosters the binding of calmodulin to the membranes (Peters and Mayer, 1998). Calmodulin binds to a high molecular weight complex which contains the protein phosphatase 1 Glc7p (Peters et al., 1999) and V0 sectors, the membrane integral part of the vacuolar H+-ATPase (V-ATPase). Calmodulin was also found in association with the membrane integral VTC complex (Peters et al., 2001). The VTC complex binds to the V-ATPase, is required for the priming activity of Sec18p/NSF, and influences the binding of LMA1 to the membrane (Muller et al., 2002). VTC proteins may, therefore, couple Sec18p/NSF to V0, perhaps to activate it for a potential role in fusion. This speculation appears particularly attractive because a subset of V0 sectors, which is enriched in calmodulin and in the vacuolar t-SNARE Vam3p, form transcomplexes. V0 sectors from the opposing membranes bind to each other before fusion has been completed (Peters et al., 2001). A multimeric (probably hexameric) cylinder of proteolipids is a central part of the V0 sector (Hirata et al., 1997; Powell et al., 2000). Thus, V0 transcomplexes resemble the situation postulated in some pore models of fusion (Lindau and Almers, 1995; Mayer, 2001; Zimmerberg, 2001) which suggest that continuous proteinaceous pores composed of multiple subunits could mediate membrane fusion. This could occur, for example, by radial expansion of the cylinder and partial lateral separation of their subunits (Lindau and Almers, 1995) or by conformational changes of the pore subunits, resulting in rotation or the transient shifting of hydrophobic and hydrophilic surfaces (Zimmerberg, 2001). If vacuole fusion followed this or a similar pathway, proteolipids or entire V0 sectors should act in the postdocking phase of this reaction. We have begun to test this hypothesis by manipulating different V-ATPase subunits and assaying the effects on vacuolar membrane fusion.


   Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Dissecting the role of V0 in vacuolar membrane fusion poses the problem to separate the requirement for a proton motive force (pmf)* from a direct involvement of V0 in bilayer fusion. Completion of vacuole docking and trans-SNARE pairing require a pmf (Ungermann et al., 1999b). However, full V-ATPase proton pump activity is not required because significant fusion activity remains after V-ATPase inactivation by chaotropic salts (Peters et al., 2001). This suggests that a comparably low pmf may suffice to drive fusion which could be satisfied by residual V-ATPase activity provided by a fraction of intact V-ATPases below the detection limit. More likely, however, alternative pathways create a pmf, for example, by combination of ATP-driven ion or metabolite transporters and proton-translocating antiporters. Many such transport systems exist in vacuolar membranes. In any case, the requirement for a basal pmf necessitates to test a direct involvement of V0 in bilayer fusion under conditions in which proton translocation activity of the V-ATPase is not limiting for the reaction.

We pursued in vivo and in vitro approaches to address this question. V-ATPase–deficient mutants die on neutral media and survive with slow growth on acidic media (Stevens and Forgac, 1997; Kane, 1999). Due to altered physiological properties of the cells, this complicates an in vivo analysis of vacuole structure. All deletions of core V-ATPase subunits result in this "vma phenotype," with one important exception: The a-subunit of the V-ATPase exists in two isoforms, the vacuolar isoform Vph1p and the Golgi or endosomal isoform Stv1p (Manolson et al., 1994). Both isoforms can substitute for one another in proton translocation, although they differ with respect to regulated V1/V0 dissociation that occurs upon glucose depletion (Parra and Kane, 1998; Kawasaki-Nishi et al., 2001a, b). A single deletion of either Vph1 or Stv1 does not result in the vma phenotype and permits healthy growth of the cells, also on neutral media (Manolson et al., 1994).

Deletion of the V0 subunit Vph1p results in vacuolar fusion defects
Absence of the vma phenotype makes vph1 mutants suitable for probing a role of V0 in vacuolar fusion in vivo. Mutation of fusion-relevant components frequently results in a fragmentation of vacuoles into multiple small vesicles in vivo (Raymond et al., 1992; Wada et al., 1992b). In some mutants, fragmentation does not occur, for example, after mutation of the v-SNARE Nyv1, Vtc1, or Vtc4 (Nichols et al., 1997; Muller et al., 2002). We assayed the in vivo effects of V-ATPase mutations by light microscopy after staining the vacuolar membranes with the red fluorescent vital dye FM4–64. Mutants lacking the vacuolar V0 subunit Vph1p showed numerous small vacuolar fragments which formed clusters (Fig. 1). This phenotype was observed with high frequency and resembles that of mutants in other genes with a function in the postdocking phase of vacuole fusion, such as Vtc3, Glc7 (protein phosphatase 1), calmodulin, or Vac8 (Peters and Mayer, 1998; Peters et al., 1999, 2001; Wang et al., 2001b; Muller et al., 2002). In contrast, mutation of Stv1, the Golgi/endosomal isoform of Vph1, did not result in vacuolar fragmentation (Fig. 1), nor did deletion of the V1 subunit Vma1p (unpublished data; with the strong caveat that this last mutant has the severe vma phenotype). Our results differ from those published in another study (Perzov et al., 2002) that reported vacuolar fragmentation for {Delta}stv1 cells but not for {Delta}vph1 cells. Due to this discrepancy, we generated {Delta}vph1 mutants in three independent strain backgrounds and consistently observed vacuolar fragmentation. Currently, we have no explanation for this difference. However, our results are strongly corroborated by an unbiased microscopic screen for deletion mutants showing vacuolar fragmentation (Seeley et al., 2002). This genome wide screen identified mutants in four out of five Vo subunits as defective in vacuolar morphology, reporting a particularly strong phenotype for {Delta}vph1 but none for {Delta}stv1 or {Delta}vma1.




View larger version (71K):
[in this window]
[in a new window]
 
Figure 1. Vacuolar structure in V-ATPase mutants. (A) Yeast cells (BY4742) containing the indicated deletions of different V-ATPase subunits were grown logarithmically in liquid YPD medium, stained with FM4–64, and analyzed by fluorescence microscopy as described in Materials and methods. (B) Quantitation of vacuole morphology. The number of vacuolar vesicles (stained by FM4–64) per cell was determined for the strains shown in A. For each experiment, 200 cells per strain were analyzed and grouped into the indicated categories. Two experiments were averaged. Bar, 5 µm.

 
In vivo experiments provide only indirect information about the proton uptake and fusion activities of the vacuoles. To overcome this limitation, we analyzed this aspect in an in vitro system reconstituting vacuolar fusion (Conradt et al., 1992). Vacuoles can be extracted from yeast spheroplasts after enzymatic digestion of the cell wall and gentle lysis by DEAE-dextrane, a treatment that leaves vacuoles intact and fusion competent. The isolated organelles fuse upon incubation with an ATP-regenerating system and cytosolic extracts. Since both V1 and V0 sectors are essential for proton translocation activity of the V-ATPase (Stevens and Forgac, 1997; Kane, 1999), we compared the fusion competence of vacuoles from V1 and V0 mutants, testing whether this V-ATPase activity was required for vacuole fusion. Vacuoles purified from the V0 mutant {Delta}vph1 were deficient for in vitro fusion. The fusion defect was even observed if only one of the fusion partners was a {Delta}vph1 vacuole and the other fusion partner was a wild-type vacuole (Fig. 2 A). This suggests that Vph1p is required for fusion on both fusion partners. Vacuoles from the V1 mutant {Delta}vma1 fused with ~50% of wild-type activity (Fig. 2 A). Addition of a cytosolic extract increased the fusion activity of {Delta}vma1 vacuoles to 70%. This activation was not due to readdition of intact V1 subunits via the cytosolic extract because immunodepletion of V1 from these extracts (Fig. 2 B) did not diminish their activities (Fig. 2 A). {Delta}vph1 vacuoles remained fusion incompetent under all conditions. Since both deletions of the V0 subunit Vph1 and deletion of the V1 subunit Vma1 completely abolish the pump activity of the V-ATPase (Stevens and Forgac, 1997; Kane, 1999), the difference in fusion activity between these strains is best explained by a function of Vph1p for vacuolar fusion that is independent of proton translocation.




View larger version (44K):
[in this window]
[in a new window]
 
Figure 2. Fusion activity of vacuoles from strains deficient in V1 sector ({Delta}vma1) or in V0 sector ({Delta}vph1). (A) Vacuoles from the indicated mutants (DKY 6281 background) were fused with wild-type vacuoles (BJ3505). Incubations were performed in the presence or absence of untreated cytosol (C) or of cytosol immunodepleted for Vma1p and Vma2p (dC). Fusion was assayed after 70 min at 27°C. The fusion activities of control reactions (asterisk) were set to 100%. The activity of the samples on ice was set to 0% (n = 5). Fusion activities of the wild-type–wild-type combination ranged from 2.2 to 4.1 U. (B) Western blot of equal protein amounts of cytosol (C) and immunodepleted cytosol (dC) against Vma1p, Vma2p, and the cytosolic marker protein phosphoglycerate kinase (PGK), verifying the absence of V1 sectors in the depleted cytosol.

 
Vacuolar proton uptake is not limiting for fusion of {Delta}vph1 vacuoles
Since vacuole fusion depends on a pmf across the vacuolar membrane (Conradt et al., 1994; Ungermann et al., 1999b) and the V-ATPase is the major vacuolar proton pump (Stevens and Forgac, 1997), we asked whether the fusion activity of {Delta}vph1 vacuoles could be limited by lack of a pmf. We tested whether {Delta}vph1 vacuoles are able to generate a basal pmf by a V-ATPase–independent pathway and whether this pmf would be above the threshold required for fusion. V-ATPase–independent antiport mechanisms can reconstitute a basal proton uptake activity by antiport of, for example, amino acids and protons (Ohsumi and Anraku, 1981, 1983; Sato et al., 1984; Klionsky et al., 1990; Wada et al., 1992a; Wada and Anraku, 1994) and/or by combination of an active vacuolar Ca2+ pump and a Ca2+/H+ antiporter (Ohsumi and Anraku, 1983; Cunningham and Fink, 1994; Forster and Kane, 2000). The pmf as such is important to drive fusion, but for the purpose of our experiments it is irrelevant whether proton uptake occurs via the V-ATPase or alternative mechanisms. We measured the apparent proton uptake activity of whole vacuoles under the conditions of our fusion reaction by following the change in absorbance of acridine orange at 491 and 540 nm, a common assay for the vacuolar pmf (Gluck et al., 1982). Since acridine orange is also fluorescent, we could monitor its distribution in the membrane preparation by fluorescence microscopy. At least 92% of the dye localized to structures that, by size and morphology, could be identified as vacuoles (unpublished data). Therefore, acridine orange will mostly report changes of the pmf on vacuoles. At standard dye to membrane ratios wild-type vacuoles showed a clear ATP-dependent decrease in the absorbance signal, indicating that a pmf had formed (Fig. 3 A, bottom panel). Addition of the protonophor carbonylcyanide-4-trifluormethoxyphenylhydrazon (FCCP) at the end of the assay period collapsed the pmf and restored the signal to the initial values. No signal was observed in the absence of ATP or after addition of even low concentrations (0.1 µM) of the V-ATPase inhibitor concanamycin A. Concanamycin A blocks V-ATPase–dependent H+ translocation at nanomolar concentrations (Drose and Altendorf, 1997). Our observation is consistent with earlier results from various other groups using subvacuolar vesicles (Drose and Altendorf, 1997). These studies demonstrated that the V-ATPase was the main source of the vacuolar pmf and could be completely inhibited by bafilomycin A or concanamycin A. At lower dye to vacuole ratios (Fig. 3 A, top two panels), however, the assay was more sensitive and could still detect a pmf in the presence of 0.1 µM concanamycin A. 1 and 5 µM of the inhibitor reduced the signal further and yielded overlapping curves, suggesting that these concentrations had saturated the system and that V-ATPase had been completely inhibited. Nevertheless, significant ATP-dependent proton uptake activity remained even at these high concentrations. This concanamycin-insensitive activity was comparable to the levels of ATP-dependent proton uptake observable with vacuoles prepared from V1 ({Delta}vma2) or V0 ({Delta}vph1) mutant cells (Fig. 3 B). The signal in V-ATPase mutant vacuoles could not be further reduced by concanamycin A. Therefore, this signal appears to reflect the V-ATPase–independent part of vacuolar proton uptake.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 3. Detection of V-ATPase–independent proton uptake activity by acridine orange. (A) Concentration dependence of the assay. Proton uptake activity of the vacuoles was assayed by measuring acridine orange absorption. Fusion reactions were started in the presence of 15 µM acridine orange and different vacuole concentrations to vary the dye to vacuole ratio. Where indicated (start), the ATP regenerating system and concanamycin A had been added. At the end of the assay period, FCCP (30 µM) was added to dissipate the proton gradient. (B) Assay of mutant vacuoles. Vacuoles from wild-type, {Delta}vph1, and {Delta}vma2 cells were assayed for proton uptake activity as in A. 54 pmol acridine orange (final concentration 15 µM) were used per µg vacuoles.

 
Next, we asked whether the V-ATPase–independent proton uptake activity could suffice to drive fusion. We compared the fusion and proton translocation activities of {Delta}vph1 vacuoles to those of wild-type vacuoles in which V-ATPase pump activity had been pharmacologically suppressed with concanamycin A. In this case, we measured apparent proton uptake activity by following alkalinization of the medium with the pH-sensitive dye 2'7'-bis-[2-carboxyethyl]-5-[and 6]-carboxyfluorescein (BCECF; Peters et al., 2001). Unlike acridine orange, which inserts into the vacuolar membrane (unpublished data), this dye is coupled to high molecular weight dextrane, does not interfere with vacuole fusion, and permits assay of fusion and proton translocation in the same samples. In this assay, the apparent proton translocation activity of {Delta}vph1 vacuoles was equal to that of wild-type vacuoles treated with 1 µM concanamycin A (Fig. 4 B). As in the acridine orange assay, this signal was ATP dependent and FCCP sensitive, suggesting that it reflected the same V-ATPase–independent component of vacuolar proton uptake. Comparison of the fusion activities revealed that {Delta}vph1 vacuoles did not fuse, but wild-type vacuoles with 1 µM concanamycin A retained full fusion activity (Fig. 4 A). FCCP dissipates the proton gradient across the vacuolar membrane, eliminating both its V-ATPase–dependent and V-ATPase–independent components. In agreement with earlier studies (Conradt et al., 1994; Mayer et al., 1996; Ungermann et al., 1999b), FCCP inhibited fusion. Together, vacuole fusion seems to depend on a pmf across the vacuolar membrane but not on V-ATPase proton pump activity. Hence, the fusion defect of {Delta}vph1 vacuoles cannot be explained by a reduction in the apparent proton uptake activity, supporting a direct function of V0 in vacuole fusion.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 4. Fusion and apparent proton translocation activity of vacuoles from vph1 deletion strains ({Delta}vph1). (A) Fusion and apparent proton translocation activity (B) were examined in parallel fusion reactions using wild-type or {Delta}vph1 vacuoles in the presence or absence of concanamycin A (Conc.A; 1 µM) or FCCP (30 µM). Fusion and pump activities of wild-type vacuoles (asterisk) were set to 100% (n = 3). Fusion activities of these control samples ranged from 2.5 to 3.8 U.

 
We sought to specifically interfere with the fusion relevant aspect of V0. Available low molecular weight V-ATPase inhibitors affect only the proton translocation function of the V-ATPase, (e.g., concanamycin A) and/or are slowly reacting and of unsatisfactory specificity (e.g., dicyclohexylcarbodiimide). We raised antibodies to V0 subunits in order to generate highly specific agents that might interfere with V0 function and be suitable for analysis of the fusion reaction. We immunized goats with the recombinantly expressed and purified NH2-terminal cytosolic part of Vph1p and prepared affinity-purified polyclonal antibodies from the sera. If titrated into in vitro fusion reactions, these antibodies inhibited fusion in a concentration-dependent manner (IC50= 6 µM; Fig. 5 A). Nonimmune antibodies had no effect at comparable concentrations (Fig. 5 B). To exclude potential interference due to the divalent nature of whole IgG, we also prepared monovalent Fab fragments from these antibodies. They also inhibited fusion at concentrations comparable to those observed for whole IgGs (Fig. 5 C), matching our general experience for many other fusion relevant components: the inhibitory potency of whole IgGs and Fab fragments is not significantly different (Haas et al., 1995; Haas and Wickner, 1996; Mayer and Wickner, 1997; Nichols et al., 1997).



View larger version (11K):
[in this window]
[in a new window]
 
Figure 5. Inhibition by antibodies to Vph1p. (A) Different concentrations of affinity-purified antibodies to Vph1p (from goat) were added to a standard fusion reaction without cytosol. The reaction was started after preincubation for 10 min on ice by adding ATP. Fusion was assayed after 70 min at 27°C. (B) Nonimmune antibodies do not interfere with vacuole fusion. Standard fusion reactions were run with 20 µM IgG purified from nonimmune or anti-Vph1p sera from goats, or with control buffer only, and assayed after 70 min at 27°C (n = 6). (C) Inhibition of fusion by Fab fragments of antibodies to Vph1p. Standard fusion reactions were incubated with Fab fragments derived either from nonimmune antibodies or from antibodies to Vph1p. Fusion was assayed as in the legend to Fig. 2 (n = 3). Fusion activities of the control samples (asterisk) ranged from 3.2 to 5.1 U, and those of ice values ranged from 0.2 to 0.3 U. Inhibitor concentrations were 45 µM anti-Vph1p Fab and 45 µM nonimmune Fab.

 
As described for the {Delta}vph1 mutants above, we tested whether antibodies to Vph1p would interfere with the apparent vacuolar proton uptake. This was not the case, although the antibodies blocked fusion (Fig. 6). The lack of effect of anti-Vph1p on proton uptake is probably due to the fact that the antibodies recognize only solitary V0 sectors but not the assembled V0/V1 holoenzyme (unpublished data). The antibodies were also tested on vacuoles from which the V1 sector had been removed by cold extraction with KSCN and ATP, a treatment that leaves the V0 sector in the membranes (Arai et al., 1989; Moriyama and Nelson, 1989; Adachi et al., 1990; Peters et al., 2001) but inactivates V-ATPase–dependent proton translocation (Fig. 7 B). Fusion of such vacuoles was inhibited by anti-Vph1p as efficiently as by GTP{gamma}S or antibodies to Sec18p/NSF (Fig. 7 A), two established antagonists of vacuole fusion (Haas et al., 1994; Mayer et al., 1996). Thus, antibodies to the cytosolic part of Vph1p provide an additional tool to separate the fusion function of V0 from its role in proton pumping.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 6. Influence of antibodies to Vph1p on the apparent proton translocation and fusion activity of intact vacuoles. Standard fusion reactions were run in the presence or absence of the indicated inhibitors. Pump activity was determined with the BCECF assay as described in Materials and methods. Fusion activities were assayed in parallel samples as in Fig. 2 (n = 4). Fusion activities of control samples ranged from 3.3 to 4.8 U. Inhibitors were FCCP (30 µM), anti-Vph1p (20 µM), and nonimmune antibodies (20 µM).

 


View larger version (12K):
[in this window]
[in a new window]
 
Figure 7. Fusion of vacuoles without V1 sector is inhibited by anti-Vph1p. (A) Vacuoles were extracted with SCN-/ATP to remove V1. Fusion activity was assayed in the absence or presence of the indicated inhibitors as in the legend to Fig. 2 (n = 3). Fusion activities of the control samples (asterisk) ranged from 0.75 to 1.4 U. (B) Apparent proton pumping activity of untreated or stripped vacuoles was determined as described in Materials and methods. The activity of untreated vacuoles was set to 100%. Inhibitors were GTP{gamma}S (2 mM), anti-Vph1p (20 µM), nonimmune antibodies (20 µM), and anti-Sec18p (2 µM).

 
Vph1p acts in the postdocking phase of vacuole fusion
The antibodies to Vph1p were used for kinetic analyses in order to explore which stage of vacuole fusion required Vph1p. First, we tested when the reaction became resistant to anti-Vph1p (Fig. 8 A). The majority of vacuoles completes distinct reaction steps within defined intervals and becomes resistant to inhibitors of these steps (Conradt et al., 1994; Mayer et al., 1996), revealing the sequence of events. Inhibitors were added to an aliquot of an ongoing fusion reaction at different times after the start point. Then, the incubation was continued until the end of a standard fusion period (70 min). Another aliquot was chilled to stop fusion at the time of inhibitor addition. All inhibitors abolished fusion when added at the start of the reaction (Fig. 8 A). After 35 min, the reaction was resistant to antibodies to the t-SNARE Vam3p, indicating the completion of docking (Mayer and Wickner, 1997; Ungermann et al., 1998b). The inhibition curve for anti-Vph1p lagged significantly behind that for anti-Vam3p, suggesting that Vph1p was required past the docking stage. This behavior resembled the inhibition curves obtained previously with calmodulin antagonists or with the Ca2+ chelator BAPTA, which inhibit completion of fusion after the docking step (Peters and Mayer, 1998; Ungermann et al., 1999b).





View larger version (68K):
[in this window]
[in a new window]
 
Figure 8. Kinetic resolution of Vph1p requirement for fusion. (A) Standard fusion reactions without cytosol were started at 27°C. At the indicated times, inhibitors or control buffer were added. The samples were left on ice for 10 min. Then, they were transferred to 27°C or left on ice for the remainder of the 70-min reaction period. After 70 min, fusion activity was assayed. (B) Trans-SNARE pairing. Fusion reactions with vacuoles from strains SBY521 ({Delta}vam3 {Delta}vph1) or no. 418 ({Delta}vam3 VPH1) and no. 120 ({Delta}nyv1 VPH1) were incubated (50 min, 27°C) with the indicated inhibitors at 27°C or left on ice. Then, the membranes were reisolated, solubilized, and assayed for trans-SNARE complexes by determining the amounts of the v-SNARE Nyv1p coimmunoprecipitating with the t-SNARE Vam3p. (C) Standard fusion reactions without cytosol were incubated at 27°C in the presence of 1 mM MgCl2 and 5 mM BAPTA for 30 min. The reactions were chilled on ice, and vacuoles were reisolated (10,000 g, 2 min, 2°C). Vacuoles were resuspended in fusion buffer with cytosol and 200 µM CaCl2 but without ATP. Aliquots were preincubated for 5 min on ice with the indicated inhibitors and incubated further for 70 min at 27°C. Fusion activities were assayed and plotted as in the legend to Fig. 2 (n = 3). Activities of the control sample ranged from 1.1 to 1.9 U. Inhibitors were BAPTA (5 mM), GTP{gamma}S (2 mM), anti-Vam3p (2 µM), Gdi1p (5 µM), anti-Vph1p (20 µM), and FCCP (30 µM).

 
Trans-SNARE pairing is believed to be a key event in docking membranes and committing them to fusion (Sollner et al., 1993; Weber et al., 1998). It can be assayed as a molecular indicator of docking (Ungermann et al., 1998b). To test whether deletion of Vph1 affected a step before or concomitant with docking, or rather an event required for subsequent fusion per se, we tested whether {Delta}vph1 vacuoles were able to form trans-SNARE complexes. Yeast vacuoles offer the possibility to measure trans-SNARE pairing by use of a combination of vacuoles lacking either the vacuolar v-SNARE Nyv1p or the vacuolar t-SNARE Vam3p (Ungermann et al., 1998b). These vacuoles are prepared from separate strains and mixed in vitro. v/t-SNARE complexes can only be formed if a v-SNARE–containing vacuole docks to a t-SNARE–containing vacuole. If this experiment is performed in the presence of a late acting fusion inhibitor, such as GTP{gamma}S, accumulating SNARE complexes represent transcomplexes. We generated a strain carrying deletions of Vam3 (t-SNARE) and Vph1. Vacuoles from this strain were fused with vacuoles from a {Delta}nyv1 (v-SNARE) strain. In agreement with previous results (Ungermann et al., 1998b), SNARE complexes accumulated at 27°C but not on ice (Fig. 8 B). There was no significant difference in the yield of trans-SNARE pairing between VPH1–containing vacuoles and {Delta}vph1 vacuoles. The docking inhibitor Gdi1p, which extracts the Rab-GTPase Ypt7p from the membranes, suppressed formation of trans-SNARE complexes, demonstrating that the signal from the coimmunoprecipitation assay was specific and a consequence of docking. GTP{gamma}S, which permits docking and the formation of V0 transcomplexes (Peters et al., 2001) but not fusion, did not interfere with trans-SNARE pairing. Since trans-SNARE pairing depends on a pmf (Ungermann et al., 1999b), this experiment also indicates that the apparent proton uptake activity of {Delta}vph1 vacuoles sufficed to drive trans-SNARE pairing. More importantly, however, it demonstrates that {Delta}vph1 vacuoles do not fuse (Fig. 2), although they form trans-SNARE complexes (Fig. 8 B), indicating that a step subsequent to or independent of trans-SNARE pairing is blocked by deletion of Vph1.

Coupling of Vph1p to the Ca2+-releasing channel
Docking triggers a Ca2+ release from the vacuolar lumen that strengthens the binding of calmodulin to the vacuolar membrane and triggers fusion (Peters and Mayer, 1998). We tested whether Vph1p function would even be required after the Ca2+/calmodulin-dependent step by accumulating reaction intermediates in the presence of the Ca2+ chelator BAPTA. This reversible block can be relieved by removing BAPTA and replenishing Ca2+ (Ungermann et al., 1999b). Completion of the reaction from this stage still showed significant sensitivity to anti-Vph1p (Fig. 8 C), although the effect was not as pronounced as for the low molecular weight inhibitor GTP{gamma}S. This suggests that the antibody-sensitive stage might be tightly coupled to the Ca2+-requiring step and/or be overcome rapidly after removal of BAPTA. The requirement for Vph1p can obviously not be completely satisfied before completion of the Ca2+/calmodulin-dependent step. Together, the results from the kinetic analysis (Fig. 8 A), the direct assay of trans-SNARE pairing (Fig. 8 B), and the staging experiments (Fig. 8 C) all suggest that Vph1p functions after the completion of docking and trans-SNARE pairing, concomitant with or after the release of lumenal Ca2+ and close to the completion of fusion.

The relationship of Ca2+ release and Vph1p function in fusion was further characterized by monitoring Ca2+ release in the course of fusion. Fusion reactions were run in the presence of aequorin and coelenterazine (Muller et al., 2001). Aequorin is a protein that oxidizes its substrate coelenterazine in a Ca2+-dependent fashion, emitting light (Shimomura et al., 1993). This permits continuous recording of Ca2+ levels in the buffer of ongoing fusion reactions. In agreement with previous results obtained with a different approach (Peters and Mayer, 1998), treatments preventing priming, such as antibodies to Sec18p/NSF or Sec17p/{alpha}-SNAP, suppressed the release of Ca2+ from the vacuolar lumen (Fig. 9 A). Docking inhibitors, such as antibodies to the t-SNAREs Vam3p and Vam7p had the same effect (not depicted). Surprisingly, antibodies to Vph1p also inhibited Ca2+ release, suggesting that either Vph1p or V0 itself might be involved in Ca2+ release or that Vph1p might be coupled to the Ca2+ channel. In both cases, adding an antibody to Vph1p might block a conformational change required for activation of the channel. Only in the first case, however, should deletion of Vph1p, which eliminates the vacuolar V0 sector as a whole (Stevens and Forgac, 1997; Kane and Parra, 2000), abolish Ca2+ release. This was not the case. {Delta}vph1 vacuoles showed Ca2+efflux just as their wild-type counterparts (Fig. 9 B). Efflux was sensitive to the Rab-GTPase inhibitor Gdi1p, demonstrating that it depended on docking and was triggered by the authentic fusion pathway. This permits several conclusions. First, it suggests that the fusion defect of {Delta}vph1 vacuoles is not due to the inability to release calcium. Second, Vph1p itself is not part of the Ca2+-releasing channel. Third, Vph1p may be coupled to the Ca2+ channel, leaving calcium release intact if Vph1p is absent but blocking it if Vph1p is inactivated by an antibody.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 9. Vacuolar Ca2+ release during fusion. (A) Inhibition by antibodies to Vph1p. Standard fusion reactions were started, and Ca2+ was monitored continuously as described in the Materials and methods. Before the reactions were started, vacuoles had been preincubated with one of the indicated inhibitors, or with one of the following buffers only (3 min, 0°C): anti-Sec18p (2 µM), anti-Sec17p (2 µM), anti-Vph1p (20 µM), and nonimmune antibodies (20 µM). (B) Effect of vph1 deletion. Vacuoles were prepared from wild-type and {Delta}vph1 cells and incubated under fusion conditions in the presence or absence of 5 µM Gdi1p. Ca2+ efflux was monitored as in A, and peak signals were plotted.

 

   Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
A previous study demonstrated that V0 sectors from opposing vacuolar membranes can associate into transcomplexes before fusion has occurred (Peters et al., 2001). Vacuolar V0 sectors consist of a cylinder composed of (probably six) proteolipids, the large multispanning integral membrane protein Vph1p, and the peripheral subunit Vma6p (Kane et al., 1989; Hirata et al., 1997; Powell et al., 2000). V0 transcomplexes might thus connect proteolipid cylinders from opposing membranes, creating a condition that might resemble the situation postulated in pore models of fusion (Lindau and Almers, 1995; Zimmerberg, 2001). Formation of V0 transcomplexes requires ATP, the Rab-GTPase Ypt7p, and trans-SNARE pairing. Therefore, it depends on the early reaction steps of priming and docking (Peters et al., 2001). Maintenance of V0 transcomplexes is independent of trans-SNARE pairing. These observations link V0 transcomplex formation into the reaction sequence. It is important, however, to investigate whether V0 is required in the final stage of fusion. The results presented here address this aspect.

First, we demonstrate that V0 does not only form transcomplexes but is critically involved in vacuole fusion in vitro and in vivo. The V0 requirement kinetically mapped to the reaction phase that follows completion of docking and trans-SNARE pairing (Ungermann et al., 1998b) and is independent of a proton gradient (Mayer et al., 1996; Mayer and Wickner, 1997; Ungermann et al., 1999b). However, this terminal reaction phase depends on Ca2+ release from the vacuolar lumen which triggers bilayer fusion (Peters and Mayer, 1998). This is consistent with the observation that V0 transcomplexes form after docking and depend on Ca2+ release (Peters et al., 2001). It establishes a correlation between the timing of V0 function in fusion and V0 transcomplex formation, strengthening the hypothesis that V0 transcomplex formation is tied to V0 function in vacuole fusion. Second, we demonstrate that Vph1p is required on both fusion partners. This symmetric requirement for Vph1p is consistent with a feature of some published pore models, namely that two membrane integral multisubunit cylinders connect the two membranes before fusion (Lindau and Almers, 1995; Zimmerberg, 2001).

Several lines of evidence suggest that trans-SNARE pairing is a necessary intermediate in vacuole fusion but that further events are required to drive the transition from docking to full fusion. First, quenching of the Ca2+ efflux by BAPTA reduces fusion activity to 10% of the control samples (Peters and Mayer, 1998), although BAPTA permits trans-SNARE pairing (Ungermann et al., 1999b). However, BAPTA blocks V0 transcomplex formation completely (Peters et al., 2001). Second, deletion of Vtc3 permits docking of the vacuoles, Ca2+ release, and V0 transcomplex formation but not fusion (Muller et al., 2002). Third, inactivation of V0 by deletion of Vph1p reduced fusion activity to 10–15% of the control value, although trans-SNARE pairing was unaffected. This demonstrates that V0 is crucial for most of the observable fusion activity of vacuoles. Fourth, trans-SNARE complexes appear to be largely dispensable after the BAPTA-sensitive stage (Ungermann et al., 1998a, 1999b) but V0 is not. This correlates to the behavior of V0 transcomplexes because docking and trans-SNARE pairing are required to establish V0 transcomplexes. Once formed, however, V0 transcomplexes persist in the absence of SNARE complexes (Peters et al., 2001).

The 10–15% of fusion activity observed after V0 inactivation is probably caused by trans-SNARE complexes, reflecting a basal level of fusion that may result from forcing the membranes into close proximity. It is possible that this basal activity is what could be reconstituted with purified SNAREs in liposomes. Although these liposomes contained high concentrations of SNAREs, they yielded significantly lower fusion rates than the equivalent complete fusion system can show in situ (Weber et al., 1998; Parlati et al., 1999). Lowering the v-SNARE concentration in liposomes to roughly physiological levels abolished this fusion activity (Mahal et al., 2002). It made the system completely dependent on an additional factor, the exocytic Ca2+ sensor synaptotagmin. Synaptotagmin strongly stimulated fusion, though in this case in a Ca2+-independent fashion.

It appears that both in triggered fusion events, such as regulated exocytosis, and in "constitutive" fusion events, such as vacuole fusion, the membranes require additional factors to efficiently progress from docking and trans-SNARE pairing to fusion. Such a function may be fulfilled by synaptotagmin in regulated exocytosis (Fernandez-Chacon et al., 2001; Chapman, 2002) or by V0 and Vtc3p in vacuole fusion. It is possible that proteins with related properties participate in other membrane fusion reactions. Candidates exist, as exemplified by Got1p and Sft2p, tetraspanning membrane proteins with a genetic interaction with the t-SNARE Sed5p and some similarities to the V0 proteolipids. Got1p is required in a postdocking stage of ER-Golgi trafficking and forms multimeric assemblies in the membrane (Conchon et al., 1999). SCAMP2 was identified as a factor required for endocytosis but also for a very late step in mast cell exocytosis. SCAMP2 is also a tetraspanning membrane protein that belongs to a protein family with members on various compartments, exists as a multimeric complex in the membrane, and binds to the t-SNARE subunit SNAP-23 (Singleton et al., 1997; Fernandez-Chacon et al., 2000; Fernandez-Chacon and Sudhof, 2000; Guo et al., 2002).

Ca2+ is released from the vacuolar lumen in a way that depends on priming and docking (Peters and Mayer, 1998). Now we have discovered that inactivation of the V0 subunit Vph1p by antibodies prevents this release, but deletion of Vph1p does not. Since inactivation of Vph1p by deletion or antibodies interferes neither with priming nor with docking (Fig. 8 B; unpublished data), we propose that the effect of Vph1p antibodies on Ca2+ release may reflect a coupling of Vph1p to the putative Ca2+ channel. Whether this coupling would be direct or indirect via shared binding partners cannot be judged at the moment. But it is striking that V0 is associated with the t-SNARE Vam3p (Peters et al., 2001) and that t-SNAREs in regulated exocytosis were shown to specifically bind to calcium channels (Leveque et al., 1994; Sheng et al., 1994). Our hypothesis is further supported by the differential effects of Ca2+ chelators on fusion (Peters and Mayer, 1998). Only BAPTA, a Ca2+ chelator with a rapid association rate, can block fusion. EGTA, which has a comparable Kd for Ca2+ but a much slower association rate, is not effective. This difference is best explained by assuming that the site of Ca2+ release and the Ca2+ effector proteins (in case of the vacuoles the effectors are most likely V0 and calmodulin [Peters et al., 2001]) are tightly associated. Then, chelators must act rapidly to be able to quench Ca2+ before it diffuses to and binds its receptor site (Neher, 1998). An analogous situation exists in regulated exocytosis. The triggering stage of this reaction is only sensitive to fast Ca2+ chelators (Adler et al., 1991), and the Ca2+ channels are associated with syntaxin (t-SNARE) in the plasma membrane (Leveque et al., 1994; Sheng et al., 1994). They should hence be close to the fusion site. This provides a physical correlate for the differential sensitivity of exocytosis to BAPTA and EGTA.

The reconstituted proteolipid cylinder of the V-ATPase can form large pores in response to binding of Ca2+ and calmodulin, demonstrating a potential for significant conformational changes in the membrane (Peters et al., 2001). On the other hand, a fraction of V0 in vacuolar membranes is associated with the VTC complex, a membrane integral complex that is required for the priming activity of Sec18p/NSF (Muller et al., 2002) and for membrane binding of LMA1, i.e., it is coupled to two components that are directly involved in generating (Sec18p; Mayer et al., 1996; Ungermann et al., 1998a) or maintaining (LMA1; Mayer and Wickner, 1997; Xu et al., 1997) an activated state of the fusion machinery. Therefore, we speculate that Vph1p, or the entire V0 sector, might undergo significant conformational changes during fusion, perhaps driven by Sec18p/NSF. Antibodies to Vph1p may prevent such conformational changes and thereby also block Ca2+ release through a channel associated with V0. Such coupling should be functionally relevant because Ca2+ release from the lumen of an organelle can only be transient. If the fusion system is not competent to respond to Ca2+ at the time of release, the reaction might be nonproductive. One might expect higher efficiency of the overall process if Ca2+ release and the Ca2+ controlled fusion system were activated in a coordinated fashion. This question can be answered with certainty only once the Ca2+-releasing channel will have been identified and assays for conformational changes of V0 during fusion will be available.


   Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Strains
BJ3505 and DKY6281 are standard fusion strains (Mayer et al., 1996). Strain no. 120 is BJ3505 ({Delta}nyv1) (Nichols et al., 1997). Strain no. 418 is DKY 6281 {Delta}vam3 provided by Christian Ungerman (Biochemiezentrum, Heidelberg, Germany). SBY521 ({Delta}vam3, {Delta}vph1) was derived from no. 418 by replacing VPH1 with a kanamycin resistance cassette as described below. BY4742 (Mat {alpha} his3{Delta}1 leu2{Delta}0 met15{Delta}0 ura3{Delta}0) and its {Delta}vph1::kanMX4 or {Delta}stv1::kanMX4 derivates were purchased from EUROSCARF.

Deletion strains of VPH1 were made by replacing the gene with a loxP-kanMX-loxP cassette from plasmid pUG6 (Guldener et al., 1996) using the following primers: Vph1 forward K.O., GCCTCTCAATATATCTATACTTGCTTAGAGGGCTACCTGTGTCAGCTGAAGCTTCGTACGC and Vph1 reverse K.O., CTGGTGGATTGGATTGCAAGTCTAACGTTTTCATGAGATAAGGCATAGGCCACTAGTGGATCTG. Vma1 and Vma2 were deleted by replacement with the HIS3 cassette from plasmid pRS 303 using the following primers: VMA1 forward, ATGGCTGGTGCAATTGAAAAGCTCGTAAGGAAATAAAAAGAATCAGATTGTACTGAGAGTGCAC, VMA1 reverse, CAGACAAGGCCGATTTACAACTAATTGAACAACTTGTTCCTG-TGCGGTATTTCACACCG, VMA2 forward, GGTGTGAACGGTCCATT-AGTCATTTGGAAAAGGTCAAGTTCCCAGATTGTACTGAGAGTGCAC, and VMA2 reverse, GAATCTTTGGGGAGATTCTATTCAACATCTCCTTAGGGTAGCTGTGCGGTATTTCACACCG. All deletions were verified by diagnostic colony PCR and by Western blotting of purified vacuoles from the mutants.

General procedures
Vacuole isolation, cytosol preparation, fusion, purification of antibodies or Gdi1p, inhibitors, and FM4–64 staining were as described (Peters and Mayer, 1998; Peters et al., 1999). PS buffer is 10 mM Pipes/KOH, pH 6.8, and 200 mM sorbitol. 1x PIC is a protease inhibitor cocktail: 100 µM pefabloc SC, 100 ng/ml leupeptin, 50 µM o-phenanthroline, and 500 ng/ml pepstatin A. Vacuoles without V1 sector were prepared as described (Peters et al., 2001). In experiments with BAPTA, the alkaline phosphatase assay mixture contained 10 mM CaCl2. All samples were centrifuged (1 min, 14, 000 g) before spectrophotometry to remove precipitated Ca2+ salts.

Proton uptake activity of vacuoles
BCECF assay.
For the determination of pump activity, 100-µl fusion reactions were incubated at 25°C with 0.5 µM BCECF-dextran (70 K; Molecular Probes). The change of fluorescence was measured at an excitation of 490 nm and an emission of 520 nm in a Perkin Elmer LS50B fluorometer or in a plate reader fluorometer (Spectra Max Gemini; Molecular Devices). Initial pump activity was determined as described (Peters et al., 2001). In brief, the pH shift in the medium was followed via the pH-dependent shift in fluorescence of BCECF. This shift could be calibrated by buffering the solution to different pH values using PS buffer with 150 mM KCl.

Acridine orange assay.
Proton uptake of vacuoles was measured essentially as described. The absorbance changes of acridine orange at 491 and 540 nm were followed in a Beckman Coulter DU-600 spectrophotometer (Gluck et al., 1982). The difference between these values at any time point serves as a measure of the vacuolar pmf. The reaction mixture in a final volume of 100 µl contained 20 µg of vacuoles under standard fusion conditions with 15 µM acridine orange. The reaction was started by the addition of 5 µl of ATP regenerating system. At the end, 30 µM FCCP were added. Proton uptake activity was defined as the absorbance change in the first 20 s of the reaction.

Trans-SNARE assay
120-µl fusion reactions (containing 24-µg vacuoles) with cytosol (0.5 µg/µl) were incubated for 50 min. The reactions were stopped by chilling the samples on ice. 380 µl of precipitation buffer were added (150 mM KCl, 1.3% [wt/vol] Triton X-100, 1.3 mM PMSF, 1.2x PIC, 13 mM EDTA, 200 mM Sorbitol, 10 mM Pipes/KOH, pH 6.8). Samples were shaken (10 min, 4°C) and centrifuged (21,000 g, 10 min). 450 µl of the solubilisate were transferred to a new reaction tube. 3% of the volume was kept as load control. 14 µg of affinity-purified anti-Vam3p antibody and 100 µl of a 1:4 slurry of protein A–Sepharose CL-4B (Amersham Biosciences) preequilibrated in washing buffer (150 mM KCl, 1% [wt/vol] Triton X-100, 1 mM PMSF, 1x PIC, 10 mM EDTA, 200 mM Sorbitol, 10 mM Pipes/KOH, pH 6.8) were added to each sample. After 1 h of shaking at 4°C, the protein A–Sepharose was washed three times with washing buffer. Residual liquid was removed with a Hamilton pipette. 80 µl SDS sample buffer was added, and aliquots were analyzed by gel electrophoresis and Western blotting.

Generation of antibodies to Vph1p
Vph1 cytosolic domain (Vph1-Cyt) was cloned with an NH2-terminal His6 tag for expression in Escherichia coli. The coding region of this domain was amplified by PCR using primers cyt Vph1 forward, GCAGAGAAGGAGGAAGCGATTTTTC, cyt Vph1 reverse, TCACTGGACTTCAATTTGATCGGT, and genomic DNA as a template. The PCR product was cloned into pCR T7/NT-TOPO (Invitrogen). The resulting plasmid was transformed into E. coli BL21. Cells were grown in LB/Ampicillin medium (37°C, 225 rpm) to an OD600 of ~0.6. Expression was induced with 1 mM IPTG at 37°C for 4 h. Cells were harvested by centrifugation (10,000 g, 7 min), washed with twofold-concentrated PBS, and lysed by two freeze–thaw cycles and sonication in twofold-concentrated PBS, 8 M urea. The lysate (50 ml out of 8 liters culture) was centrifuged (20,000 g, 15 min, 4°C) and batch incubated with Ni-NTA resin (1 ml bed volume, 2 h, 4°C). The resin was washed with 20 ml of twofold-concentrated PBS, 0.05% SDS and with 20 ml twofold-concentrated PBS, 0.05% SDS, and 10 mM imidazole. Urea was omitted during washing to avoid interference in the following coupling reaction. 0.05% SDS was added to avoid precipitation during elution from the column. The protein was eluted with 150 mM imidazole. The eluate (containing 3 mg of protein) was directly coupled (1 h, RT) to 1.5 ml CH-activated Sepharose 4 B (Amersham Biosciences).

Antibodies to Vph1-Cyt were raised by injecting purified recombinant protein eluate (300–500 µg per boost) into a goat. Serum (10 ml) was affinity purified using the recombinant protein immobilized on activated CH–Sepharose 4B. The serum was diluted with 1 vol PBS and passed over the column at RT. The column was washed with 20–25 column volumes of PBS. Antibodies were eluted with 0.1 M glycine pH 2.75/150 mM NaCl, and the pH was immediately neutralized by adding 1 M Tris/HCl, pH 8.8. The antibodies were transferred into PS buffer with 150 mM KCl by repeated dilution and ultrafiltration in centricon-30 (Amicon) and stored at -20°C. Control antibodies were affinity purified with protein G from preimmune serum and treated as above.

Preparation of Fab fragments
Fab fragments were prepared from Vph1p antibodies essentially according to the manufacturer's instructions (ImmunoPure Fab Preparation kit; Pierce Chemical Co.). 20 mg of purified antibody were diluted with 1 vol of digestion buffer (as supplied). The solution (2 ml) was incubated overnight at 30°C with 0.5 ml immobilized papain. The sample was centrifuged, and the supernatant was passed over a protein G column to remove uncleaved antibodies and Fc Fragments. The flowthrough containing the Fab fragments was repeatedly diluted and concentrated to exchange the buffer for PS with 150 mM KCl.

Ca2+ assay
Ca2+ release from vacuoles in the course of the fusion reaction was assayed similarly as described (Peters and Mayer, 1998) with the following modifications. Ca2+ was directly measured with aequorin in ongoing fusion reactions running in parallel in a microtiter plate luminometer (EG&G Berthold). Reactions (30 µl) contained 10 µg of vacuoles from strain BJ3505 in PS buffer with 150 mM KCl and 0.5 µl cytosol (30 mg/ml). Respective inhibitors were included. After 2 min of preincubation on ice, 2 µl of ATP regenerating system (same composition as in the fusion assay) and 3 µl of a freshly prepared 2:2:1 mix of the following stock solutions were added: 2.5 µM aequorin (Aqualite; Molecular Probes), 1 mM EGTA/KOH, pH 7.5, and 500 µM native coelenterazine (Molecular Probes) in EtOH. Samples were pipetted into a microtiter plate, and light emission of aequorin was measured with the luminometer for 60 min at 27°C. The assay was calibrated with solutions of different calcium concentrations as described (Peters and Mayer, 1998).

FM4–64 staining
Cells were grown logarithmically in liquid YPD overnight (OD600 < 2) at 30°C. Cells were harvested (2 min, 3,000 g), resuspended in YPD with 10 µM FM4–64 at OD600 = 1, and shaken for 3 h at 30°C. Cells were harvested as above, resuspended in YPD at OD600 = 0.2, and shaken for 2–3 h at 30°C. For microscopy, individual samples were removed from the shaker. Cells were harvested (1 min, 3,000 g), resuspended in YPD at OD600 = 10, and immediately analyzed by fluorescence microscopy. For quantitation of vacuole morphology, photos of at least 20 random fields were taken. Vacuoles were counted in at least 200 cells per experiment and condition.


   Acknowledgments
 
We thank Michael Harrison (School of Biochemistry and Molecular Biology, University of Leeds, UK) for plasmids and Christa Baradoy for technical assistance.

This work was supported by grants from the Deutsche Forschungsgemeinschaft (SFB184) and from the Human Frontier Science Program.

Submitted: 2 December 2002

Revised: 27 May 2003

Accepted: 27 May 2003


   References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 

Adachi, I., K. Puopolo, N. Marquez-Sterling, H. Arai, and M. Forgac. 1990. Dissociation, cross-linking, and glycosylation of the coated vesicle proton pump. J. Biol. Chem. 265:967–973.[Abstract/Free Full Text]

Adamo, J.E., G. Rossi, and P. Brennwald. 1999. The Rho GTPase Rho3 has a direct role in exocytosis that is distinct from its role in actin polarity. Mol. Biol. Cell. 10:4121–4133.[Abstract/Free Full Text]

Adamo, J.E., J.J. Moskow, A.S. Gladfelter, D. Viterbo, D.J. Lew, and P.J. Brennwald. 2001. Yeast Cdc42 functions at a late step in exocytosis, specifically during polarized growth of the emerging bud. J. Cell Biol. 155:581–592.[Abstract/Free Full Text]

Adler, E.M., G.J. Augustine, S.N. Duffy, and M.P. Charlton. 1991. Alien intracellular calcium chelators attenuate neurotransmitter release at the squid giant synapse. J. Neurosci. 11:1496–1507.[Abstract]

Arai, H., S. Pink, and M. Forgac. 1989. Interaction of anions and ATP with the coated vesicle proton pump. Biochemistry. 28:3075–3082.[CrossRef][Medline]

Boeddinghaus, C., A.J. Merz, R. Laage, and C. Ungermann. 2002. A cycle of Vam7p release from and PtdIns 3-P–dependent rebinding to the yeast vacuole is required for homotypic vacuole fusion. J. Cell Biol. 157:79–90.[Abstract/Free Full Text]

Chapman, E.R. 2002. Synaptotagmin: a Ca(2+) sensor that triggers exocytosis? Nat. Rev. Mol. Cell Biol. 3:498–508.[CrossRef][Medline]

Cheever, M.L., T.K. Sato, T. de Beer, T.G. Kutateladze, S.D. Emr, and M. Overduin. 2001. Phox domain interaction with PtdIns(3)P targets the Vam7 t-SNARE to vacuole membranes. Nat. Cell Biol. 3:613–618.[CrossRef][Medline]

Chen, Y.A., and R.H. Scheller. 2001. SNARE-mediated membrane fusion. Nat. Rev. Mol. Cell Biol. 2:98–106.[CrossRef][Medline]

Conchon, S., X. Cao, C. Barlowe, and H.R. Pelham. 1999. Got1p and Sft2p: membrane proteins involved in traffic to the Golgi complex. EMBO J. 18:3934–3946.[CrossRef][Medline]

Conradt, B., J. Shaw, T. Vida, S. Emr, and W. Wickner. 1992. In vitro reactions of vacuole inheritance in Saccharomyces cerevisiae. J. Cell Biol. 119:1469–1479.[Abstract/Free Full Text]

Conradt, B., A. Haas, and W. Wickner. 1994. Determination of four biochemically distinct, sequential stages during vacuole inheritance in vitro. J. Cell Biol. 126:99–110.[Abstract/Free Full Text]

Cunningham, K.W., and G.R. Fink. 1994. Calcineurin-dependent growth control in Saccharomyces cerevisiae mutants lacking PMC1, a homolog of plasma membrane Ca2+ ATPases. J. Cell Biol. 124:351–363.[Abstract/Free Full Text]

Drose, S., and K. Altendorf. 1997. Bafilomycins and concanamycins as inhibitors of V-ATPases and P-ATPases. J. Exp. Biol. 200:1–8.[Abstract]

Eitzen, G., N. Thorngren, and W. Wickner. 2001. Rho1p and Cdc42p act after Ypt7p to regulate vacuole docking. EMBO J. 20:5650–5656.[CrossRef][Medline]

Eitzen, G., L. Wang, N. Thorngren, and W. Wickner. 2002. Remodeling of organelle-bound actin is required for yeast vacuole fusion. J. Cell Biol. 158:669–679.[Abstract/Free Full Text]

Fernandez-Chacon, R., and T.C. Sudhof. 2000. Novel SCAMPs lacking NPF repeats: ubiquitous and synaptic vesicle-specific forms implicate SCAMPs in multiple membrane-trafficking functions. J. Neurosci. 20:7941–7950.[Abstract/Free Full Text]

Fernandez-Chacon, R., M. Achiriloaie, R. Janz, J.P. Albanesi, and T.C. Sudhof. 2000. SCAMP1 function in endocytosis. J. Biol. Chem. 275:12752–12756.[Abstract/Free Full Text]

Fernandez-Chacon, R., A. Konigstorfer, S.H. Gerber, J. Garcia, M.F. Matos, C.F. Stevens, N. Brose, J. Rizo, C. Rosenmund, and T.C. Sudhof. 2001. Synaptotagmin I functions as a calcium regulator of release probability. Nature. 410:41–49.[CrossRef][Medline]

Forster, C., and P.M. Kane. 2000. Cytosolic Ca2+ homeostasis is a constitutive function of the V-ATPase in Saccharomyces cerevisiae. J. Biol. Chem. 275:38245–38253.[Abstract/Free Full Text]

Gluck, S., S. Kelly, and Q. Al-Awqati. 1982. The proton translocating ATPase responsible for urinary acidification. J. Biol. Chem. 257:9230–9233.[Abstract/Free Full Text]

Gotte, M., T. Lazar, J.S. Yoo, D. Scheglmann, and D. Gallwitz. 2000. The full complement of yeast Ypt/Rab-GTPases and their involvement in exo- and endocytic trafficking. Subcell. Biochem. 34:133–173.[Medline]

Guldener, U., S. Heck, T. Fielder, J. Beinhauer, and J.H. Hegemann. 1996. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic Acids Res. 24:2519–2524.[Abstract/Free Full Text]

Guo, W., F. Tamanoi, and P. Novick. 2001. Spatial regulation of the exocyst complex by Rho1 GTPase. Nat. Cell Biol. 3:353–360.[CrossRef][Medline]

Guo, Z., L. Liu, D. Cafiso, and D. Castle. 2002. Perturbation of a very late step of regulated exocytosis by a secretory carrier membrane protein (SCAMP2)-derived peptide. J. Biol. Chem. 277:35357–35363.[Abstract/Free Full Text]

Haas, A., and W. Wickner. 1996. Homotypic vacuole fusion requires Sec17p (yeast alpha-SNAP) and Sec18p (yeast NSF). EMBO J. 15:3296–3305.[Medline]

Haas, A., B. Conradt, and W. Wickner. 1994. G-protein ligands inhibit in vitro reactions of vacuole inheritance. J. Cell Biol. 126:87–97.[Abstract/Free Full Text]

Haas, A., D. Scheglmann, T. Lazar, D. Gallwitz, and W. Wickner. 1995. The GTPase Ypt7p of Saccharomyces cerevisiae is required on both partner vacuoles for the homotypic fusion step of vacuole inheritance. EMBO J. 14:5258–5270.[Medline]

Hirata, R., L.A. Graham, A. Takatsuki, T.H. Stevens, and Y. Anraku. 1997. VMA11 and VMA16 encode second and third proteolipid subunits of the Saccharomyces cerevisiae vacuolar membrane H+-ATPase. J. Biol. Chem. 272:4795–4803.[Abstract/Free Full Text]

Kane, P.M. 1999. Biosynthesis and regulation of the yeast vacuolar H+-ATPase. J. Bioenerg. Biomembr. 31:49–56.[CrossRef][Medline]

Kane, P.M., and K.J. Parra. 2000. Assembly and regulation of the yeast vacuolar H(+)-ATPase. J. Exp. Biol. 203:81–87.[Abstract]

Kane, P.M., C.T. Yamashiro, and T.H. Stevens. 1989. Biochemical characterization of the yeast vacuolar H(+)-ATPase. J. Biol. Chem. 264:19236–19244.[Abstract/Free Full Text]

Kato, M., and W. Wickner. 2001. Ergosterol is required for the Sec18/ATP-dependent priming step of homotypic vacuole fusion. EMBO J. 20:4035–4040.[CrossRef][Medline]

Kawasaki-Nishi, S., K. Bowers, T. Nishi, M. Forgac, and T.H. Stevens. 2001a. The amino-terminal domain of the vacuolar proton-translocating ATPase a subunit controls targeting and in vivo dissociation, and the carboxyl-terminal domain affects coupling of proton transport and ATP hydrolysis. J. Biol. Chem. 276:47411–47420.[Abstract/Free Full Text]

Kawasaki-Nishi, S., T. Nishi, and M. Forgac. 2001b. Yeast V-ATPase complexes containing different isoforms of the 100-kDa a-subunit differ in coupling efficiency and in vivo dissociation. J. Biol. Chem. 276:17941–17948.[Abstract/Free Full Text]

Klionsky, D.J., P.K. Herman, and S.D. Emr. 1990. The fungal vacuole: composition, function, and biogenesis. Microbiol. Rev. 54:266–292.[Abstract/Free Full Text]

Laage, R., and C. Ungermann. 2001. The N-terminal domain of the t-SNARE Vam3p coordinates priming and docking in yeast vacuole fusion. Mol. Biol. Cell. 12:3375–3385.[Abstract/Free Full Text]

Leveque, C., O. el Far, N. Martin-Moutot, K. Sato, R. Kato, M. Takahashi, and M.J. Seagar. 1994. Purification of the N-type calcium channel associated with syntaxin and synaptotagmin. A complex implicated in synaptic vesicle exocytosis. J. Biol. Chem. 269:6306–6312.[Abstract/Free Full Text]

Lindau, M., and W. Almers. 1995. Structure and function of fusion pores in exocytosis and ectoplasmic membrane fusion. Curr. Opin. Cell Biol. 7:509–517.[CrossRef][Medline]

Mahal, L.K., S.M. Sequeira, J.M. Gureasko, and T.H. Sollner. 2002. Calcium-independent stimulation of membrane fusion and SNAREpin formation by synaptotagmin I. J. Cell Biol. 158:273–282.[Abstract/Free Full Text]

Manolson, M.F., B. Wu, D. Proteau, B.E. Taillon, B.T. Roberts, M.A. Hoyt, and E.W. Jones. 1994. STV1 gene encodes functional homologue of 95-kDa yeast vacuolar H(+)- ATPase subunit Vph1p. J. Biol. Chem. 269:14064–14074.[Abstract/Free Full Text]

Mayer, A. 2001. What drives membrane fusion in eukaryotes? Trends Biochem. Sci. 26:717–723.[CrossRef][Medline]

Mayer, A., and W. Wickner. 1997. Docking of yeast vacuoles is catalyzed by the Ras-like GTPase Ypt7p after symmetric priming by Sec18p (NSF). J. Cell Biol. 136:307–317.[Abstract/Free Full Text]

Mayer, A., W. Wickner, and A. Haas. 1996. Sec18p (NSF)-driven release of Sec17p (alpha-SNAP) can precede docking and fusion of yeast vacuoles. Cell. 85:83–94.[CrossRef][Medline]

Mayer, A., D. Scheglmann, S. Dove, A. Glatz, W. Wickner, and A. Haas. 2000. Phosphatidylinositol 4,5-bisphosphate regulates two steps of homotypic vacuole fusion. Mol. Biol. Cell. 11:807–817.[Abstract/Free Full Text]

Moriyama, Y., and N. Nelson. 1989. Cold inactivation of vacuolar proton-ATPases. J. Biol. Chem. 264:3577–3582.[Abstract/Free Full Text]

Muller, O., D.I. Johnson, and A. Mayer. 2001. Cdc42p functions at the docking stage of yeast vacuole membrane fusion. EMBO J. 20:5657–5665.[CrossRef][Medline]

Muller, O., M.J. Bayer, C. Peters, J.S. Andersen, M. Mann, and A. Mayer. 2002. The Vtc proteins in vacuole fusion: coupling NSF activity to V0 trans-complex formation. EMBO J. 21:259–269.[CrossRef][Medline]

Neher, E. 1998. Vesicle pools and Ca2+ microdomains: new tools for understanding their roles in neurotransmitter release. Neuron. 20:389–399.[CrossRef][Medline]

Nichols, B.J., C. Ungermann, H.R. Pelham, W.T. Wickner, and A. Haas. 1997. Homotypic vacuolar fusion mediated by t- and v-SNAREs. Nature. 387:199–202.[CrossRef][Medline]

Ohsumi, Y., and Y. Anraku. 1981. Active transport of basic amino acids driven by a proton motive force in vacuolar membrane vesicles of Saccharomyces cerevisiae. J. Biol. Chem. 256:2079–2082.[Abstract/Free Full Text]

Ohsumi, Y., and Y. Anraku. 1983. Calcium transport driven by a proton motive force in vacuolar membrane vesicles of Saccharomyces cerevisiae. J. Biol. Chem. 258:5614–5617.[Abstract/Free Full Text]

Parlati, F., T. Weber, J.A. McNew, B. Westermann, T.H. Sollner, and J.E. Rothman. 1999. Rapid and efficient fusion of phospholipid vesicles by the alpha-helical core of a SNARE complex in the absence of an N-terminal regulatory domain. Proc. Natl. Acad. Sci. USA. 96:12565–12570.[Abstract/Free Full Text]

Parra, K.J., and P.M. Kane. 1998. Reversible association between the V1 and V0 domains of yeast vacuolar H+-ATPase is an unconventional glucose-induced effect. Mol. Cell. Biol. 18:7064–7074.[Abstract/Free Full Text]

Pelham, H.R. 2001. SNAREs and the specificity of membrane fusion. Trends Cell Biol. 11:99–101.[CrossRef][Medline]

Perzov, N., V. Padler-Karavani, H. Nelson, and N. Nelson. 2002. Characterization of yeast V-ATPase mutants lacking Vph1p or Stv1p and the effect on endocytosis. J. Exp. Biol. 205:1209–1219.[Abstract/Free Full Text]

Peters, C., and A. Mayer. 1998. Ca2+/calmodulin signals the completion of docking and triggers a late step of vacuole fusion. Nature. 396:575–580.[CrossRef][Medline]

Peters, C., P.D. Andrews, M.J. Stark, S. Cesaro-Tadic, A. Glatz, A. Podtelejnikov, M. Mann, and A. Mayer. 1999. Control of the terminal step of intracellular membrane fusion by protein phosphatase 1. Science. 285:1084–1087.[Abstract/Free Full Text]

Peters, C., M.J. Bayer, S. Buhler, J.S. Andersen, M. Mann, and A. Mayer. 2001. Trans-complex formation by proteolipid channels in the terminal phase of membrane fusion. Nature. 409:581–588.[CrossRef][Medline]

Powell, B., L.A. Graham, and T.H. Stevens. 2000. Molecular characterization of the yeast vacuolar H+-ATPase proton pore. J. Biol. Chem. 275:23654–23660.[Abstract/Free Full Text]

Price, A., D. Seals, W. Wickner, and C. Ungermann. 2000a. The docking stage of yeast vacuole fusion requires the transfer of proteins from a cis-SNARE complex to a Rab/Ypt protein. J. Cell Biol. 148:1231–1238.[Abstract/Free Full Text]

Price, A., W. Wickner, and C. Ungermann. 2000b. Proteins needed for vesicle budding from the Golgi complex are also required for the docking step of homotypic vacuole fusion. J. Cell Biol. 148:1223–1229.[Abstract/Free Full Text]

Raymond, C.K., I. Howald-Stevenson, C.A. Vater, and T.H. Stevens. 1992. Morphological classification of the yeast vacuolar protein sorting mutants: evidence for a prevacuolar compartment in class E vps mutants. Mol. Biol. Cell. 3:1389–1402.[Abstract]

Rohde, J., L. Dietrich, D. Langosch, and C. Ungermann. 2003. The transmembrane domain of Vam3 affects the composition of cis- and trans-SNARE complexes to promote homotypic vacuole fusion. J. Biol. Chem. 278:1656–1662.[Abstract/Free Full Text]

Rothman, J.E. 1994. Mechanisms of intracellular protein transport. Nature. 372:55–63.[CrossRef][Medline]

Sato, T., Y. Ohsumi, and Y. Anraku. 1984. Substrate specificities of active transport systems for amino acids in vacuolar-membrane vesicles of Saccharomyces cerevisiae. Evidence of seven independent proton/amino acid antiport systems. J. Biol. Chem. 259:11505–11508.[Abstract/Free Full Text]

Sato, T.K., P. Rehling, M.R. Peterson, and S.D. Emr. 2000. Class C Vps protein complex regulates vacuolar SNARE pairing and is required for vesicle docking/fusion. Mol. Cell. 6:661–671.[CrossRef][Medline]

Seals, D.F., G. Eitzen, N. Margolis, W.T. Wickner, and A. Price. 2000. A Ypt/Rab effector complex containing the Sec1 homolog Vps33p is required for homotypic vacuole fusion. Proc. Natl. Acad. Sci. USA. 97:9402–9407.[Abstract/Free Full Text]

Seeley, E.S., M. Kato, N. Margolis, W. Wickner, and G. Eitzen. 2002. Genomic analysis of homotypic vacuole fusion. Mol. Biol. Cell. 13:782–794.[Abstract/Free Full Text]

Sheng, Z.H., J. Rettig, M. Takahashi, and W.A. Catterall. 1994. Identification of a syntaxin-binding site on N-type calcium channels. Neuron. 13:1303–1313.[CrossRef][Medline]

Shimomura, O., B. Musicki, Y. Kishi, and S. Inouye. 1993. Light-emitting properties of recombinant semi-synthetic aequorins and recombinant fluorescein-conjugated aequorin for measuring cellular calcium. Cell Calcium. 14:373–378.[CrossRef][Medline]

Singleton, D.R., T.T. Wu, and J.D. Castle. 1997. Three mammalian SCAMPs (secretory carrier membrane proteins) are highly related products of distinct genes having similar subcellular distributions. J. Cell Sci. 110:2099–2107.[Abstract]

Slusarewicz, P., Z. Xu, K. Seefeld, A. Haas, and W.T. Wickner. 1997. I2B is a small cytosolic protein that participates in vacuole fusion. Proc. Natl. Acad. Sci. USA. 94:5582–5587.[Abstract/Free Full Text]

Sollner, T., S.W. Whiteheart, M. Brunner, H. Erdjument-Bromage, S. Geromanos, P. Tempst, and J.E. Rothman. 1993. SNAP receptors implicated in vesicle targeting and fusion. Nature. 362:318–324.[CrossRef][Medline]

Stevens, T.H., and M. Forgac. 1997. Structure, function and regulation of the vacuolar (H+)-ATPase. Annu. Rev. Cell Dev. Biol. 13:779–808.[CrossRef][Medline]

Ungermann, C., B.J. Nichols, H.R. Pelham, and W. Wickner. 1998a. A vacuolar v-t-SNARE complex, the predominant form in vivo and on isolated vacuoles, is disassembled and activated for docking and fusion. J. Cell Biol. 140:61–69.[Abstract/Free Full Text]

Ungermann, C., K. Sato, and W. Wickner. 1998b. Defining the functions of trans-SNARE pairs. Nature. 396:543–548.[CrossRef][Medline]

Ungermann, C., G.F. von Mollard, O.N. Jensen, N. Margolis, T.H. Stevens, and W. Wickner. 1999a. Three v-SNAREs and two t-SNAREs, present in a pentameric cis-SNARE complex on isolated vacuoles, are essential for homotypic fusion. J. Cell Biol. 145:1435–1442.[Abstract/Free Full Text]

Ungermann, C., W. Wickner, and Z. Xu. 1999b. Vacuole acidification is required for trans-SNARE pairing, LMA1 release, and homotypic fusion. Proc. Natl. Acad. Sci. USA. 96:11194–11199.[Abstract/Free Full Text]

Veit, M., R. Laage, L. Dietrich, L. Wang, and C. Ungermann. 2001. Vac8p release from the SNARE complex and its palmitoylation are coupled and essential for vacuole fusion. EMBO J. 20:3145–3155.[CrossRef][Medline]

Wada, Y., and Y. Anraku. 1994. Chemiosmotic coupling of ion transport in the yeast vacuole: its role in acidification inside organelles. J. Bioenerg. Biomembr. 26:631–637.[CrossRef][Medline]

Wada, Y., Y. Ohsumi, and Y. Anraku. 1992a. Chloride transport of yeast vacuolar membrane vesicles: a study of in vitro vacuolar acidification. Biochim. Biophys. Acta. 1101:296–302.[CrossRef][Medline]

Wada, Y., Y. Ohsumi, and Y. Anraku. 1992b. Genes for directing vacuolar morphogenesis in Saccharomyces cerevisiae. I. Isolation and characterization of two classes of vam mutants. J. Biol. Chem. 267:18665–18670.[Abstract/Free Full Text]

Wang, L., C. Ungermann, and W. Wickner. 2000. The docking of primed vacuoles can be reversibly arrested by excess Sec17p (alpha-SNAP). J. Biol. Chem. 275:22862–22867.[Abstract/Free Full Text]

Wang, L., E.S. Seeley, W. Wickner, and A.J. Merz. 2002. Vacuole fusion at a ring of vertex docking sites leaves membrane fragments within the organelle. Cell. 108:357–369.[CrossRef][Medline]

Wang, Y., I. Dulubova, J. Rizo, and T.C. Sudhof. 2001a. Functional analysis of conserved structural elements in yeast syntaxin Vam3p. J. Biol. Chem. 276:28598–28605.[Abstract/Free Full Text]

Wang, Y.X., E.J. Kauffman, J.E. Duex, and L.S. Weisman. 2001b. Fusion of docked membranes requires the armadillo repeat protein Vac8p. J. Biol. Chem. 276:35133–35140.[Abstract/Free Full Text]

Weber, T., B.V. Zemelman, J.A. McNew, B. Westermann, M. Gmachl, F. Parlati, T.H. Sollner, and J.E. Rothman. 1998. SNAREpins: minimal machinery for membrane fusion. Cell. 92:759–772.[CrossRef][Medline]

Wurmser, A.E., T.K. Sato, and S.D. Emr. 2000. New component of the vacuolar class C-Vps complex couples nucleotide exchange on the Ypt7 GTPase to SNARE-dependent docking and fusion. J. Cell Biol. 151:551–562.[Abstract/Free Full Text]

Xu, Z., and W. Wickner. 1996. Thioredoxin is required for vacuole inheritance in Saccharomyces cerevisiae. J. Cell Biol. 132:787–794.[Abstract/Free Full Text]

Xu, Z., A. Mayer, E. Muller, and W. Wickner. 1997. A heterodimer of thioredoxin and I(B)2 cooperates with Sec18p (NSF) to promote yeast vacuole inheritance. J. Cell Biol. 136:299–306.[Abstract/Free Full Text]

Xu, Z., K. Sato, and W. Wickner. 1998. LMA1 binds to vacuoles at Sec18p (NSF), transfers upon ATP hydrolysis to a t-SNARE (Vam3p) complex, and is released during fusion. Cell. 93:1125–1134.[CrossRef][Medline]

Zhang, X., E. Bi, P. Novick, L. Du, K.G. Kozminski, J.H. Lipschutz, and W. Guo. 2001. Cdc42 interacts with the exocyst and regulates polarized secretion. J. Biol. Chem. 276:46745–46750.[Abstract/Free Full Text]

Zimmerberg, J. 2001. How can proteolipids be central players in membrane fusion? Trends Cell Biol. 11:233–235.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 185K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JCB
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bayer, M. J.
Right arrow Articles by Mayer, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bayer, M. J.
Right arrow Articles by Mayer, A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?


  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents