Published 2 September 2003. doi:10.1083/jcb.200305145
© The Rockefeller University Press,
0021-9525/2003/9/909 $5.00
The Journal of Cell Biology, Volume 162, Number 5, 909-918
Clathrin-mediated endocytosis in AP-2depleted cells
Alison Motley,
Nicholas A. Bright,
Matthew N.J. Seaman and
Margaret S. Robinson
University of Cambridge, Department of Clinical Biochemistry, Cambridge Institute for Medical Research (CIMR), Cambridge CB2 2XY, UK
Address correspondence to Margaret S. Robinson, University of Cambridge, CIMR, Wellcome Trust/MRC Building, Addenbrooke's Hospital, Hills Road, Cambridge CB2 2XY, UK. Tel.: 44-1223-330163. Fax: 44-1223-762640. email: msr12{at}mole.bio.cam.ac.uk
 |
Abstract
|
|---|
We have used RNA interference to knock down the AP-2 µ2 subunit and clathrin heavy chain to undetectable levels in HeLaM cells. Clathrin-coated pits associated with the plasma membrane were still present in the AP-2depleted cells, but they were 12-fold less abundant than in control cells. No clathrin-coated pits or vesicles could be detected in the clathrin-depleted cells, and post-Golgi membrane compartments were swollen. Receptor-mediated endocytosis of transferrin was severely inhibited in both clathrin- and AP-2depleted cells. Endocytosis of EGF, and of an LDL receptor chimera, were also inhibited in the clathrin-depleted cells; however, both were internalized as efficiently in the AP-2depleted cells as in control cells. These results indicate that AP-2 is not essential for clathrin-coated vesicle formation at the plasma membrane, but that it is one of several endocytic adaptors required for the uptake of certain cargo proteins including the transferrin receptor. Uptake of the EGF and LDL receptors may be facilitated by alternative adaptors.
Key Words: coated vesicles; adaptors; RNA interference; receptor-mediated endocytosis; internalization signals
Abbreviation used in this paper: siRNA, small interfering RNA.
 |
Introduction
|
|---|
The AP-2 adaptor complex has long been assumed to be essential for clathrin-mediated endocytosis. It is a major component of purified clathrin-coated vesicles, second in abundance only to clathrin itself in most coated vesicle preparations. It has been shown to have binding sites not only for clathrin, but also for cargo proteins and for phospholipids. The prevailing view is that clathrin-mediated endocytosis is initiated by the recruitment of AP-2 onto the plasma membrane. Once on the plasma membrane, AP-2 interacts with sorting signals in the cytoplasmic domains of membrane proteins destined to become cargo in the coated vesicle. At the same time, AP-2 recruits clathrin onto the membrane, where it acts as a scaffold for vesicle budding. Recently, a number of accessory proteins have been identified that also participate in clathrin-mediated endocytosis, all of which bind either directly or indirectly to subunits of the AP-2 complex. These proteins together form an interconnected network, with AP-2 believed to be the central component (for review see Conner and Schmid, 2003a).
Although most of the available data are consistent with this model, there are a few discrepancies. First, the budding yeast Saccharomyces cerevisiae has an AP-2related complex, AP-2R; however, deleting genes encoding AP-2R subunits has no apparent effect on clathrin-mediated endocytosis, or indeed, on any other pathway that has been investigated (Yeung et al., 1999). A caveat here is that AP-2R may not be functionally equivalent to AP-2 in higher cells. Second, some of the accessory proteins that bind to AP-2 have properties suggesting that they may be adaptors in their own right. Epsin, ß-arrestin, AP180/CALM, Hip1, Dab2, and ARH have all been shown to bind not only to AP-2, but also to PIP2 and to clathrin, indicating that they may be able to bind to the plasma membrane and to recruit clathrin in an AP-2independent manner (Gaidarov et al., 1999; Ford et al., 2001, 2002; Mishra et al., 2001, 2002a,b). There is also some evidence that each of these proteins may interact with a specific type of cargo. For instance, epsin has ubiquitin-interacting motifs that may help to facilitate the internalization of plasma membrane proteins like the EGF receptor, which is ubiquitinated in response to ligand binding. Dab2 and ARH are able to bind NPXY motifs, found in members of the LDL receptor family (for review see Bonifacino and Traub, 2003). Thus, an alternative view is that AP-2 may be just one of several endocytic adaptors, and that although it participates in the network of proteinprotein interactions and is required for the uptake of certain types of cargo, it is not essential for clathrin-mediated endocytosis.
We asked the question, what would happen if AP-2 were to drop out of the network? Would clathrin and accessory proteins still be recruited onto the plasma membrane? What would happen to receptor-mediated endocytosis? Using small interfering RNAs (siRNAs), we have been able to knock down the expression of the µ2 subunit of the AP-2 complex to undetectable levels in HeLaM cells. Then, we compared the phenotype of the AP-2depleted cells with that of cells treated with siRNAs directed against clathrin heavy chain.
 |
Results
|
|---|
Depletion of AP-2 and clathrin by RNA interference
To find the most effective conditions for depleting AP-2 and clathrin, a number of siRNAs were synthesized, and both single and double transfections were performed. We found that siRNAs µ2-2 and chc-2 (see Materials and methods), directed against the AP-2 µ2 subunit and clathrin heavy chain, respectively, produced the most complete disruption, and that in both cases it was best to transfect the cells twice, with a 48-h interval in between. An siRNA directed against the AP-2
subunit (
-2) also worked well, but not quite as effectively as µ2-2 or chc-2. Fig. 1 a shows Western blots of equal protein loadings of control and siRNA-treated cells two days after the second transfection. The signals from both µ2 and clathrin heavy chain are undetectable after knockdown, whereas a weak signal (<5% of control) could be detected in the
-2treated cells.

View larger version (101K):
[in this window]
[in a new window]
|
Figure 1. Effects of depleting AP-2 and clathrin heavy chain from HeLaM cells. (a) Equal protein loadings of homogenates of either control cells or cells treated with siRNAs directed against clathrin heavy chain, -adaptin, or µ2 were subjected to SDS-PAGE, and Western blots were probed with antibodies against the indicated protein. Clathrin heavy chain and the AP-2 µ2 subunit were both undetectable after knockdown, whereas a weak signal (<5% of control) was detected after knockdown. (b) Equal protein loadings of homogenates from control and siRNA-treated cells were subjected to SDS-PAGE, and Western blots were cut in four and probed with the indicated antibody. Anti-actin was included as a loading control. As well as affecting its target, the siRNA causes a depletion in µ2, and the µ2 siRNA causes a depletion in . (c) Homogenates of control and µ2-depleted cells were centrifuged at high speed, and supernatants and pellets were probed with anti- . Knocking down µ2 increases the percentage of in the supernatant. (df) Phase-contrast micrographs of cells treated with a control (nonfunctional) siRNA (d), cells treated with µ2 siRNA (e), and cells treated with clathrin heavy chain siRNA (f). The µ2 siRNA-treated cells look essentially normal. However, many of the clathrin heavy chain siRNA-treated cells are vacuolated, and nearly half are multinucleated. (gk) Control cells (g), cells treated once with (h) and µ2 (i) siRNAs, and cells treated twice with (j) and µ2 (k) siRNAs were labeled with an antibody against the AP-2 subunit. The labeling becomes patchy after one hit, and after both hits there is little or no label associated with the plasma membrane. (ln) Control cells (l) and cells treated once (m) or twice (n) with a clathrin heavy chain siRNA were labeled with an antibody against clathrin. The signal disappears more uniformly than the AP-2 signal, again becoming undetectable on membranes after two hits. Bars, 20 µm.
| |
Although the µ2 and
siRNAs only directly affect the expression of the subunit against which they were targeted, Fig. 1 b shows that levels of the other subunit were also reduced. In contrast, depleting AP-2 subunits has no effect on the amount of clathrin in the cell, and clathrin depletion does not affect the levels of AP-2 (Fig. 1 b). We also investigated whether depleting µ2 affects the proportion of soluble versus membrane-associated
, by centrifuging cell homogenates at high speed and then probing Western blots of the supernatant and pellet. Fig. 1 c shows that normally, most of the
is in the pellet, but depleting µ2 causes some of the protein to shift into the supernatant. These results are consistent with analyses of the AP-1 and AP-3 complexes, which show that deleting any one of the subunits decreases the stability of the remaining subunits, and that the partial complexes that form in the absence of a particular subunit are inactive and fail to localize to membranes (Meyer et al., 2000; Peden et al., 2002).
Both AP-2 and clathrin depletion were found to slow down the growth of the cells, but we did not see any apparent increase in apoptosis (unpublished data), although clathrin loss has been reported to cause apoptosis in a chicken B cell line (Wettey et al., 2002). By phase-contrast microscopy, the µ2-2treated cells look essentially normal (compare Fig. 1 e with the control cells in Fig. 1 d). However, many of the chc-2treated cells were found to be heavily vacuolated, and nearly half of the cells had two or more nuclei (Fig. 1 f), indicating that cytokinesis is blocked in clathrin-depleted cells. Interestingly, a similar phenotype has been reported in clathrin-deficient Dictyostelium (Niswonger and O'Halloran, 1997).
Fig. 1 (gn) shows the appearance of the cells by immunofluorescence. In gk, either control cells (g) or AP-2 knockdown cells (hk) were labeled with an antibody against the AP-2
subunit. After a single transfection, the
-adaptin labeling was found to be very patchy in both
-2treated (h) and µ2-2treated (i) cells; individual spots were of approximately equal intensity to those in control cells, but much fewer in number and usually occurring in clusters. After two transfections (j and k), membrane-associated labeling was essentially undetectable in the µ2-2treated cells, although cytosolic labeling of partial complexes containing the
subunit could be seen (k). The
-2 knockdown (j) was not quite so complete in that some of the cells still had residual spots after the second transfection. Clathrin knockdowns (ln) caused a more uniform loss of signal. After a single transfection (m), the number of clathrin-positive spots per cell was similar to controls (l), but the intensity of the spots was reduced. After two transfections, clathrin labeling was essentially undetectable (n). In all three cases, virtually 100% of the cells were affected by the end of the full course of treatment.
Localization of other proteins in the siRNA-treated cells
To find out what happens to other coat proteins in cells where one of them has been depleted, we performed triple labeling on cells treated with both µ2-2 and chc-2 siRNAs. For these experiments, we plated out equal numbers of control and siRNA-treated cells onto microscope slides so the two types of cells could be viewed together in the same field, and then labeled the cells with antibodies against
-adaptin (blue), clathrin heavy chain (red), and epsin 1 (green).
Fig. 2 shows that normally, the three proteins have overlapping distributions at the plasma membrane, with additional intracellular structures labeled with the clathrin antibody. Knocking down µ2 causes a reduction in the number of epsin spots (c). These spots do not contain any detectable
-adaptin, which is now diffuse and cytosolic (a). However, many of the epsin-positive spots in these cells are also positive for clathrin (b; insets), suggesting that the two proteins are able to co-assemble on the plasma membrane even in the absence of AP-2.
In cells where clathrin had been depleted, AP-2 labeling was not markedly different from control cells (d). There were still multiple spots associated with the plasma membrane, often occurring in rows. These spots were also positive for epsin (f). However, the epsin labeling was consistently brighter in clathrin-depleted cells, indicating that more of the protein was associated with the plasma membrane. This was confirmed by Western blotting of cell homogenates centrifuged at high speed; in control and AP-2depleted cells, epsin partitioned approximately equally between supernatant and pellet, whereas in clathrin-depleted cells, it was found almost exclusively in the pellet (unpublished data).
Ultrastructure of the cells
To observe the phenotype of AP-2 and clathrin-depleted cells at the ultrastructural level, EM was performed. Fig. 3 (a and b) shows that control cells contain numerous clathrin-coated pits associated with the plasma membrane, indicated with the large arrowheads. A morphometric analysis (Fig. 4) showed that in these cells, 0.6% of the cell surface is occupied by clathrin-coated pits. In the AP-2depleted cells (ce), clathrin-coated pits were found to be 12-fold less abundant, occupying only 0.05% of the cell surface. The morphology of the coat appears to be identical in control and AP-2depleted cells; however, the coated pits tend to be smaller in the AP-2depleted cells. In the clathrin-depleted cells, clathrin-coated pits were undetectable, and nearly all of the budding profiles that could be observed at the plasma membrane had the characteristic appearance of caveolae.

View larger version (136K):
[in this window]
[in a new window]
|
Figure 3. Electron micrographs of control and siRNA-treated cells. The cells in these experiments were incubated with an antibody against the transferrin receptor coupled to 8-nm gold before fixation to monitor the efficiency of transferrin receptor endocytosis. (a and b) Control cells have abundant clathrin-coated pits (large arrowheads) associated with the plasma membrane. Gold particles (small arrowheads) can be seen in endosomes. (cf) Cells were treated with µ2-2 siRNA. These cells still have clathrin-coated pits associated with the plasma membrane, but when the pits were quantified by morphometry in control and AP-2depleted cells, they were found to be 12-fold less abundant in the AP-2depleted cells. Morphologically, the coated pits are similar to those in control cells, but they tend to be smaller. Gold particles (small arrowheads) remain on the cell surface. A clathrin-coated bud or vesicle in the Golgi region (G) is indicated with the arrow in f. (g) Clathrin-depleted cells have no recognizable clathrin-coated pits or vesicles, either at the plasma membrane or on intracellular membranes, although COP-coated vesicles can still be seen on the cis side of the Golgi stack. In addition, membranes on the trans side of the Golgi stack are swollen. Bar, 500 nm.
| |

View larger version (44K):
[in this window]
[in a new window]
|
Figure 4. Morphometric analysis of the EM data, using 128 images of each condition. For the control cells, 7,630 plasma membrane intersections were scored, of which 45 were coated pit intersections (0.6%). For the µ2-2treated cells, 11,361 plasma membrane intersections were scored, of which six were coated pit intersections (0.05%). For the chc-2treated cells, 7,585 plasma membrane intersections were scored, of which none were coated pit intersections.
| |
We also examined intracellular membranes in the control and knockdown cells. Fig. 3 f shows the Golgi region of an AP-2depleted cell, with the Golgi stack indicated (G). A clathrin-coated vesicle (arrow) can be seen budding from a membrane on the trans side of the stack, presumably the TGN. Control cells have a similar Golgi morphology (unpublished data). However, in clathrin-depleted cells, there is a striking amount of swelling of post-Golgi compartments (Fig. 3 g), presumably because membrane is unable to leave by the clathrin-coated vesicle route.
Effects on clathrin-mediated endocytosis: transferrin receptor
It has been well documented that AP-2 is required for the uptake of cargo proteins with YXX
-type sorting signals, such as the transferrin receptor. This motif has been shown to bind to hydrophobic pockets in the µ2 subunit (Ohno et al., 1995; Owen and Evans, 1998). Mutating the signal in the transferrin receptor prevents the receptor from entering the cell by clathrin-mediated endocytosis, causing it to be internalized 510 times more slowly (Jing et al., 1990). Similarly, mutating the µ2 subunit so that it can no longer bind the motif, and then overexpressing it in cells so that most of the AP-2 complexes contain mutant rather than wild-type µ2, also strongly inhibits uptake of the transferrin receptor (Nesterov et al., 1999).
Fig. 5 a shows the effects of AP-2 and clathrin knockdown on transferrin receptor endocytosis. For these experiments, the cells were incubated at 4°C with 125I-labeled transferrin to allow binding (but not internalization) to occur, and then were warmed to 37°C for various lengths of time. At the end of the incubation, the medium was harvested, surface-bound ligand was stripped off at low pH, the cells were solubilized in 1 M NaOH, and the label in all three fractions was quantified. The percentage of counts in the NaOH extract (i.e., intracellular counts) is shown in the graph. In control cells, >50% of the prebound transferrin is internalized within 5 min after warm-up, but after 10 min, the amount of intracellular transferrin starts to go down, as it gets recycled back into the medium. Knocking down both AP-2 and clathrin causes a profound inhibition of transferrin uptake. In both cases, the transferrin never accumulates inside the cells, but remains primarily on the cell surface, where it slowly dissociates into the medium. Even after 30 min, <10% of the transferrin is recovered in the intracellular fraction. Thus, as expected, both AP-2 and clathrin are required for efficient internalization of the transferrin receptor.

View larger version (13K):
[in this window]
[in a new window]
|
Figure 5. Kinetics of ligand uptake in control and siRNA-treated cells. (a) Cells were allowed to bind 125I-labeled transferrin at 4°C, and were then shifted to 37°C for the indicated length of time, after which the medium was harvested, ligand remaining on the cell surface was released with an acid wash, the cells were solubilized with NaOH, and all three fractions were quantified and expressed as a percentage of total counts/m. The graph shows percentage of total counts recovered in the NaOH extract (i.e., internalized transferrin). Each point is derived from at least three separate experiments; the error bars show the SEM. Both µ2- and clathrin-depleted cells are strongly impaired in their ability to internalize transferrin. (b) Cells were treated exactly as in a, but using 125I-labeled EGF. Uptake is strongly inhibited in the clathrin-depleted cells, but it is not significantly different from control in the µ2-depleted cells. (c) Cells expressing a chimera consisting of the CD8 extracellular and lumenal domains fused to the LDL receptor cytoplasmic tail were incubated at 4°C with an mAb against CD8 followed by 125I-labeled protein A, and were then shifted to 37°C and treated as in a and b. Again, uptake is strongly inhibited in the clathrin-depleted cells, but similar to controls in the µ2-depleted cells. Virtually identical results were obtained using -depleted cells, except that the effect on transferrin uptake was not quite so profound, presumably because the knockdown was less complete (not depicted).
| |
EGF receptor
The behavior of the EGF receptor was less predictable. This receptor has a YXX
consensus sequence in its cytoplasmic tail, which binds to µ2 in vitro (Owen and Evans, 1998), and which acts as an internalization signal when transplanted onto other proteins (Chang et al., 1993). Surprisingly, however, mutating this sequence does not change the internalization rate of the receptor (Nesterov et al., 1995; Sorkin et al., 1996). In addition, EGF receptor endocytosis was found to proceed normally in cells expressing mutant µ2 (Nesterov et al., 1999). These observations indicate that the receptor must have another signal (or signals) for endocytosis, and there is increasing evidence that ubiquitin may be that signal (Haglund et al., 2003). However, it has not yet been tested whether EGF internalization is really independent of AP-2, because the cells expressing mutant µ2 still contained normal levels of AP-2, which was recruited normally onto the plasma membrane (Nesterov et al., 1999). Thus, it is possible that the EGF receptor may bind to another part of AP-2, and/or that AP-2 may be necessary for coat assembly.
Fig. 5 b shows a similar experiment to the one shown in Fig. 5 a, but using 125I-labeled EGF as the ligand. In control cells, EGF is internalized slightly more slowly than transferrin, but by 10 min, >50% of the label is intracellular. Knocking down clathrin strongly inhibits the receptor-mediated endocytosis of EGF. Strikingly, however, knocking down AP-2 has no significant effect on EGF uptake. The rate of accumulation of intracellular EGF is virtually identical in control and AP-2depleted cells.
LDL receptor
There is currently some controversy as to how the LDL receptor's internalization signal actually works. This signal has been reported to bind to several coat components, including the µ2 subunit of AP-2 (Boll et al., 2002), clathrin (Kibbey et al., 1998), and proteins with phosphotyrosine-binding domains like Dab2 and ARH (Mishra et al., 2002a,b). Initially, we attempted to monitor receptor internalization using 125I-labeled LDL, but these experiments were complicated by the very rapid dissociation of the ligand from its receptor in HeLa cells (see Materials and methods). Therefore, we stably transfected the cells with a construct consisting of the extracellular and transmembrane domains of CD8 fused to the LDL receptor tail, then assayed for internalization following a similar protocol to the one just mentioned, but with anti-CD8 followed by 125I-labeled protein A as the ligand. Fig. 5 c shows that in control cells, the LDL receptor chimera is efficiently internalized, and that knocking down clathrin strongly inhibits uptake. However, knocking down AP-2 again has no effect on the rate of endocytosis of the protein. Thus, out of the three transmembrane proteins that we have analyzed in siRNA-treated HeLa cells, two are internalized in an AP-2independent manner.
 |
Discussion
|
|---|
In this work, we have knocked down both clathrin heavy chain and the AP-2 µ2 subunit to undetectable levels using siRNAs. Remarkably, we find that clathrin-mediated endocytosis can still occur in the absence of any detectable AP-2 at the plasma membrane. Although we cannot rule out the possibility that trace amounts of AP-2 may contribute to endocytosis in the siRNA-treated cells, it is clear that AP-2 is not an essential structural component of the coat, as had always been assumed. A similar conclusion has been reached by Conner and Schmid (2003b)(in this issue), who used a different approach to inactivate AP-2, and also found that effects on clathrin-mediated endocytosis were cargo-specific. This means that there must be other proteins in the cell that can fulfill the role that had always been assigned to AP-2. These proteins cannot completely replace AP-2, because the number of coated pits per cell is reduced by 12-fold in AP-2depleted cells, and clathrin-mediated endocytosis of the transferrin receptor is abolished. In addition, others have shown that mutations in the AP-2
subunit in Drosophila cause either embryonic lethality or neurological defects, depending on the allele (Gonzalez-Gaitan and Jackle, 1997). However, we find that both the EGF receptor and the LDL receptor chimera are internalized just as efficiently in AP-2depleted cells as in control cells, presumably by making use of alternative adaptors.
Over the last several years, a number of reports have been published that challenge the view that all cargo proteins are endocytosed by the same molecular mechanism. Marks et al. (1996) showed that overexpression of constructs with either YXX
or dileucine internalization signals causes endogenous proteins with the same signal to accumulate on the cell surface, but endogenous proteins with the other signal are still endocytosed normally. They concluded that the two signals were competing for two distinct components of the endocytic machinery. However, they could not rule out the possibility that both of these components were part of the AP-2 complex, and indeed, subsequent reports showed that dileucine signals can also bind to AP complexes, most likely through their ß subunits (for review see Bonifacino and Traub, 2003). Warren et al. (1998) used a similar approach to show that the transferrin, EGF, and LDL receptors do not compete with each other for internalization. They suggested that although AP-2 interactions might be necessary for the internalization of some cargo proteins, other cargo proteins could be interacting with other components of the coat. However, until now, it has not been possible to test these ideas by specifically depleting different coat components from the cell.
The approach that we have used in the present paper should be widely applicable for looking at the internalization of other transmembrane proteins, to determine whether or not their endocytosis is dependent on AP-2. So far, most functional analyses of the roles of various proteins in clathrin-mediated endocytosis have made use of dominant-negative mutants (for review see Conner and Schmid, 2003a), but these may lead to indirect effects (e.g., overexpressing a truncated version of a particular protein may impede interactions involving other components of the coated pit). RNA interference is a much cleaner way of testing the function of a protein because it removes the protein instead of altering it and adding it back in excess amounts. The CD8 chimera system may be especially useful, because theoretically, one could transplant the cytoplasmic tail from any type I membrane protein, or an artificial tail designed to test a potential internalization signal, onto the CD8 reporter, and then assay for uptake using reagents that are commercially available.
Fig. 6 is a schematic diagram summarizing our results and how we interpret them. Normally, clathrin, AP-2, and alternative adaptors all co-assemble at the plasma membrane, bringing cargo with different types of internalization signals into the coated pit. In the absence of AP-2, alternative adaptors are still recruited onto the plasma membrane, where they interact with a subset of the cargo proteins, including the EGF and LDL receptors, and co-assemble with clathrin. These cargo proteins are still efficiently internalized, but cargo proteins like the transferrin receptor, which can only interact with AP-2, stay on the cell surface. In addition, because AP-2 is the major clathrin adaptor at the plasma membrane, there is less clathrin recruited onto the membrane and fewer (and perhaps smaller) coated pits per cell. In the absence of clathrin, both AP-2 and alternative adaptors are still recruited onto the plasma membrane, where they interact with each other and most likely with potential cargo proteins as well, but there are no morphologically recognizable coated pits, and all of the cargo proteins are internalized much more slowly.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 6. Model showing interactions at the plasma membrane in control and siRNA-treated cells. In control cells, AP-2 and alternative adaptors are both recruited onto the plasma membrane, where they interact with each other and recruit clathrin through interactions mainly involving their flexible linker and appendage domains, whereas their more highly structured domains interact with phosphoinositides and with cargo. In AP-2depleted cells, only alternative adaptors are recruited onto the plasma membrane, but these can still associate with each other (e.g., through EH domainNPF interactions and SH3 domainproline-rich domain interactions), and can still recruit clathrin and bring a subset of cargo proteins into the coated pit. However, without AP-2 there is less clathrin on the plasma membrane and fewer coated pits per cell, and cargo proteins that only have signals for AP-2 do not get internalized into coated vesicles. In clathrin-depleted cells, AP-2 and alternative adaptors are both recruited onto the plasma membrane, where they interact with each other and with cargo, but the membrane does not invaginate and there is no selective uptake of cargo.
| |
Several recent papers provide insights into the identity of these alternative adaptors. In particular, Traub and colleagues have shown that a number of the endocytic accessory proteins, including epsin, Hip1, Dab2, and ARH, can bind to plasma membrane lipids and to clathrin, and they have proposed that these proteins may, in fact, be cargo-selective clathrin adaptors (Mishra et al., 2001, 2002a,b). However, they hypothesize that the role of these proteins is to "potentiate AP-2driven coat formation" (Mishra et al., 2002a), whereas the present paper suggests that alternative adaptors may, in fact, be just as capable of driving coat formation as AP-2. This makes mammalian cells much more similar to yeast in this regard than had previously been suspected. S. cerevisiae can still carry out most of its clathrin-mediated trafficking even when all three of its AP complexes are absent (Huang et al., 1999; Yeung et al., 1999), presumably because most of its cargo proteins do not depend on YXX
motifs. Ubiquitin appears to be the major endocytic signal in yeast, and there is some evidence that it is recognized by the epsin orthologues Ent1p and Ent2p (Shih et al., 2002; Aguilar et al., 2003). Mammalian epsins may play a similar role, capturing ubiquitinated cargo proteins like the activated EGF receptor. ARH and Dab2 are both good candidates for cargo-specific adaptors for the LDL receptor, and may be functionally redundant because mutations in either gene alone do not block LDL uptake (Mishra et al., 2002b). By using RNA interference to deplete these and other candidate adaptors from cells (either alone or in combination) and then monitoring the internalization of different membrane proteins, it should be possible to match each of the alternative adaptors with its respective cargo.
 |
Materials and methods
|
|---|
siRNA knockdowns
HeLaM cells (Tiwari et al., 1987) were seeded at a density of 106 cells per 9-cm dish. At least 2 h after seeding the cells, the first transfection was performed. For each 9-cm dish, 50 µl OligofectAMINETM (Invitrogen) was added to 100 µl Opti-MEM® I (Life Technologies), and the solution was incubated at RT for 510 min. This was then added to a second solution or 800 µl Opti-MEM® I plus 50 µl 20 µM siRNA, and the mixture was incubated at RT for 1520 min. Next, 4 ml Opti-MEM® I was added to the siRNA mixture to make a final volume of 5 ml, and this was added to the cells after rinsing them once with Opti-MEM® I. The transfection mixture was left for 4 h on the cells, after which 5 ml DME containing 20% FCS without antibiotics was added, and the cells were left in this mixture until they were trypsinized the following day. Two transfections were performed, on d 0 and d 2. The cells were trypsinized 24 h after each transfection and were seeded into two 9-cm dishes for the second transfection, whereas after the second transfection, they were plated onto coverslips or 35-mm dishes for uptake assays. For each experiment, an extra 35-mm dish was used to assay efficiency of knockdown.
Two independent siRNAs were used to investigate the effects of knockdown of each target. For AP-2, the targets were the
and µ2 subunits of the complex. The
-2 siRNA target sequence was AAGAGCAUGUGCACGCUGGCCA and the µ2-2 target sequence was AAGUGGAUGCCUUUCGGGUCA (other sequences, designated
-1 and µ21, were ineffective). The clathrin heavy chain target sequences were AAG-CUGGGAAAACUCUUCAGA (chc-1) and UAAUCCAAUUCGAAGACCAAU (chc-2). The control siRNA was a nonfunctional oligo, µ21, originally designed to knock down the µ2 subunit, target sequence AACACAGCAACCUCUACUUGG. All siRNAs were designed according to the manufacturer's instructions and were synthesized as Option C siRNAs by Dharmacon, Inc.
Immunofluorescence and Western blotting
Antibodies used for immunofluorescence included an affinity-purified rabbit polyclonal antiserum directed against clathrin heavy chain (Simpson et al., 1996); a mouse monoclonal anti-
-adaptin, AP.6, provided by Frances Brodsky (University of California, San Francisco, San Francisco, CA); and a commercially available goat anti-epsin 1 (Santa Cruz Biotechnology, Inc.). Secondary antibodies were all purchased from Molecular Probes, Inc. For Western blotting,
and µ2 subunits of AP-2 were detected using mouse monoclonal antibodies from Transduction Laboratories, clathrin heavy chain was detected using the same rabbit antibody that was used for immunofluorescence, and actin was detected using a rabbit antibody from Sigma-Aldrich. Incubations with the mouse antibodies were followed by an incubation with rabbit antimouse immunoglobulin (DakoCytomation). The blots were then probed with 125I-labeled protein A (Amersham Biosciences).
EM
Cells to be used for EM were first fed with mouse anti-transferrin receptor B3/25 conjugated to 8-nm gold, a gift from Colin Hopkins and Liz Alichin (Imperial College London, London, UK). The cells were incubated with the antibodygold conjugate for 30 min at 4°C, followed by a 10-min chase at 37°C. They were then fixed in tissue culture dishes by adding double-strength fixative (5% glutaraldehyde and 4% PFA in 0.2 M sodium cacodylate, pH 7.2, containing 6 mM CaCl2) to an equal volume of tissue culture medium for 2 min at 37°C. This solution was aspirated off and replaced by 2.5% glutaraldehyde and 2% PFA in 0.1 M sodium cacodylate buffer, pH 7.2, containing 3 mM CaCl2. The cells were fixed for a further 3 h at RT, washed with 0.1 M sodium cacodylate buffer, pH 7.2, and post-fixed with 1% osmium tetroxide in 0.1 M sodium cacodylate buffer, pH 7.2, for 1 h. The cells were scraped from the dish and pelleted, and the pellet was washed with 0.05 M sodium maleate buffer, pH 5.2, and en bloc stained with 0.5% uranyl acetate in 0.05 M sodium maleate buffer. The cell pellets were dehydrated in ethanol, exchanged into 1,2-epoxy propane, and embedded in Araldite CY212 epoxy resin (Agar Scientific).
50-nm ultrathin sections were cut using a diamond knife mounted on an ultramicrotome (Reichert Ultracut S; Leica), collected onto formvar/carbon-coated EM grids, and stained with uranyl acetate and Reynolds lead citrate (Reynolds, 1963). The sections were observed in a transmission electron microscope (model CM 100; Philips) at an operating voltage of 80 kV.
For quantification of the percentage of plasma membrane occupied by coated pits, cell pellets were randomly sectioned and oriented in the electron microscope. Grids were systematically scanned at a magnification of 13,500, and 128 images of each condition were captured using a camera (Megaview II TEM; Soft Imaging System). A 500-nm lattice overlay was used to score intersections with the plasma membrane and coated pits (Weibel, 1979; Griffiths, 1993) using analySIS® 3.0 image analytical software.
Internalization assays
Ligand uptake assays were performed on cells seeded onto 35-mm dishes on the day preceding the experiment. On the day of the experiment, the dishes were placed on ice and were washed briefly with prechilled serum-free medium (SFM; DME and 20 mM Hepes containing 1% BSA). The cells were then incubated on a rocker for 30 min at 4°C in 0.6 ml SFM containing either 125I-labeled EGF or 125I-labeled transferrin (both obtained from PerkinElmer) at a concentration of 500 nCi/ml. The dishes were washed six times with ice-cold SFM, and the surface counts were collected for the zero time point by incubating the cells for 5 min at 4°C in 0.8 ml ice-cold acid wash (0.2 M acetic acid and 0.5 M NaCl), followed by a brief rinse with another 0.8-ml acid wash. The other dishes were incubated with 1.5 ml prewarmed medium (DME containing 10% FCS) at 37°C for various times. Endocytosis was stopped by placing the cells on ice, collecting the medium, and rinsing the cells with ice-cold SFM. Label associated with the cell surface was then collected by acid wash, as above. Finally, the intracellular fraction was collected by extracting the cells twice with 0.8 ml 1 M NaOH. The radioactivity in the medium, acid wash, and NaOH extract was quantified using a gamma counter (Nuclear Enterprises).
We also attempted to follow the fate of 125I-labeled LDL, but found that >50% of the prebound ligand dissociated within the first few minutes of warm-up. Therefore, we made use of HeLaM cells expressing a chimera of the extracellular and transmembrane domain of CD8 fused to the tail domain of the LDL receptor. Human CD8 cDNA in pBlueScript® was a gift from Gudrun Ihrke (University of Cambridge, Cambridge, UK; Ihrke et al., 2001). The cytoplasmic tail of the mouse LDL receptor (from the arginine residue at position 813) was amplified by PCR from an EST (Clone ID 2581960; GenBank/EMBL/DDBJ accession no. gi6519196) obtained from the I.M.A.G.E. Consortium, incorporating an AflII site into the 5' end. The resulting fragment was ligated to the AflII site at the end of the transmembrane domain coding sequence of CD8, and the chimera was cloned into pIRES2Neo (CLONTECH Laboratories, Inc.). The construct was sequenced to confirm that a correct in-frame fusion had been achieved, and was then transfected into HeLaM cells. Stably transfected cells were selected and maintained in the presence of 500 µg/ml G418 (GIBCO BRL).
To monitor uptake of the chimera, the cells were treated as above, but incubated with SFM containing 1:100 diluted anti-CD8 (153020; Ancell Corp.) instead of with a radiolabeled ligand, and the incubation was for 45 min at 4°C instead of for 30 min. The cells were then washed and incubated for a further 45 min at 4°C with SFM containing 125I-labeled protein A (1:1,000 diluted; Amersham Biosciences). The rest of the experiment was performed exactly as above.
 |
Acknowledgments
|
|---|
We thank Mark Marsh (University College London, London, UK) for sharing unpublished data and reagents and Colin Hopkins and Liz Allchin for the B3/25-gold conjugate. We also thank Paul Lehner (Cambridge Institute for Medical Research, Cambridge, UK) for the HeLaM cells, Howard Davidson for the chc-1 siRNA sequence, Gudrun Ihrke for the CD8 cDNA, and Frances Brodsky for the AP.6 antibody. We are grateful to Paul Luzio, John Kilmartin, David Owen, and members of the Robinson lab for reading the manuscript and for helpful discussions.
This work was supported by grants from the Wellcome Trust (grant 053316/Z/98 to M.S. Robinson) and the Medical Research Council (grant G9310915 to M.S. Robinson and J.P. Luzio).
Submitted: 30 May 2003
Accepted: 24 July 2003
 |
References
|
|---|
Aguilar, R.C., H.A. Watson, and B. Wendland. 2003. The yeast Epsin Ent1 is recruited to membranes through multiple independent interactions. J. Biol. Chem. 278:1073710743.[Abstract/Free Full Text]
Boll, W., I. Rapoport, C. Brunner, Y. Modis, S. Prehn, and T. Kirchhausen. 2002. The mu2 subunit of the clathrin adaptor AP-2 binds to FDNPVY and Ypp
sorting signals at distinct sites. Traffic. 3:590600.[CrossRef][Medline]
Bonifacino, J.S., and L.M. Traub. 2003. Signals for sorting of transmembrane proteins to endosomes and lysosomes. Annu. Rev. Biochem. In press.
Chang, C.P., C.S. Lazar, B.J. Walsh, M. Komuro, J.F. Collawn, L.A. Kuhn, J.A. Tainer, I.S. Trowbridge, M.G. Farquhar, M.G. Rosenfeld, et al. 1993. Ligand-induced internalization of the epidermal growth factor receptor is mediated by multiple endocytic codes analogous to the tyrosine motif found in constitutively internalized receptors. J. Biol. Chem. 268:1931219320.[Abstract/Free Full Text]
Conner, S.D., and S.L. Schmid. 2003a. Regulated portals of entry into the cell. Nature. 422:3744.[CrossRef][Medline]
Conner, S.D., and S.L. Schmid. 2003b. Differential requirements for AP2 in clathrin-mediated endocytosis. J. Cell Biol. 162:773779.[Abstract/Free Full Text]
Ford, M.G., B.M. Pearse, M.K. Higgins, Y. Vallis, D.J. Owen, A. Gibson, C.R. Hopkins, P.R. Evans, and H.T. McMahon. 2001. Simultaneous binding of PtdIns(4,5)P2 and clathrin by AP180 in the nucleation of clathrin lattices on membranes. Science. 291:10511055.[Abstract/Free Full Text]
Ford, M.G., I.G. Mills, B.J. Peter, Y. Vallis, G.J. Praefcke, P.R. Evans, and H.T. McMahon. 2002. Curvature of clathrin-coated pits driven by epsin. Nature. 419:361366.[CrossRef][Medline]
Gaidarov, I., J.G. Krupnick, J.R. Falck, J.L. Benovic, and J.H. Keen. 1999. Arrestin function in G protein-coupled receptor endocytosis requires phosphoinositide binding. EMBO J. 18:871881.[CrossRef][Medline]
Gonzalez-Gaitan, M., and H. Jackle. 1997. Role of Drosophila alpha-adaptin in presynaptic vesicle recycling. Cell. 88:767776.[CrossRef][Medline]
Griffiths, G. 1993. Fine Structure Immunocytochemistry. Springer-Verlag, Heidelberg, Germany. 459 pp.
Haglund, K., S. Sigismund, S. Polo, I. Szymkiewicz, P.P. Di Fiore, and I. Dikic. 2003. Multiple monoubiquitination of RTKs is sufficient for their endocytosis and degradation. Nat. Cell Biol. 5:461466.[CrossRef][Medline]
Huang, K.M., K. D'Hondt, H. Riezman, and S.K. Lemmon. 1999. Clathrin functions in the absence of heterotetrameric adaptors and AP180-related proteins in yeast. EMBO J. 18:38973908.[CrossRef][Medline]
Ihrke, G., J.R. Bruns, J.P. Luzio, and O.A. Weisz. 2001. Competing sorting signals guide endolyn along a novel route to lysosomes in MDCK cells. EMBO J. 20:62566264.[CrossRef][Medline]
Jing, S.Q., T. Spencer, K. Miller, C. Hopkins, and I.S. Trowbridge. 1990. Role of the human transferrin receptor cytoplasmic domain in endocytosis: localization of a specific signal sequence for internalization. J. Cell Biol. 110:283294.[Abstract/Free Full Text]
Kibbey, R.G., J. Rizo, L.M. Gierasch, and R.G. Anderson. 1998. The LDL receptor clustering motif interacts with the clathrin terminal domain in a reverse turn conformation. J. Cell Biol. 142:5967.[Abstract/Free Full Text]
Marks, M.S., L. Woodruff, H. Ohno, and J.S. Bonifacino. 1996. Protein targeting by tyrosine- and di-leucine-based signals: evidence for distinct saturable components. J. Cell Biol. 135:341354.[Abstract/Free Full Text]
Meyer, C., D. Zizioli, S. Lausmann, E.L. Eskelinen, J. Hamann, P. Saftig, K. von Figura, and P. Schu. 2000. mu1A-adaptin-deficient mice: lethality, loss of AP-1 binding and rerouting of mannose 6-phosphate receptors. EMBO J. 19:21932203.[CrossRef][Medline]
Mishra, S.K., N.R. Agostinelli, T.J. Brett, I. Mizukami, T.S. Ross, and L.M. Traub. 2001. Clathrin- and AP-2-binding sites in HIP1 uncover a general assembly role for endocytic accessory proteins. J. Biol. Chem. 276:4623046236.[Abstract/Free Full Text]
Mishra, S.K., P.A. Keyel, M.J. Hawryluk, N.R. Agostinelli, S.C. Watkins, and L.M. Traub. 2002a. Disabled-2 exhibits the properties of a cargo-selective endocytic clathrin adaptor. EMBO J. 21:49154926.[CrossRef][Medline]
Mishra, S.K., S.C. Watkins, and L.M. Traub. 2002b. The autosomal recessive hypercholesterolemia (ARH) protein interfaces directly with the clathrin-coat machinery. Proc. Natl. Acad. Sci. USA. 99:1609916104.[Abstract/Free Full Text]
Nesterov, A., H.S. Wiley, and G.N. Gill. 1995. Ligand-induced endocytosis of epidermal growth factor receptors that are defective in binding adaptor proteins. Proc. Natl. Acad. Sci. USA. 92:87198723.[Abstract/Free Full Text]
Nesterov, A., R.E. Carter, T. Sorkina, G.N. Gill, and A. Sorkin. 1999. Inhibition of the receptor-binding function of clathrin adaptor protein AP-2 by dominant-negative mutant mu2 subunit and its effects on endocytosis. EMBO J. 18:24892499.[CrossRef][Medline]
Niswonger, M.L., and T.J. O'Halloran. 1997. A novel role for clathrin in cytokinesis. Proc. Natl. Acad. Sci. USA. 94:85758578.[Abstract/Free Full Text]
Ohno, H., J. Stewart, M.C. Fournier, H. Bosshart, I. Rhee, S. Miyatake, T. Saito, A. Gallusser, T. Kirchhausen, and J.S. Bonifacino. 1995. Interaction of tyrosine-based sorting signals with clathrin-associated proteins. Science. 269:18721875.[Abstract/Free Full Text]
Owen, D.J., and P.R. Evans. 1998. A structural explanation for the recognition of tyrosine-based endocytic signals. Science. 282:13271332.[Abstract/Free Full Text]
Peden, A.A., R.E. Rudge, W.W. Lui, and M.S. Robinson. 2002. Assembly and function of AP-3 complexes in cells expressing mutant subunits. J. Cell Biol. 156:327336.[Abstract/Free Full Text]
Reynolds, E.S. 1963. The use of lead citrate at high pH as an electron opaque stain in electron microscopy. J. Cell Biol. 17:208212.[Free Full Text]
Shih, S.C., D.J. Katzmann, J.D. Schnell, M. Sutanto, S.D. Emr, and L. Hicke. 2002. Epsins and Vps27p/Hrs contain ubiquitin-binding domains that function in receptor endocytosis. Nat. Cell Biol. 4:389393.[CrossRef][Medline]
Simpson, F., N.A. Bright, M.A. West, L.S. Newman, R.B. Darnell, and M.S. Robinson. 1996. A novel adaptor-related protein complex. J. Cell Biol. 133:749760.[Abstract/Free Full Text]
Sorkin, A., M. Mazzotti, T. Sorkina, L. Scotto, and L. Beguinot. 1996. Epidermal growth factor receptor interaction with clathrin adaptors is mediated by the Tyr974-containing internalization motif. J. Biol. Chem. 271:1337713384.[Abstract/Free Full Text]
Tiwari, R.K., J. Kusari, and G.C. Sen. 1987. Functional equivalents of interferon-mediated signals needed for induction of an mRNA can be generated by double-stranded RNA and growth factors. EMBO J. 6:33733378.[Medline]
Warren, R.A., F.A. Green, P.E. Stenberg, and C.A. Enns. 1998. Distinct saturable pathways for the endocytosis of different tyrosine motifs. J. Biol. Chem. 273:1705617063.[Abstract/Free Full Text]
Weibel, E.W. 1979. Stereological Methods. Vol 1: Practical Methods for Biological Morphometry. Academic Press, London. 415 pp.
Wettey, F.R., S.F. Hawkins, A. Stewart, J.P. Luzio, J.C. Howard, and A.P. Jackson. 2002. Controlled elimination of clathrin heavy-chain expression in DT40 lymphocytes. Science. 297:15211525.[Abstract/Free Full Text]
Yeung, B.G., H.L. Phan, and G.S. Payne. 1999. Adaptor complex-independent clathrin function in yeast. Mol. Biol. Cell. 10:36433659.[Abstract/Free Full Text]

CiteULike
Complore
Connotea
Del.icio.us
Digg
Facebook
Reddit
Technorati
Twitter What's this?
Related Article
-
AP-2 gets demoted
- Alan W. Dove
J. Cell Biol. 2003 162: 749.
[Full Text]
[PDF]
This article has been cited by other articles:
-
Coon, B. G., Mukherjee, D., Hanna, C. B., Riese, D. J. II, Lowe, M., Aguilar, R. C.
(2009). Lowe syndrome patient fibroblasts display Ocrl1-specific cell migration defects that cannot be rescued by the homologous Inpp5b phosphatase. Hum Mol Genet
18: 4478-4491
[Abstract]
[Full Text]
-
Stimpson, H. E. M., Toret, C. P., Cheng, A. T., Pauly, B. S., Drubin, D. G.
(2009). Early-Arriving Syp1p and Ede1p Function in Endocytic Site Placement and Formation in Budding Yeast. Mol. Biol. Cell
20: 4640-4651
[Abstract]
[Full Text]
-
Patel, K. P., Coyne, C. B., Bergelson, J. M.
(2009). Dynamin- and Lipid Raft-Dependent Entry of Decay-Accelerating Factor (DAF)-Binding and Non-DAF-Binding Coxsackieviruses into Nonpolarized Cells. J. Virol.
83: 11064-11077
[Abstract]
[Full Text]
-
Huang, Y.-W., Su, P., Liu, G. Y., Crow, M. R., Chaukos, D., Yan, H., Robinson, L. A.
(2009). Constitutive Endocytosis of the Chemokine CX3CL1 Prevents Its Degradation by Cell Surface Metalloproteases. J. Biol. Chem.
284: 29644-29653
[Abstract]
[Full Text]
-
Tsang, H. T.H., Edwards, T. L., Wang, X., Connell, J. W., Davies, R. J., Durrington, H. J., O'Kane, C. J., Luzio, J. P., Reid, E.
(2009). The hereditary spastic paraplegia proteins NIPA1, spastin and spartin are inhibitors of mammalian BMP signalling. Hum Mol Genet
18: 3805-3821
[Abstract]
[Full Text]
-
Madshus, I. H., Stang, E.
(2009). Internalization and intracellular sorting of the EGF receptor: a model for understanding the mechanisms of receptor trafficking. J. Cell Sci.
122: 3433-3439
[Abstract]
[Full Text]
-
Hood, F. E., Royle, S. J.
(2009). Functional equivalence of the clathrin heavy chains CHC17 and CHC22 in endocytosis and mitosis. J. Cell Sci.
122: 2185-2190
[Abstract]
[Full Text]
-
Masuyama, N., Kuronita, T., Tanaka, R., Muto, T., Hirota, Y., Takigawa, A., Fujita, H., Aso, Y., Amano, J., Tanaka, Y.
(2009). HM1.24 Is Internalized from Lipid Rafts by Clathrin-mediated Endocytosis through Interaction with {alpha}-Adaptin. J. Biol. Chem.
284: 15927-15941
[Abstract]
[Full Text]
-
Thieman, J. R., Mishra, S. K., Ling, K., Doray, B., Anderson, R. A., Traub, L. M.
(2009). Clathrin Regulates the Association of PIPKI{gamma}661 with the AP-2 Adaptor {beta}2 Appendage. J. Biol. Chem.
284: 13924-13939
[Abstract]
[Full Text]
-
Rudinskiy, N., Grishchuk, Y., Vaslin, A., Puyal, J., Delacourte, A., Hirling, H., Clarke, P. G. H., Luthi-Carter, R.
(2009). Calpain Hydrolysis of {alpha}- and {beta}2-Adaptins Decreases Clathrin-dependent Endocytosis and May Promote Neurodegeneration. J. Biol. Chem.
284: 12447-12458
[Abstract]
[Full Text]
-
Rappoport, J. Z., Simon, S. M.
(2009). Endocytic trafficking of activated EGFR is AP-2 dependent and occurs through preformed clathrin spots. J. Cell Sci.
122: 1301-1305
[Abstract]
[Full Text]
-
Chiasson, C. M., Wittich, K. B., Vincent, P. A., Faundez, V., Kowalczyk, A. P.
(2009). p120-Catenin Inhibits VE-Cadherin Internalization through a Rho-independent Mechanism. Mol. Biol. Cell
20: 1970-1980
[Abstract]
[Full Text]
-
Chaudhuri, R., Mattera, R., Lindwasser, O. W., Robinson, M. S., Bonifacino, J. S.
(2009). A Basic Patch on {alpha}-Adaptin Is Required for Binding of Human Immunodeficiency Virus Type 1 Nef and Cooperative Assembly of a CD4-Nef-AP-2 Complex. J. Virol.
83: 2518-2530
[Abstract]
[Full Text]
-
Moulakakis, C., Stamme, C.
(2009). Role of clathrin-mediated endocytosis of surfactant protein A by alveolar macrophages in intracellular signaling. Am. J. Physiol. Lung Cell. Mol. Physiol.
296: L430-L441
[Abstract]
[Full Text]
-
Newell-Litwa, K., Salazar, G., Smith, Y., Faundez, V.
(2009). Roles of BLOC-1 and Adaptor Protein-3 Complexes in Cargo Sorting to Synaptic Vesicles. Mol. Biol. Cell
20: 1441-1453
[Abstract]
[Full Text]
-
Hamelers, I. H.L., Staffhorst, R. W.H.M., Voortman, J., de Kruijff, B., Reedijk, J., van Bergen en Henegouwen, P. M.P., de Kroon, A. I.P.M.
(2009). High Cytotoxicity of Cisplatin Nanocapsules in Ovarian Carcinoma Cells Depends on Uptake by Caveolae-Mediated Endocytosis. Clin. Cancer Res.
15: 1259-1268
[Abstract]
[Full Text]
-
Scarselli, M., Donaldson, J. G.
(2009). Constitutive Internalization of G Protein-coupled Receptors and G Proteins via Clathrin-independent Endocytosis. J. Biol. Chem.
284: 3577-3585
[Abstract]
[Full Text]
-
Johannsdottir, H. K., Mancini, R., Kartenbeck, J., Amato, L., Helenius, A.
(2009). Host Cell Factors and Functions Involved in Vesicular Stomatitis Virus Entry. J. Virol.
83: 440-453
[Abstract]
[Full Text]
-
Lau, A. W., Chou, M. M.
(2008). The adaptor complex AP-2 regulates post-endocytic trafficking through the non-clathrin Arf6-dependent endocytic pathway. J. Cell Sci.
121: 4008-4017
[Abstract]
[Full Text]
-
Gu, M., Schuske, K., Watanabe, S., Liu, Q., Baum, P., Garriga, G., Jorgensen, E. M.
(2008). {micro}2 adaptin facilitates but is not essential for synaptic vesicle recycling in Caenorhabditis elegans. JCB
183: 881-892
[Abstract]
[Full Text]
-
Keyel, P. A., Thieman, J. R., Roth, R., Erkan, E., Everett, E. T., Watkins, S. C., Heuser, J. E., Traub, L. M.
(2008). The AP-2 Adaptor {beta}2 Appendage Scaffolds Alternate Cargo Endocytosis. Mol. Biol. Cell
19: 5309-5326
[Abstract]
[Full Text]
-
Semerdjieva, S., Shortt, B., Maxwell, E., Singh, S., Fonarev, P., Hansen, J., Schiavo, G., Grant, B. D., Smythe, E.
(2008). Coordinated regulation of AP2 uncoating from clathrin-coated vesicles by rab5 and hRME-6. JCB
183: 499-511
[Abstract]
[Full Text]
-
Brady, R. J., Wen, Y., O'Halloran, T. J.
(2008). The ENTH and C-terminal domains of Dictyostelium epsin cooperate to regulate the dynamic interaction with clathrin-coated pits. J. Cell Sci.
121: 3433-3444
[Abstract]
[Full Text]
-
Barr, D. J., Ostermeyer-Fay, A. G., Matundan, R. A., Brown, D. A.
(2008). Clathrin-independent endocytosis of ErbB2 in geldanamycin-treated human breast cancer cells. J. Cell Sci.
121: 3155-3166
[Abstract]
[Full Text]
-
Hitchcock, I. S., Chen, M. M., King, J. R., Kaushansky, K.
(2008). YRRL motifs in the cytoplasmic domain of the thrombopoietin receptor regulate receptor internalization and degradation. Blood
112: 2222-2231
[Abstract]
[Full Text]
-
Toussaint, H., Gobert, F.-X., Schindler, M., Banning, C., Kozik, P., Jouve, M., Kirchhoff, F., Benaroch, P.
(2008). Human Immunodeficiency Virus Type 1 Nef Expression Prevents AP-2-Mediated Internalization of the Major Histocompatibility Complex Class II-Associated Invariant Chain. J. Virol.
82: 8373-8382
[Abstract]
[Full Text]
-
Chen, C., Zhuang, X.
(2008). Epsin 1 is a cargo-specific adaptor for the clathrin-mediated endocytosis of the influenza virus. Proc. Natl. Acad. Sci. USA
105: 11790-11795
[Abstract]
[Full Text]
-
Murphy, J. E., Vohra, R. S., Dunn, S., Holloway, Z. G., Monaco, A. P., Homer-Vanniasinkam, S., Walker, J. H., Ponnambalam, S.
(2008). Oxidised LDL internalisation by the LOX-1 scavenger receptor is dependent on a novel cytoplasmic motif and is regulated by dynamin-2. J. Cell Sci.
121: 2136-2147
[Abstract]
[Full Text]
-
Lee, D.-w., Zhao, X., Yim, Y.-I., Eisenberg, E., Greene, L. E.
(2008). Essential Role of Cyclin-G-associated Kinase (Auxilin-2) in Developing and Mature Mice. Mol. Biol. Cell
19: 2766-2776
[Abstract]
[Full Text]
-
Hoque, Md. T., Cole, S. P.C.
(2008). Down-regulation of Na+/H+ Exchanger Regulatory Factor 1 Increases Expression and Function of Multidrug Resistance Protein 4. Cancer Res.
68: 4802-4809
[Abstract]
[Full Text]
-
Abe, N., Inoue, T., Galvez, T., Klein, L., Meyer, T.
(2008). Dissecting the role of PtdIns(4,5)P2 in endocytosis and recycling of the transferrin receptor. J. Cell Sci.
121: 1488-1494
[Abstract]
[Full Text]
-
Mishra, S. K., Jha, A., Steinhauser, A. L., Kokoza, V. A., Washabaugh, C. H., Raikhel, A. S., Foster, W. A., Traub, L. M.
(2008). Internalization of LDL-receptor superfamily yolk-protein receptors during mosquito oogenesis involves transcriptional regulation of PTB-domain adaptors. J. Cell Sci.
121: 1264-1274
[Abstract]
[Full Text]
-
Endo, Y., Sugiyama, A., Li, S.-A., Ohmori, K., Ohata, H., Yoshida, Y., Shibuya, M., Takei, K., Enari, M., Taya, Y.
(2008). Regulation of clathrin-mediated endocytosis by p53.. GENES CELLS
13: 375-386
[Abstract]
[Full Text]
-
Mason, A. K., Jacobs, B. E., Welling, P. A.
(2008). AP-2-dependent Internalization of Potassium Channel Kir2.3 Is Driven by a Novel Di-hydrophobic Signal. J. Biol. Chem.
283: 5973-5984
[Abstract]
[Full Text]
-
Urs, N. M., Kowalczyk, A. P., Radhakrishna, H.
(2008). Different Mechanisms Regulate Lysophosphatidic Acid (LPA)-dependent Versus Phorbol Ester-dependent Internalization of the LPA1 Receptor. J. Biol. Chem.
283: 5249-5257
[Abstract]
[Full Text]
-
Poupon, V., Girard, M., Legendre-Guillemin, V., Thomas, S., Bourbonniere, L., Philie, J., Bright, N. A., McPherson, P. S.
(2008). Clathrin light chains function in mannose phosphate receptor trafficking via regulation of actin assembly. Proc. Natl. Acad. Sci. USA
105: 168-173
[Abstract]
[Full Text]
-
Yun, S., Hong, W.-P., Choi, J. H., Yi, K. S., Chae, S.-K., Ryu, S. H., Suh, P.-G.
(2008). Phospholipase C-{epsilon} Augments Epidermal Growth Factor-dependent Cell Growth by Inhibiting Epidermal Growth Factor Receptor Down-regulation. J. Biol. Chem.
283: 341-349
[Abstract]
[Full Text]
-
Nohe, A., Petersen, N. O.
(2007). Image Correlation Spectroscopy. Sci Signal
2007: pl7-pl7
[Abstract]
[Full Text]
-
Braun, V., Deschamps, C., Raposo, G., Benaroch, P., Benmerah, A., Chavrier, P., Niedergang, F.
(2007). AP-1 and ARF1 Control Endosomal Dynamics at Sites of FcR mediated Phagocytosis. Mol. Biol. Cell
18: 4921-4931
[Abstract]
[Full Text]
-
Eden, E. R., Sun, X.-M., Patel, D. D., Soutar, A. K.
(2007). Adaptor protein Disabled-2 modulates low density lipoprotein receptor synthesis in fibroblasts from patients with autosomal recessive hypercholesterolaemia. Hum Mol Genet
16: 2751-2759
[Abstract]
[Full Text]
-
Rollason, R., Korolchuk, V., Hamilton, C., Schu, P., Banting, G.
(2007). Clathrin-mediated endocytosis of a lipid-raft-associated protein is mediated through a dual tyrosine motif. J. Cell Sci.
120: 3850-3858
[Abstract]
[Full Text]
-
Nishi, K., Saigo, K.
(2007). Cellular Internalization of Green Fluorescent Protein Fused with Herpes Simplex Virus Protein VP22 via a Lipid Raft-mediated Endocytic Pathway Independent of Caveolae and Rho Family GTPases but Dependent on Dynamin and Arf6. J. Biol. Chem.
282: 27503-27517
[Abstract]
[Full Text]
-
Uezu, A., Horiuchi, A., Kanda, K., Kikuchi, N., Umeda, K., Tsujita, K., Suetsugu, S., Araki, N., Yamamoto, H., Takenawa, T., Nakanishi, H.
(2007). SGIP1{alpha} Is an Endocytic Protein That Directly Interacts with Phospholipids and Eps15. J. Biol. Chem.
282: 26481-26489
[Abstract]
[Full Text]
-
Lubben, N. B., Sahlender, D. A., Motley, A. M., Lehner, P. J., Benaroch, P., Robinson, M. S.
(2007). HIV-1 Nef-induced Down-Regulation of MHC Class I Requires AP-1 and Clathrin but Not PACS-1 and Is Impeded by AP-2. Mol. Biol. Cell
18: 3351-3365
[Abstract]
[Full Text]
-
Hybiske, K., Stephens, R. S.
(2007). Mechanisms of Chlamydia trachomatis Entry into Nonphagocytic Cells. Infect. Immun.
75: 3925-3934
[Abstract]
[Full Text]
-
Li, J., Peters, P. J., Bai, M., Dai, J., Bos, E., Kirchhausen, T., Kandror, K. V., Hsu, V. W.
(2007). An ACAP1-containing clathrin coat complex for endocytic recycling. JCB
178: 453-464
[Abstract]
[Full Text]
-
Huang, C., Chang, S. C., Yu, I-C., Tsay, Y.-G., Chang, M.-F.
(2007). Large Hepatitis Delta Antigen Is a Novel Clathrin Adaptor-Like Protein. J. Virol.
81: 5985-5994
[Abstract]
[Full Text]
-
Forzan, M., Marsh, M., Roy, P.
(2007). Bluetongue Virus Entry into Cells. J. Virol.
81: 4819-4827
[Abstract]
[Full Text]
-
Inoue, T., Hayashi, T., Takechi, K., Agata, K.
(2007). Clathrin-mediated endocytic signals are required for the regeneration of, as well as homeostasis in, the planarian CNS. Development
134: 1679-1689
[Abstract]
[Full Text]
-
Singhirunnusorn, P., Ueno, Y., Matsuo, M., Suzuki, S., Saiki, I., Sakurai, H.
(2007). Transient Suppression of Ligand-mediated Activation of Epidermal Growth Factor Receptor by Tumor Necrosis Factor-{alpha} through the TAK1-p38 Signaling Pathway. J. Biol. Chem.
282: 12698-12706
[Abstract]
[Full Text]
-
Chaudhuri, R., Lindwasser, O. W., Smith, W. J., Hurley, J. H., Bonifacino, J. S.
(2007). Downregulation of CD4 by Human Immunodeficiency Virus Type 1 Nef Is Dependent on Clathrin and Involves Direct Interaction of Nef with the AP2 Clathrin Adaptor. J. Virol.
81: 3877-3890
[Abstract]
[Full Text]
-
Au, J. S.-Y., Puri, C., Ihrke, G., Kendrick-Jones, J., Buss, F.
(2007). Myosin VI is required for sorting of AP-1B-dependent cargo to the basolateral domain in polarized MDCK cells. JCB
177: 103-114
[Abstract]
[Full Text]
-
Kastning, K., Kukhtina, V., Kittler, J. T., Chen, G., Pechstein, A., Enders, S., Lee, S. H., Sheng, M., Yan, Z., Haucke, V.
(2007). Molecular determinants for the interaction between AMPA receptors and the clathrin adaptor complex AP-2. Proc. Natl. Acad. Sci. USA
104: 2991-2996
[Abstract]
[Full Text]
-
Traub, L. M., Lukacs, G. L.
(2007). Decoding ubiquitin sorting signals for clathrin-dependent endocytosis by CLASPs. J. Cell Sci.
120: 543-553
[Abstract]
[Full Text]
-
Piehl, M., Lehmann, C., Gumpert, A., Denizot, J.-P., Segretain, D., Falk, M. M.
(2007). Internalization of Large Double-Membrane Intercellular Vesicles by a Clathrin-dependent Endocytic Process. Mol. Biol. Cell
18: 337-347
[Abstract]
[Full Text]
-
Byland, R., Vance, P. J., Hoxie, J. A., Marsh, M.
(2007). A Conserved Dileucine Motif Mediates Clathrin and AP-2-dependent Endocytosis of the HIV-1 Envelope Protein. Mol. Biol. Cell
18: 414-425
[Abstract]
[Full Text]
-
Radulescu, A. E., Siddhanta, A., Shields, D.
(2007). A Role for Clathrin in Reassembly of the Golgi Apparatus. Mol. Biol. Cell
18: 94-105
[Abstract]
[Full Text]
-
Motley, A. M., Berg, N., Taylor, M. J., Sahlender, D. A., Hirst, J., Owen, D. J., Robinson, M. S.
(2006). Functional Analysis of AP-2 {alpha} and {micro}2 Subunits. Mol. Biol. Cell
17: 5298-5308
[Abstract]
[Full Text]
-
Borner, G. H.H., Harbour, M., Hester, S., Lilley, K. S., Robinson, M. S.
(2006). Comparative proteomics of clathrin-coated vesicles. JCB
175: 571-578
[Abstract]
[Full Text]
-
Mero, P., Zhang, C. Y., Huang, Z.-Y., Kim, M.-K., Schreiber, A. D., Grinstein, S., Booth, J. W.
(2006). Phosphorylation-independent Ubiquitylation and Endocytosis of Fc{gamma}RIIA. J. Biol. Chem.
281: 33242-33249
[Abstract]
[Full Text]
-
Rappoport, J. Z., Kemal, S., Benmerah, A., Simon, S. M.
(2006). Dynamics of clathrin and adaptor proteins during endocytosis. Am. J. Physiol. Cell Physiol.
291: C1072-C1081
[Abstract]
[Full Text]
-
Mahata, B., Mukherjee, S., Mishra, S., Bandyopadhyay, A., Adhya, S.
(2006). Functional Delivery of a Cytosolic tRNA into Mutant Mitochondria of Human Cells.. Science
314: 471-474
[Abstract]
[Full Text]
-
Maurer, M. E., Cooper, J. A.
(2006). The adaptor protein Dab2 sorts LDL receptors into coated pits independently of AP-2 and ARH. J. Cell Sci.
119: 4235-4246
[Abstract]
[Full Text]
-
Keyel, P. A., Mishra, S. K., Roth, R., Heuser, J. E., Watkins, S. C., Traub, L. M.
(2006). A Single Common Portal for Clathrin-mediated Endocytosis of Distinct Cargo Governed by Cargo-selective Adaptors. Mol. Biol. Cell
17: 4300-4317
[Abstract]
[Full Text]
-
Lee, D.-w., Wu, X., Eisenberg, E., Greene, L. E.
(2006). Recruitment dynamics of GAK and auxilin to clathrin-coated pits during endocytosis. J. Cell Sci.
119: 3502-3512
[Abstract]
[Full Text]
-
Dho, S. E., Trejo, J., Siderovski, D. P., McGlade, C. J.
(2006). Dynamic Regulation of Mammalian Numb by G Protein-coupled Receptors and Protein Kinase C Activation: Structural Determinants of Numb Association with the Cortical Membrane. Mol. Biol. Cell
17: 4142-4155
[Abstract]
[Full Text]
-
Di Pietro, S. M., Falcon-Perez, J. M., Tenza, D., Setty, S. R.G., Marks, M. S., Raposo, G., Dell'Angelica, E. C.
(2006). BLOC-1 Interacts with BLOC-2 and the AP-3 Complex to Facilitate Protein Trafficking on Endosomes. Mol. Biol. Cell
17: 4027-4038
[Abstract]
[Full Text]
-
Deinhardt, K., Berninghausen, O., Willison, H. J., Hopkins, C. R., Schiavo, G.
(2006). Tetanus toxin is internalized by a sequential clathrin-dependent mechanism initiated within lipid microdomains and independent of epsin1. JCB
174: 459-471
[Abstract]
[Full Text]
-
Blanchard, E., Belouzard, S., Goueslain, L., Wakita, T., Dubuisson, J., Wychowski, C., Rouille, Y.
(2006). Hepatitis C Virus Entry Depends on Clathrin-Mediated Endocytosis. J. Virol.
80: 6964-6972
[Abstract]
[Full Text]
-
Hinrichsen, L., Meyerholz, A., Groos, S., Ungewickell, E. J.
(2006). Bending a membrane: How clathrin affects budding. Proc. Natl. Acad. Sci. USA
103: 8715-8720
[Abstract]
[Full Text]
-
Schmidt, U., Briese, S., Leicht, K., Schurmann, A., Joost, H.-G., Al-Hasani, H.
(2006). Endocytosis of the glucose transporter GLUT8 is mediated by interaction of a dileucine motif with the {beta}2-adaptin subunit of the AP-2 adaptor complex. J. Cell Sci.
119: 2321-2331
[Abstract]
[Full Text]
-
Ohno, H.
(2006). Physiological Roles of Clathrin Adaptor AP Complexes: Lessons from Mutant Animals. J Biochem
139: 943-948
[Abstract]
[Full Text]
-
Paing, M. M., Johnston, C. A., Siderovski, D. P., Trejo, J.
(2006). Clathrin Adaptor AP2 Regulates Thrombin Receptor Constitutive Internalization and Endothelial Cell Resensitization. Mol. Cell. Biol.
26: 3231-3242
[Abstract]
[Full Text]
-
Noble, B., Abada, P., Nunez-Iglesias, J., Cannon, P. M.
(2006). Recruitment of the Adaptor Protein 2 Complex by the Human Immunodeficiency Virus Type 2 Envelope Protein Is Necessary for High Levels of Virus Release. J. Virol.
80: 2924-2932
[Abstract]
[Full Text]
-
Bowers, K., Piper, S. C., Edeling, M. A., Gray, S. R., Owen, D. J., Lehner, P. J., Luzio, J. P.
(2006). Degradation of Endocytosed Epidermal Growth Factor and Virally Ubiquitinated Major Histocompatibility Complex Class I Is Independent of Mammalian ESCRTII. J. Biol. Chem.
281: 5094-5105
[Abstract]
[Full Text]
-
Johannessen, L. E., Pedersen, N. M., Pedersen, K. W., Madshus, I. H., Stang, E.
(2006). Activation of the epidermal growth factor (EGF) receptor induces formation of EGF receptor- and Grb2-containing clathrin-coated pits.. Mol. Cell. Biol.
26: 389-401
[Abstract]
[Full Text]
-
Su, J., He, L., Zhang, N., Ho, P. C.
(2006). Evaluation of Tributyrin Lipid Emulsion with Affinity to Low-Density Lipoprotein: Pharmacokinetics in Adult Male Wistar Rats and Cellular Activity on Caco-2 and HepG2 Cell Lines. J. Pharmacol. Exp. Ther.
316: 62-70
[Abstract]
[Full Text]
-
Schweitzer, J. K., Burke, E. E., Goodson, H. V., D'Souza-Schorey, C.
(2005). Endocytosis Resumes during Late Mitosis and Is Required for Cytokinesis. J. Biol. Chem.
280: 41628-41635
[Abstract]
[Full Text]
-
Chen, C., Vincent, O., Jin, J., Weisz, O. A., Montelaro, R. C.
(2005). Functions of Early (AP-2) and Late (AIP1/ALIX) Endocytic Proteins in Equine Infectious Anemia Virus Budding. J. Biol. Chem.
280: 40474-40480
[Abstract]
[Full Text]
-
Urs, N. M., Jones, K. T., Salo, P. D., Severin, J. E., Trejo, J., Radhakrishna, H.
(2005). A requirement for membrane cholesterol in the {beta}-arrestin- and clathrin-dependent endocytosis of LPA1 lysophosphatidic acid receptors. J. Cell Sci.
118: 5291-5304
[Abstract]
[Full Text]
-
Mitsunari, T., Nakatsu, F., Shioda, N., Love, P. E., Grinberg, A., Bonifacino, J. S., Ohno, H.
(2005). Clathrin Adaptor AP-2 Is Essential for Early Embryonal Development. Mol. Cell. Biol.
25: 9318-9323
[Abstract]
[Full Text]
-
Lee, D.-w., Zhao, X., Zhang, F., Eisenberg, E., Greene, L. E.
(2005). Depletion of GAK/auxilin 2 inhibits receptor-mediated endocytosis and recruitment of both clathrin and clathrin adaptors. J. Cell Sci.
118: 4311-4321
[Abstract]
[Full Text]
-
Stove, V., Van de Walle, I., Naessens, E., Coene, E., Stove, C., Plum, J., Verhasselt, B.
(2005). Human Immunodeficiency Virus Nef Induces Rapid Internalization of the T-Cell Coreceptor CD8{alpha}{beta}. J. Virol.
79: 11422-11433
[Abstract]
[Full Text]
-
Jin, Y.-J., Cai, C. Y., Zhang, X., Zhang, H.-T., Hirst, J. A., Burakoff, S. J.
(2005). HIV Nef-Mediated CD4 Down-Regulation Is Adaptor Protein Complex 2 Dependent. J. Immunol.
175: 3157-3164
[Abstract]
[Full Text]
-
Janvier, K., Bonifacino, J. S.
(2005). Role of the Endocytic Machinery in the Sorting of Lysosome-associated Membrane Proteins. Mol. Biol. Cell
16: 4231-4242
[Abstract]
[Full Text]
-
McCormick, P. J., Martina, J. A., Bonifacino, J. S.
(2005). Involvement of clathrin and AP-2 in the trafficking of MHC class II molecules to antigen-processing compartments. Proc. Natl. Acad. Sci. USA
102: 7910-7915
[Abstract]
[Full Text]
-
Dugast, M., Toussaint, H., Dousset, C., Benaroch, P.
(2005). AP2 Clathrin Adaptor Complex, but Not AP1, Controls the Access of the Major Histocompatibility Complex (MHC) Class II to Endosomes. J. Biol. Chem.
280: 19656-19664
[Abstract]
[Full Text]
-
Mishra, S. K., Keyel, P. A., Edeling, M. A., Dupin, A. L., Owen, D. J., Traub, L. M.
(2005). Functional Dissection of an AP-2 {beta}2 Appendage-binding Sequence within the Autosomal Recessive Hypercholesterolemia Protein. J. Biol. Chem.
280: 19270-19280
[Abstract]
[Full Text]
-
Montagnac, G., Molla-Herman, A., Bouchet, J., Yu, L. C. H., Conrad, D. H., Perdue, M. H., Benmerah, A.
(2005). Intracellular Trafficking of CD23: Differential Regulation in Humans and Mice by Both Extracellular and Intracellular Exons. J. Immunol.
174: 5562-5572
[Abstract]
[Full Text]
-
Hirst, J., Borner, G. H.H., Harbour, M., Robinson, M. S.
(2005). The Aftiphilin/p200/{gamma}-Synergin Complex. Mol. Biol. Cell
16: 2554-2565
[Abstract]
[Full Text]
-
Moskowitz, H. S., Yokoyama, C. T., Ryan, T. A.
(2005). Highly Cooperative Control of Endocytosis by Clathrin. Mol. Biol. Cell
16: 1769-1776
[Abstract]
[Full Text]
-
Huang, F., Sorkin, A.
(2005). Growth Factor Receptor Binding Protein 2-mediated Recruitment of the RING Domain of Cbl to the Epidermal Growth Factor Receptor Is Essential and Sufficient to Support Receptor Endocytosis. Mol. Biol. Cell
16: 1268-1281
[Abstract]
[Full Text]
-
Sigismund, S., Woelk, T., Puri, C., Maspero, E., Tacchetti, C., Transidico, P., Di Fiore, P. P., Polo, S.
(2005). From the Cover: Clathrin-independent endocytosis of ubiquitinated cargos. Proc. Natl. Acad. Sci. USA
102: 2760-2765
[Abstract]
[Full Text]
-
Chen, H., De Camilli, P.
(2005). From the Cover: The association of epsin with ubiquitinated cargo along the endocytic pathway is negatively regulated by its interaction with clathrin. Proc. Natl. Acad. Sci. USA
102: 2766-2771
[Abstract]
[Full Text]
-
Legendre-Guillemin, V., Metzler, M., Lemaire, J.-F., Philie, J., Gan, L., Hayden, M. R., McPherson, P. S.
(2005). Huntingtin Interacting Protein 1 (HIP1) Regulates Clathrin Assembly through Direct Binding to the Regulatory Region of the Clathrin Light Chain. J. Biol. Chem.
280: 6101-6108
[Abstract]
[Full Text]
-
Meier, O., Gastaldelli, M., Boucke, K., Hemmi, S., Greber, U. F.
(2005). Early Steps of Clathrin-Mediated Endocytosis Involved in Phagosomal Escape of Fc{gamma} Receptor-Targeted Adenovirus. J. Virol.
79: 2604-2613
[Abstract]
[Full Text]
-
Kapetanovich, L., Baughman, C., Lee, T. H.
(2005). Nm23H2 Facilitates Coat Protein Complex II Assembly and Endoplasmic Reticulum Export in Mammalian Cells. Mol. Biol. Cell
16: 835-848
[Abstract]
[Full Text]
-
Signoret, N., Hewlett, L., Wavre, S., Pelchen-Matthews, A., Oppermann, M., Marsh, M.
(2005). Agonist-induced Endocytosis of CC Chemokine Receptor 5 Is Clathrin Dependent. Mol. Biol. Cell
16: 902-917
[Abstract]
[Full Text]