|
||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
© The Rockefeller University Press,
0021-9525/2003/9/843 $5.00
The Journal of Cell Biology, Volume 162, Number 5, 843-850
Article |
Repression of slow myosin heavy chain 2 gene expression in fast skeletal muscle fibers by muscarinic acetylcholine receptor and G
q signaling
Address correspondence to Joseph X. DiMario, Dept. of Cell Biology and Anatomy, Chicago Medical School, 3333 Green Bay Rd., North Chicago, IL 60064. Tel: (847) 578-8633. Fax: (847) 578-3253. email: dimarioj{at}finchcms.edu
| Abstract |
|---|
|
|
|---|
Gene expression in skeletal muscle fibers is regulated by innervation and intrinsic fiber properties. To determine the mechanism of repression of slow MyHC2 expression in innervated fast pectoralis major (PM) fibers, we investigated the function of the muscarinic acetylcholine receptor (mAchR) and G
q. Both mAchR and G
q are abundant in medial adductor (MA) and PM fibers, and mAchR and G
q interact in these fibers. Whereas innervation of PM fibers was insufficient to induce slow MyHC2 expression, inhibition of mAchR activity with atropine in innervated PM fibers induced slow MyHC2 expression. Increased G
q activity repressed slow MyHC2 expression to nondetectable levels in innervated MA fibers. Reduced mAchR activity decreased PKC activity in PM fibers, and increased G
q activity increased PKC activity in PM and MA fibers. Decreased PKC activity in atropine-treated innervated PM fibers correlated with slow MyHC2 expression. These data suggest that slow MyHC2 repression in innervated fast PM fibers is mediated by cell signaling involving mAchRs, G
q, and PKC.
Key Words: mAchR; innervation; fiber type; MyHC; PKC
| Introduction |
|---|
|
|
|---|
For decades, it has been known that cues extrinsic to muscle fibers such as innervation, activity, and hormones influence patterns of contractile protein gene expression and corresponding muscle function. Studies using cross-reinnervation and denervation have demonstrated the substantive role of innervation in the regulation of whole muscle contractile activity and patterns of gene expression within individual muscle fibers (Pette and Vrbova, 1985). However, in contrast to the extensive body of work linking innervation with fiber typespecific gene expression, the cellular and molecular mechanisms that mediate the innervation-induced changes in contractile protein gene expression are only beginning to be elucidated.
In addition to extrinsic regulation of muscle fiber phenotype, avian skeletal muscle fibers also display patterns of MyHC gene expression that are intrinsically restricted to distinct myogenic cell lineages (Stockdale, 1997). These cell lineagedependent, fiber typespecific patterns of fast versus slow MyHC gene expression were first observed in primary muscle fibers formed from embryonic myoblasts (Miller and Stockdale, 1986a; DiMario et al., 1993), but have since been demonstrated in secondary muscle fibers formed from fetal myoblasts as well (DiMario and Stockdale, 1997). Fetal chicken myoblasts appear in hypaxial musculature at approximately embryonic day 8 (ED8; Feldman and Stockdale, 1992). Continued proliferation and differentiation of fetal myoblasts through ED18 contributes to the formation of the majority of skeletal muscle fibers in the adult. The distribution pattern of secondary muscle fibers formed from fetal myoblasts and the fiber typedefining pattern of fast versus slow MyHC gene expression in vivo is reflective of the innervation independent pattern of MyHC gene expression in primary muscle fibers. All primary and secondary muscle fibers of the medial adductor (MA) muscle express fast MyHC genes and the slow MyHC2 gene (Page et al., 1992). All primary and secondary muscle fibers of the pectoralis major (PM) muscle (except the superior red strip) express only fast MyHC genes. Although MA and PM secondary muscle fibers differ in their expression of slow MyHC2 in vivo, muscle fibers derived from fetal MA and PM myoblasts only express fast MyHC genes in vitro. However, muscle fibers formed from fetal slow MA myoblasts have been induced to express slow MyHC2 by innervation from randomized spinal cord explants in vitro (DiMario and Stockdale, 1997). Furthermore, innervated muscle fibers formed from fast PM fetal myoblasts in vitro were repressed in their expression of slow MyHC2.
Functional innervation of skeletal muscle fibers causes fiber depolarization, release of intracellular calcium from the sarcoplasmic reticulum, and activation of calcium responsive biochemical cascades. A number of studies in a variety of cell types have correlated cell depolarization with changes in transcription factor activity. For instance, depolarization of pancreatic ß cells activated nuclear factor
B (Bernal-Mizrachi et al., 2002), and potassium depolarization of skeletal muscle cells resulted in phosphorylation of cycle adenosine monophosphate (cAMP)responsive element (Jaimovich and Carrasco, 2002). Other recent evidence has indicated that free intracellular calcium amplitudes and transients characteristic of slow skeletal muscle fibers activates the protein phosphatase, calcineurin, which may then dephosphorylate members of the nuclear factor of activated T cell transcription factor family. Dephosphorylated nuclear factor of activated T cells can be imported into the nuclear compartment where they are proposed to activate transcription of genes indicative of the slow fiber phenotype, such as slow troponin I (Chin et al., 1998).
Cellular innervation also elicits signal transduction cascades initiated by cell surface receptors. These signaling cascades are often transduced from cell surface receptors to intracellular signaling molecules by heterotrimeric guanine nucleotide-binding proteins (G proteins). Skeletal muscle contains G
q, a G
isoform that is insensitive to pertussis toxin. Activated G
q causes activation of phospholipase Cß and subsequent generation of inositol triphosphate (IP3) and diacylglycerol (DAG; Taylor et al., 1991; Wilkie et al., 1991; Wu et al., 1992). In vertebrate cardiac tissue, G
q is associated with the M1 muscarinic acetylcholine receptor (mAchR) and, in conjunction with calcineurin, may mediate signal transduction pathways leading to physiological responses, such as cardiac hypertrophy with accompanying changes in MyHC gene expression (Mende et al., 1998). Very little is known regarding the function of mAchRs and G
q in skeletal muscle. Of the five types of identified mAchRs, type M1 AchR is present in skeletal muscle cells. Studies using the muscarinic antagonist, atropine, have demonstrated that mAchRs regulate glucose uptake in C2C12 cells and that muscle fiberassociated mAchRs bind acetylcholine released from motor neurons (Welsh and Segal, 1997; Liu et al., 2002). G
q-stimulated production of DAG and IP3 by PLC and release of calcium via intracellular calcium release channels, such as the ryanodine and IP3 receptors, provide intracellular activators of PKC. Interestingly, several studies have implicated PKC activity in the depolarization and activity-dependent regulation of skeletal muscle genes such as the nicotinic AchR (nAchR), N-CAM, and N-cadherin (Klarsfeld et al., 1989; Hahn and Covault, 1992; Rafuse and Landmesser, 1996). In addition, expression of slow MyHC2 is regulated by both innervation and PKC activity (DiMario and Funk, 1999; DiMario, 2001). Innervation-induced expression of slow MyHC2 in MA muscle fibers is accompanied by decreased PKC activity. Furthermore, overexpression of PKC abrogates slow MyHC2 expression in innervated MA muscle fibers.
Here, we examine the cellular mechanisms controlling innervation-induced expression of slow MyHC2 in a fiber typespecific manner in the context of cell lineage restriction. Using an in vitro nervemuscle coculture system, we demonstrate that mAchR and G
q are associated in innervated fast and slow skeletal muscle fibers. mAchR and G
q signaling increased PKC activities in PM and MA muscle fibers. Conversely, inhibition of mAchR activity in innervated fast PM muscle fibers resulted in fiber-type transition and expression of slow MyHC2. Furthermore, constitutively active G
q repressed slow MyHC2 expression in innervated slow MA muscle fibers.
| Results |
|---|
|
|
|---|
q may be present as potential regulators of PKC activity in PM and MA muscle fibers. To determine whether chicken PM and MA muscle express mAchR and G
q, Western blots were performed on whole muscle cell extracts using M1 type mAchR and G
q antibodies (Fig. 1). Both PM and MA contained readily detectable mAchR and G
q in approximately equal amounts. These results are in agreement with studies of murine skeletal muscle in which G
q and G
11 mRNAs were present, and G
14 and G
15 mRNAs were absent (Strathmann and Simon, 1990; Wilkie et al., 1991).
|
q proteins interact in PM and MA muscle cells, myogenic cultures were transfected with the expression construct, G
qFLAG, which constitutively expressed wild-type G
q coupled to a FLAG epitope. ED5 spinal cord explants were added to some of the plates of transfected cells to provide the muscle fibers with motor neuron innervation (DiMario and Stockdale, 1997). mAchRG
qFLAG complexes were coimmunoprecipitated using an anti-mAchR antibody. Complexes were then denatured and Western blotted (Fig. 2). G
q, which coimmunoprecipitated with mAchR, was detected with an anti-FLAG epitope antibody. G
qFLAG in transfected cultures of PM and MA with and without innervation coimmunoprecipitated with the mAchR. G
qFLAG was not detected in extracts from nontransfected cells or in extracts carried through the coimmunoprecipitation procedure without the mAchR antibody. To determine whether the mAchRG
q interaction in transfected cells was specific, protein extract was incubated with
-actin antibody. No G
qFLAG was detected in protein extracts immunoprecipitated with
-actin antibody. Therefore, G
q and mAchR interact in both innervated and noninnervated PM and MA muscle cells.
|
|
|
q, we hypothesized that mAchR activitydependent repression of slow MyHC2 expression was mediated by G
q signaling. To test this hypothesis, a constitutively active, GTPase-deficient G
q expression construct, CMVG
qQ209LFLAG, was generated yielding a single amino acid substitution (Q209
L209) and transfected into MA myogenic cultures. Similar mutations have resulted in constitutively active G
q (Wu et al., 1992; Qian et al., 1993). As shown above (Figs. 3 and 4), MA muscle fibers expressed slow MyHC2 when innervated and, therefore, these muscle fibers provide the most appropriate basis for forced repression of slow MyHC2 expression. Transfected muscle fibers were identified with an anti-FLAG epitope antibody, and fast and slow MyHC2 were detected with F59 and S58 antibodies, respectively (Fig. 5). In addition, innervation of muscle fibers was visualized by detection of nAchR clusters using rhodamine-conjugated
-bungarotoxin. Whereas innervated, nontransfected MA muscle fibers expressed slow MyHC2 (Fig. 5 A), innervated MA muscle fibers expressing G
qQ209LFLAG did not immunostain with S58 (Fig. 5 B). No muscle fibers containing detectable amounts of G
qQ209LFLAG expressed slow MyHC2. In contrast, expression of wild-type G
qFLAG in innervated MA muscle fibers did not repress slow MyHC2 expression. Importantly, expression of G
qQ209LFLAG did not prevent MA muscle fiber innervation as indicated by clusters of nAchRs. In this culture system, these clusters are only evident when muscle fibers are innervated by spinal cord explants (DiMario and Stockdale, 1997). PM muscle fibers, whether innervated and/or transfected with CMVG
qQ209LFLAG, did not express slow MyHC2 as determined by immunostaining (unpublished data). Therefore, G
q activity repressed slow MyHC2 expression in innervated MA muscle fibers.
|
q activities was mediated by PKC activity. To determine whether mAchR and G
q signaling controlled PKC activities in PM and MA muscle fibers, PKC activities were directly determined in cytoplasmic and membrane fractions obtained from PM and MA muscle fiber cultures (Fig. 6). These cultures were generated by incubation of noninnervated and innervated PM and MA muscle fibers in control medium and/or in medium containing 200 µM atropine. In addition, cytoplasmic and membrane fractions were obtained from PM and MA muscle fiber cultures transfected with CMVG
qQ209LFLAG. Membrane versus cytoplasmic PKC activities were determined to quantitate membrane-associated active PKC in the cultures. Noninnervated PM muscle fibers contained 2.5-fold more PKC activity than noninnervated MA muscle fibers. This is in agreement with previous studies examining PKC activities in avian and mammalian fast versus slow type muscles (Donnelly et al., 1994; DiMario and Funk, 1999). Innervation of both PM and MA muscle fibers significantly reduced PKC activities. Innervation of PM muscle fibers resulted in an
33% reduction in membrane versus cytoplasmic PKC activity. PM muscle fibers incubated in medium containing atropine also yielded reduced PKC activity by 41%. Combination of innervation of PM muscle fibers and incubation in medium containing atropine resulted in a significant, additive inhibition of PKC activity. PKC activities in MA muscle fibers incubated in control medium or medium containing atropine were not significantly different. Last, both PM and MA muscle fiber cultures expressing constitutively active G
q yielded significantly increased PKC activities. These results indicate that direct modulation of mAchR and G
q activities affects downstream PKC activities, particularly in PM muscle fibers. Reduced mAchR/G
q signaling resulted in reduced PKC activity, and increased mAchR/G
q signaling increased PKC activity.
|
| Discussion |
|---|
|
|
|---|
Here, we have begun to identify the mechanism by which expression of slow MyHC2 and the slow muscle fiber phenotype is repressed in innervated fast muscle fibers. Based on previous findings that inhibition of PKC activity in noninnervated MA muscle fibers was sufficient to induce slow MyHC2 expression, that innervated and noninnervated PM muscle fibers contained significantly greater PKC activity, and that innervation of muscle fibers decreased PKC activity, we hypothesized that a signaling cascade mediating innervation with PKC activity at least partly defined the intrinsic repression of slow MyHC2 expression in innervated fast PM muscle fibers.
PKC activity is regulated via activity of PLC, which generates DAG and IP3. In turn, PLC is activated from cell surface receptors via the heterotrimeric guanine nucleotide binding protein G
q. To determine whether the cell surface receptor, mAchR, and G
q were present in PM and MA muscle fibers, Western blots were performed. Both mAchR and G
q were readily detectable in PM and MA muscle fibers. Furthermore, mAchR and G
q were coimmunoprecipitated, indicating a physical, and potentially functional, interaction. These results are in agreement with independent investigations that demonstrated expression of G
q in skeletal muscle (Wilkie et al., 1991) and that functional mAchRs are present in cultured skeletal muscle fibers (Reyes and Jaimovich, 1996). Furthermore, mAchRs can be activated by acetylcholine from neuromuscular junctions (Welsh and Segal, 1997).
Functionality of mAchRs with regard to slow MyHC2 expression was examined in PM and MA muscle fibers. Innervated and noninnervated PM and MA muscle fibers were incubated in medium containing 200 µM atropine, an antagonist of mAchRs. Based on immunostaining for fast MyHCs and slow MyHC2, atropine had no effect on MA muscle fibers. However, incubation of innervated PM muscle fibers in medium containing atropine induced slow MyHC2 expression and resulted in a fiber-type transition. This is the first report documenting avian fast muscle fiber-type transition to a slow muscle fiber phenotype.
G
q transduces activation of mAchRs to downstream targets, such as PLC. To determine whether G
q signaling regulates slow MyHC2 expression, a constitutively active, GTPase deficient mutation of G
q was generated. Identical mutations of G
q Q209
L209 resulted in unregulated active G
q (Qian et al., 1993; Mende et al., 1998). Expression of constitutively active G
q in innervated MA muscle fibers repressed slow MyHC2 expression, whereas expression of wild-type G
q had no detectable effect on slow MyHC2 expression. Activated G
q did not negate innervation of MA muscle fibers. Therefore, repression of slow MyHC2 expression was due to G
q activity and not due to lack of innervation. Together, these results indicate that cell signaling via mAchR and G
q represses slow MyHC2 expression. This mechanism appears to be normally operative in PM muscle fibers since inhibition of mAchR activity in innervated PM muscle fibers resulted in derepression of slow MyHC2 expression. Furthermore, activation of the mAchRG
q pathway in innervated, normally slow MA muscle fibers repressed slow MyHC2 expression and yielded a slow to fast fiber-type transition.
Based on previous findings indicating that increased PKC activity repressed slow MyHC2 expression (DiMario, 2001), we hypothesized that repression of slow MyHC2 expression by activated G
q would be accompanied by increased PKC activity. Measurements of PKC activities in innervated and noninnervated PM and MA muscle fibers incubated in medium with and without atropine indicated that decreased PKC activity was correlated with slow MyHC2 expression. As described previously (DiMario, 2001), fast muscle fibers contain greater PKC activity than slow fibers, whether innervated or not. Interestingly innervation reduced PKC activity in both PM and MA muscle fiber types, although PKC activity in innervated PM was greater than the activities in innervated and noninnervated MA muscle fibers. The mechanism by which innervation reduces PKC activity is currently not known. PKC activity in noninnervated PM muscle fibers was also reduced by incubation in medium containing atropine. PKC activity in MA muscle fibers was unaffected by atropine. The reduction in PM muscle fiber PKC activity is likely due to inhibition of a basal level of mAchRG
q activation of PKC. Importantly, addition of atropine to innervated PM muscle fibers reduced PKC activity to levels that were not significantly different from activities in innervated MA muscle fibers with and without atropine. These three experimental conditions (MA plus innervation, MA plus innervation plus atropine, and PM plus innervation plus atropine) resulted in slow MyHC2 expression.
Regulation of muscle fiber gene expression by mechanisms initiated by electrical and contractile activities and mediated by PKC activity have been demonstrated for expression of nAchR, N-CAM, and N-cadherin (Klarsfeld et al., 1989; Hahn and Covault, 1992; Rafuse and Landmesser, 1996). Based on the evidence that innervation reduces PKC activity in MA and PM muscle fibers and that inhibition of mAchR activity is required for slow MyHC2 expression in innervated PM muscle fibers, it is proposed that multiple signaling pathways regulate PKC activity and ultimately slow MyHC2 expression in PM muscle fibers. Reduction of PKC activity in innervated PM muscle fibers is blunted by concomitant activation via mAchRG
q signaling. This intermediate reduction in PKC activity is insufficient to de-repress slow MyHC2 expression.
It is not known if mAchRG
q activation of PKC occurs in innervated MA muscle fibers. Similar to PM muscle fibers, MA muscle fibers contain readily detectable levels of both mAchR and G
q. mAchR and G
q were coimmunoprecipitated in extracts of innervated and noninnervated MA muscle fibers. Yet, incubation of MA muscle fibers in medium containing atropine did not significantly reduce PKC activity as it did in PM muscle fibers. Furthermore, MA PKC activity did significantly increase due to constitutive expression of active G
q. Therefore, mAchRG
q signaling may be uncoupled from modulation of PKC or repressed by an impinging signaling circuit in MA muscle fibers.
In total, these results suggest that innervation of MA muscle fibers causes a reduction in PKC activity and that, as shown previously (DiMario, 2001), this is sufficient to induce a signaling cascade leading to slow MyHC2 expression. In PM muscle fibers, innervation causes a reduction in PKC activity, but this reduction is tempered by cell signaling via mAchRG
q, which tends to increase PKC activity. This modulation of PKC activity is evident in the partial reduction of PKC activity in innervated PM muscle fibers and in fibers exposed to atropine. These declines yield PKC activities that are significantly greater than MA muscle fibers under any nontransfected experimental condition. Combination of innervation and atropine exposure reduced PKC activity in PM muscle fibers to levels that were not significantly different than the PKC activities in MA muscle fibers, and it was this experimental condition (spinal cord plus atropine) that resulted in slow MyHC2 expression in formerly fast PM muscle fibers.
| Materials and methods |
|---|
|
|
|---|
qFLAG and 4 µg/dish CMVG
qQ209LFLAG were transfected using Lipofectamine Plus reagent (Life Technologies).
Immunofluorescence
Before fixation, some cultures were incubated in 100 nM rhodamineconjugated
-bungarotoxin (Molecular Probes) for 1 h at 37°C to visualize nAchR clusters. Cultures were washed twice with PBS and fixed in 100% ethanol for 5 min. Cells were then incubated in 5% horse serum and 2% BSA in PBS for 1 h at room temperature. Muscle fiber and nervemuscle cultures were immunostained for fast MyHCs and slow MyHC2 using mAbs F59 and S58, respectively, and diluted 1:10 in blocking solution for 1 h at room temperature. The specificities of these antibodies have been established previously (Crow and Stockdale, 1986). Cells were washed three times with PBS. F59 and S58 antibodies were detected by incubating fluorochrome-conjugated antimouse IgG (Vector Laboratories) and antimouse IgA (Southern Biotechnology Associates, Inc.) secondary antibodies, respectively, for 1 h at room temperature. Expression of G
qFLAG and G
qQ209LFLAG was immunodetected using an anti-FLAG epitope antibody (Sigma-Aldrich) diluted 1:1,000 in blocking solution for 1 h at room temperature. Cells were washed three times with PBS and coverslipped.
Coimmunoprecipitation and Western blotting
ED13 PM and MA cultures were transfected with CMVG
qFLAG on day 2 of incubation. ED5 spinal cord explants were added to half of the cultures on day 3 of incubation. On day 7 of incubation, cultures were washed twice with PBS and 1ml of dithiobis (succinimidylpropionate; Pierce Chemical Co.) diluted to 2 mM in PBS was added to each plate for 1 h at room temperature after which 1 M Tris, pH 7.5, was added to a final concentration of 20 mM for 15 min at room temperature. Cells were scraped in 750 µl RIPA buffer (1 x PBS, 1% Nonidet P-40, 0.5% sodium deoxycholate, and 0.1% SDS) and homogenized by 10 passages through a 22-gauge needle. All steps were performed at 4°C. The extracts were spun in a centrifuge (Eppendorf) for 10 min at 14,000 rpm. 1 µg nonspecific rabbit IgG was added to each sample and incubated for 30 min. Protein A/Gagarose beads (Santa Cruz Biotechnology, Inc.) were added to each sample and incubated for 1 h. The beads were pelleted at 2,500 rpm for 1 min and the supernatants were transferred to new tubes. 2 µg anti-mAchR antibody (Santa Cruz Biotechnology, Inc.) was added to the samples (except control samples) and incubated for 4 h. Control samples were incubated with 2 µg anti-G
q (Santa Cruz Biotechnology, Inc.) and anti
-actin (Sigma-Aldrich) antibodies. Protein A/Gagarose beads were added and incubated overnight. The agarose beads were washed three times by pelleting the beads at 2,500 rpm for 1 min and resuspending them with cold RIPA buffer. Denaturing electrophoresis sample buffer was added to the pelleted beads and heated to 70°C for 10 min. Protein extracts were run in a 10% SDS polyacrylamide gel and Western blotted. The blot was incubated in 2% nonfat dry milk, 0.05% Tween 20 in 1 x PBS for 1 h at room temperature, and with anti-FLAG antibody (Sigma-Aldrich) diluted 1:1,000 in blocking solution for 1 h. The blot was washed three times with 0.05% Tween 20 in PBS and incubated in HRP-conjugated antimouse IgG (Santa Cruz Biotechnology, Inc.) diluted 1:1,000 in blocking solution for 1 h. The blot was washed as before and incubated in Supersignal West Pico Chemiluminescent substrate (Pierce Chemical Co.) before X-ray film exposure.
Western blots of mAchR and G
q were similarly performed. ED13 PM and MA muscles were dissected and homogenized in 25 mM Tris, 1 mM EDTA, 50 mM NaCl, and 0.5% Triton X-100, pH 7.2. Each extract was electrophoresed in a 10% SDS polyacrylamide gel and blotted. Blots were incubated in anti-mAchR, anti-G
q, and ß-actin antibodies (Santa Cruz Biotechnology, Inc.) diluted 1:500 and processed as above (previous paragraph). For Western blots of MyHCs, innervated and noninnervated PM and MA muscle fiber cultures were scraped and homogenized on day 7 of incubation in 20 mM KCl, 2 mM K2HPO4, and 2 mM EGTA, pH 6.8. Extracts were incubated on ice overnight and centrifuged at 10,000 rpm in a rotor (model SS-34; Sorvall) for 20 min. The pellets were washed twice in homogenization buffer. Myosin was extracted from the pellets by resuspending the pellets in 80 mM Na4P2O7, 2 mM MgCl2, and 2 mM EGTA, pH 9.6. The extracts were incubated on ice for 2 h and centrifuged at 10,000 rpm for 20 min. Supernatants were collected and protein content was determined using a BCA protein assay (Pierce Chemical Co.). MyHCs were electrophoresed and blotted as above (previous paragraph). MyHCs were detected with F59 and S58 mAbs diluted 1:10 in blocking solution, followed by HRP-conjugated secondary antibodies as above (previous paragraph).
DNA constructs
Mouse G
q cDNA, provided by M.I. Simon (California Institute of Technology, Pasedena, CA; Strathmann and Simon, 1990), was amplified using the following oligonucleotides: GATCGAAAGCTTGACCAGATTGTACTCCTTC and GATCGAGCGGCCGCGCGAGGCACTTCGGAAGA. The PCR product was gel purified, digested with HinDIII and NotI restriction enzymes, and cloned into the CMVTAG4a expression vector (Stratagene). Correct, in-frame cloning relative to the FLAG epitope was verified by DNA sequencing. The following mutagenic oligonucleotides were used to PCR amplify the CMVG
qFLAG template DNA: GGTCGATGTAGGGGGCCTAAGGTCAGAGAGAAG and CTTCTCTCTGACCTTAGGCCCCCTACATCGACC. These oligonucleotides generated a point mutation (underlined codon) at glutamine 209
leucine 209 rendering G
q GTPase deficient and constitutively active (Qian et al., 1993). Mutagenesis was confirmed by DNA sequencing.
PKC assay
On day 7 of incubation, cultures of PM and MA muscle fibers were washed once with PBS and homogenized in cold 25 mM Tris, 1 mM EDTA, and 50 mM NaCl, pH 7.2, using a Dounce homogenizer type B. Extracts were spun in a centrifuge (Eppendorf) at 4°C for 10 min at 14,000 rpm. Supernatants were saved as cytoplasmic extracts. Pellets were resuspended in homogenization buffer containing 0.5% Triton X-100 and set on ice for 30 min. The extracts were spun for 10 min at 14,000 rpm and the supernatants were saved as membrane fractions. Protein concentrations were determined using a BCA protein assay reagent (Pierce Chemical Co.). PKC activities were determined using a PKC assay kit (Upstate Biotechnology) including inhibitors of PKA and CaM-dependent kinases.
| Acknowledgments |
|---|
This work was supported by a grant (AR45939) from the National Institutes of Health (to J.X. DiMario).
Submitted: 25 March 2003
Accepted: 16 July 2003
| References |
|---|
|
|
|---|
Bernal-Mizrachi, E., W. Wen, M. Shornick, and M.A. Permutt. 2002. Activation of nuclear factor-kappa b by depolarization and Ca(2+) influx in MIN6 insulinoma cells. Diabetes. 51:S484S488.
Chin, E.R., E.N. Olson, J.A. Richardson, Q. Yang, C. Humphries, J.M. Shelton, H. Wu, W. Zhu, R. Bassel-Duby, and R.S. Williams. 1998. A calcineurin-dependent transcriptional pathway controls skeletal muscle fiber type. Genes Dev. 12:24992509.
Crow, M.T., and F.E. Stockdale. 1986. The developmental program of fast myosin heavy chain expression in avian skeletal muscles. Dev. Biol. 118:333342.[CrossRef][Medline]
DiMario, J.X. 2001. Protein kinase C signaling controls skeletal muscle fiber types. Exp. Cell Res. 263:2332.[CrossRef][Medline]
DiMario, J.X., and F.E. Stockdale. 1997. Both myoblast lineage and innervation determine fiber type and are required for expression of the slow myosin heavy chain 2 gene. Dev. Biol. 188:167180.[CrossRef][Medline]
DiMario, J.X., and P.E. Funk. 1999. Protein kinase C activity regulates slow myosin heavy chain 2 gene expression in slow lineage skeletal muscle fibers. Dev. Dyn. 216:177189.[CrossRef][Medline]
DiMario, J.X., S.E. Fernyak, and F.E. Stockdale. 1993. Myoblasts transferred to the limbs of embryos are committed to specific fibre fates. Nature. 362:165167.[CrossRef][Medline]
Donnelly, R., M.J. Reed, S. Azhar, and G.M. Reaven. 1994. Expression of the major isoenzyme of protein kinase-C in skeletal muscle, nPKC
, varies with muscle type and in response to fructose-induced insulin resistance. Endocrinology. 135:23692374.[Abstract]
Feldman, J.L., and F.E. Stockdale. 1992. Temporal appearance of satellite cells during myogenesis. Dev. Biol. 153:217226.[CrossRef][Medline]
Hahn, C., and J. Covault. 1992. Neural regulation of N-cadherin gene expression in developing and adult skeletal muscle. J. Neurosci. 12:46774687.[Abstract]
Jaimovich, E., and M.A. Carrasco. 2002. IP3 dependent Ca2+ signals in muscle cells are involved in regulation of gene expression. Biol. Res. 35:195202.[Medline]
Klarsfeld, A., R. Laufer, B. Fontaine, A. Devillers-Thiery, C. Dubreuil, and J.P. Changeux. 1989. Regulation of muscle AchR
subunit gene expression by electrical activity: Involvement of protein kinase C and Ca2+. Neuron. 2:12291236.[CrossRef][Medline]
Liu, T.P., P. Yu, I. Liu, T. Tzeng, and J. Cheng. 2002. Activation of muscarinic M1 receptors by acetylcholine to increase glucose uptake into cultured C2C12 cells. Auton Neurosci. 96:113118.[CrossRef][Medline]
Mende, U., A. Kagen, A. Cohen, J. Aramburu, F.J. Schoen, and E.J. Neer. 1998. Transient cardiac expression of constitutively active G
q leads to hypertrophy and dilated cardiomyopathy by calcineurin-dependent and independent pathways. Proc. Natl. Acad. Sci. USA. 95:1389313898.
Miller, J.B., and F.E. Stockdale. 1986a. Developmental origins of skeletal muscle fibers: clonal analysis of myogenic cell lineages based on expression of fast and slow myosin heavy chains. Proc. Natl. Acad. Sci. USA. 83:38603864.
Miller, J.B., and F.E. Stockdale. 1986b. Developmental regulation of the multiple myogenic cell lineages of the avian embryo. J. Cell Biol. 103:21972208.
Nikovits, W., Jr., G.F. Wang, J.L. Feldman, J.B. Miller, R. Wade, L. Nelson, and F.E. Stockdale. 1996. Isolation and characterization of an avian slow myosin heavy chain gene expressed during embryonic skeletal muscle fiber formation. J. Biol. Chem. 271:1704717056.
O'Neill, M.C., and F.E. Stockdale. 1972. A kinetic analysis of myogenesis in vitro. J. Cell Biol. 52:5265.
Page, S., J.B. Miller, J.X. DiMario, E.J. Hager, A. Moser, and F.E. Stockdale. 1992. Developmentally regulated expression of three slow isoforms of myosin heavy chain: diversity among the first fibers to form in avian muscle. Dev. Biol. 154:118128.[CrossRef][Medline]
Pette, D., and G. Vrbova. 1985. Invited review: neural control of phenotypic expression in mammalian muscle fibers. Muscle Nerve. 8:676689.[CrossRef][Medline]
Qian, N.X., S. Winitz, and G.L. Johnson. 1993. Epitope-tagged Gq
subunits: expression of GTPase-deficient
subunits persistently stimulates phosphatidylinositol-specific phospholipase C but not mitogen-activated protein kinase activity regulated by the M1 muscarinic acetylcholine receptor. Proc. Natl. Acad. Sci. USA. 90:40774081.
Rafuse, V.F., and L. Landmesser. 1996. Contractile activity regulates isoform expression and polysialylation of NCAM in cultured myotubes: Involvement of Ca2+ and protein kinase C. J. Cell Biol. 132:969983.
Reiser, P.J., R.L. Moss, G.G. Giulian, and M.L. Greaser. 1985. Shortening velocity in single fibers from adult rabbit soleus muscles is correlated with myosin heavy chain composition. J. Biol. Chem. 260:90779080.
Reiser, P.J., M.L. Greaser, and R.L. Moss. 1988. Myosin heavy chain composition of single cells from avian slow skeletal muscle is strongly correlated with velocity of shortening during development. Dev. Biol. 129:400407.[CrossRef][Medline]
Reyes, R., and E. Jaimovich. 1996. Functional muscarinic receptors in cultured skeletal muscle. Arch. Biochem. Biophys. 331:4147.[CrossRef][Medline]
Stockdale, F.E. 1997. Mechanisms of formation of muscle fiber types. Cell Struct. Funct. 22:3743.[Medline]
Strathmann, M., and M.I. Simon. 1990. G protein diversity: a distinct class of
subunits is present in vertebrates and invertebrates. Proc. Natl. Acad. Sci. USA. 87:91139117.
Taylor, S.J., H.Z. Chae, S.G. Rhee, and J.H. Exton. 1991. Activation of the ß1 isozyme of phospholipase C by a subunits of the Gq class of G proteins. Nature. 350:516518.[CrossRef][Medline]
Welsh, D.G., and S.S. Segal. 1997. Coactivation of resistance vessels and muscle fibers with acetylcholine release from motor nerves. Am. J. Physiol. 273:H156H163.
Wilkie, T.M., P.A. Scherle, M.P. Strathmann, V.Z. Slepak, and M.I. Simon. 1991. Characterization of G-protein
subunits in the Gq class: expression in murine tissues and in stromal and hematopoietic cell lines. Proc. Natl. Acad. Sci. USA. 88:1004910053.
Wu, D., C.H. Lee, S.G. Rhee, and M.I. Simon. 1992. Activation of phospholipase C by the
subunits of the Gq and G11 proteins in transfected Cos-7 cells. J. Biol. Chem. 267:18111817.
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|