|
||
Article |
Mammalian PAR-1 determines epithelial lumen polarity by organizing the microtubule cytoskeleton
Address correspondence to Anne Müsch, Margaret M. Dyson Vision Research Institute, Weill Medical College of Cornell University, 1300 York Ave., Box 233, New York, NY 10021. Tel.: (212) 746-2260. Fax: (212) 746-8101. email: amuesch{at}mail.med.conell.edu
| Abstract |
|---|
|
|
|---|
Epithelial differentiation involves the generation of luminal surfaces and of a noncentrosomal microtubule (MT) network aligned along the polarity axis. Columnar epithelia (e.g., kidney, intestine, and Madin-Darby canine kidney [MDCK] cells) generate apical lumina and orient MT vertically, whereas liver epithelial cells (hepatocytes and WIFB9 cells) generate lumina at cellcell contact sites (bile canaliculi) and orient MTs horizontally. We report that knockdown or inhibition of the mammalian orthologue of Caenorhabditis elegans Par-1 (EMK1 and MARK2) during polarization of cultured MDCK and WIFB9 cells prevented development of their characteristic lumen and nonradial MT networks. Conversely, EMK1 overexpression induced the appearance of intercellular lumina and horizontal MT arrays in MDCK cells, making EMK1 the first known candidate to regulate the developmental branching decision between hepatic and columnar epithelial cells. Our experiments suggest that EMK1 primarily promotes reorganization of the MT network, consistent with the MT-regulating role of this gene product in other systems, which in turn controls lumen formation and position.
Key Words: EMK1; MARK2; MDCK; WIFB; apical surface
Abbreviations: BC, bile canaliculi; DPPIV, dipeptidyl aminopeptidase IV; KN-EMK1, kinase-negative EMK1; MT, microtubule; MTOC, MT organizing center; VAC, vacuolar apical compartment.
| Introduction |
|---|
|
|
|---|
A good candidate cellular system to regulate lumen position in epithelial cells is the microtubule (MT) cytoskeleton because of the following: (a) epithelial polarization is accompanied by a dramatic change in MT organization; (b) simple columnar epithelia have a MT organization that is different from that of hepatic epithelia; (c) the polarized delivery of apical (luminal) membrane proteins is controlled by the MT cytoskeleton (for review see Mays et al., 1994; Grindstaff et al., 1998; Kreitzer et al., 2003); and (d) MT disruption inhibits the maintenance of luminal domains in intestinal cells in vivo (Achler et al., 1989) and in the intestinal epithelial cell line Caco2 (Gilbert et al., 1991) and follicle formation in three-dimensional primary thyroid cultures (Yap and Manley, 2001). Nonpolarized epithelial cells exhibit a radial MT array with the slow-growing minus ends emanating from a juxtanuclear MT organizing center (MTOC) and the plus ends extending to the cell cortex (Bacallao et al., 1989), an arrangement generally observed in fibroblasts and other nonepithelial cells. When simple epithelial cells (e.g., MDCK) reach confluency and polarize, the MTs form vertical arrays with the negative ends facing an MTOC under the cell apex and arrays of mixed polarity at the apical and basal poles (Bacallao et al., 1989; Bre et al., 1990). Most MTs appear not to be associated with the MTOC; the mechanisms involved in release of MT negative ends from the MTOC and capture at cortical sites have not been elucidated. Polarized hepatic cells also organize their MT noncentrosomally; unlike simple epithelia, the general orientation of these arrays is horizontal, with the negative ends facing an MTOC under the BC (Meads and Schroer, 1995). No mechanisms have been identified that control the MT rearrangements observed in polarizing epithelial cells or the differential MT arrangements observed in simple and hepatic epithelia. Therefore, the relevance of MT reorganization for lumen formation remains unclear.
A clue on which molecules might be controlling the MT organization responsible for polarized apical trafficking and perhaps for polarized lumen formation is provided by studies in organisms especially amenable to genetic analysis. PAR-1 is a serine/threonine kinase that was shown to be essential for the establishment of polarity in the Caenorhabditis elegans zygote (Guo and Kemphues, 1995) and the Drosophila melanogaster oocyte (Shulman et al., 2000; Tomancak et al., 2000). Its mammalian homologues, the family of EMK/MARK proteins, regulate polarity in neuronal cell models (Biernat et al., 2002) and appear to function redundantly in phosphorylating MT-associated proteins and in regulating MT stability (Drewes et al., 1998). Likewise, evidence in D. melanogaster suggests that at least some aspects of PAR-1 function in embryonic polarity involve MT-dependent events (Cox et al., 2001; Vaccari and Ephrussi, 2002). Moreover, recent studies in D. melanogaster follicle epithelia have suggested that PAR-1 localizes to the lateral surface and regulates cell shape and monolayer integrity as well as MT stability and organization in this epithelium (Cox et al., 2001; Doerflinger et al., 2003). In contrast, Hurd and Kemphues (2003) found no polarity defects in PAR-1deficient vulva epithelia of C. elegans but reported a role for PAR-1 in cellular process extension and cellcell contact during vulva morphogenesis. Bohm et al. (1997) have suggested that EMK1/MARK2 regulates polarity in the dog kidney cell line MDCK based on its association with the lateral surface and on the observation that cells expressing dominant-negative EMK1 change shape and lose adhesion to their neighbors. The changes in cell shape and apico-basal polarity elicited by PAR-1 inhibition in different epithelial systems together with the observation that PAR-1 is a kinase for MT-associated proteins make this gene product an excellent candidate to test the hypothesis that the MT cytoskeleton regulates lumen formation in epithelial cells.
In the studies reported here, we have used siRNA to EMK1 and a dominant-negative form of the kinase to knock down its function in two models for columnar epithelial cell (MDCK) polarization, collagen overlay (Hall et al., 1982), and Ca2+ switch (Gonzalez-Mariscal et al., 1990) and a model for liver cell polarization (WIFB9; Ihrke et al., 1993). We demonstrate that EMK1/MARK2 is essential for the de novo formation and positioning of luminal domains and for the development of nonradial, epithelial-specific MT arrays in polarizing columnar and hepatic epithelial cells. Our additional experiments show that high expression levels of EMK1 during polarization of MDCK cells promote the appearance of numerous intercellular lumina and a horizontal MT arrangement, both typical of the hepatocyte phenotype, whereas overexpression of the kinase in fully polarized cells only affected MT organization. The data demonstrate an important regulatory role of PAR-1 in the acquisition of epithelial-specific MT arrays that control the generation of polarized lumina in columnar and hepatic epithelia. Furthermore, they support previous findings (Vega-Salas et al., 1987; Ojakian et al., 1997) that indicate that a transient "hepatic" phenotype characterized by the presence of intercellular lumina is an intermediate stage in the de novo generation of polarity by simple columnar epithelia.
| Results |
|---|
|
|
|---|
|
|
To understand how EMK1 may be involved in the formation of the apical surface, we used the Ca2+ switch assay (Gonzalez-Mariscal et al., 1990). When cultured at confluency in Ca2+-depleted medium, MDCK cells do not interact with neighboring cells, and hence fail to form a lateral surface domain ("contact naive" cells; Gonzalez-Mariscal et al., 1990). When prevented from polarizing, apical markers accumulate intracellularly in a specialized vacuolar apical compartment (VAC; see Fig. 4 C, control, 0 h; Vega-Salas et al., 1987). Synchronous cellcell adhesion induced by addition of normal (1.8 mM) Ca2+ levels causes exocytosis of VACs to the cellcell contact surface. Development of the lateral domain leads to displacement of the lateral lumen to the apex and acquisition of a polarized simple columnar shape.
EMK1 knockdown inhibited the generation of the luminal domain in Ca switch assays. 24 h after Ca switch, when control cells were fully polarized, EMK1-KO monolayers exhibited fivefold less gp135 at the cell surface than control cultures (20 ± 6%; see Materials and methods for details; Fig. 2 C, top). When normalized for the two times larger apical surface area (Fig. 2 C) individual EMK1-KO cells had 40% of surface gp135 of control cells. We obtained similar results for the apical protein GP114 (Fig. S1, top, available at http://www.jcb.org/cgi/content/full/jcb.200308104/DC1; Le Bivic et al., 1990). That EMK1-KO MDCK cells exhibited a defect in apical surface formation was further evidenced by the reduction of the number of microvilli-specific differentiations of the apical domain (Fig. 2 C, microvilli). Pulsechase analysis revealed that EMK1-KO drastically reduced the half-life of apical proteins at the cell surface (unpublished data). In contrast, basolateral markers such as Na-K-ATPase and the cellcell adhesion complexes of E-cadherin and ß-catenin were present at the lateral domain at comparable levels in control and EMK1-KO cells (Fig. 2 C, bottom panels, and not depicted for Na-K-ATPase). However, EMK1-KO prevented MDCK cells from compacting and fully developing their columnar cell shape. The length of the lateral domain was 6 ± 2 µm in EMK1-KO cells versus 12 ± 3 µm in control. EMK1-KO monolayers reached only 50% of the packing density of control cultures at confluency (Fig. 2 C, x-z). Despite their reduced length, EMK1-KO cells distributed the apical and basolateral proteins remaining at the cell surface into polarized domains separated by tight junctions (Fig. 2 C, Ca switch, x-z). These data indicate that EMK1 is required both for the formation of a mature luminal domain and for the full development of columnar cell shape in polarizing MDCK cells.
We obtained similar results as those described for EMK1 knockdown when we expressed a kinase-deficient form of EMK1, kinase-negative EMK1(KN-EMK1), which has been suggested to act in a dominant-negative fashion (Bohm et al., 1997). We found that recombinant KN-EMK1, expressed by adenovirus-mediated gene transfer in polarized cells (Fig. S2, available at http://www.jcb.org/cgi/content/full/jcb.200308104/DC1), accumulated like the endogenous kinase at the apical junctional complex and showed intracellular labeling; in addition, labeling also extended along the lateral domain (Fig. 3 A). Transduction of MDCK cells with a virus carrying the recombinant protein, but not with a control virus, inhibited tubulogenesis and lumen formation in collagen overlay assays (Fig. 3 B). KN-EMK1 also caused a reduction in gp135 levels at the cell surface and prevented cell compaction and growth of the lateral domain in Ca switch assays resulting in cells with a reduced height (Fig. 3 C). In contrast to the dramatic changes caused by KO or KN-EMK1 expression in polarizing MDCK cells, expression of KN-EMK1 after cells had fully established polarity (i.e., transduction of monolayers after 3 d at confluency) did not affect cell shape and had no obvious effect on the appearance or position of the luminal domain (unpublished data).
|
|
Overexpression of EMK1 after the cells were fully polarized did not cause morphological changes or changes in the position of the luminal domain, indicating that EMK1 promotes hepatic-type lumina only during the development of polarity in MDCK cells. Together with the results from KN-EMK1 expression in fully polarized MDCK cells, these data indicate that the kinase functions in the generation rather than in the maintenance of epithelial luminal domains.
EMK1 regulates BC formation in WIFB9 cells
The gain-of-function experiments demonstrating the generation of hepatocyte-like lumina in MDCK cells prompted us to test whether EMK1 also regulates lumen morphogenesis in the hepatic model cell line WIFB9 (Ihrke et al., 1993). We confirmed published results that showed that WIFB9 cells develop typical hepatocyte polarity over a period of 15 d (Decaens et al., 1996). After 5 d in culture, cells formed monolayers with a polarity similar to that of intestinal or kidney epithelial cells; i.e., the cells expressed the luminal markers dipeptidyl aminopeptidase IV (DPPIV) and HA4 (not depicted) and the tight junction protein ZO1 at their apical poles, and the basolateral markers CE9 and E-cadherin (not depicted) at their basolateral domains (Fig. 5 B, day 5). Subsequently, WIFB9 cells lost their luminal surface (Fig. 5 C, note the absence of DPPIV from many control cells [GFP] at day 9) before they reaccumulated luminal markers in intercellular BC-like lumina characteristic of polarized hepatocytes (Fig. 5 B, day 15).
|
The effects on lumen morphogenesis are secondary to regulation of MT organization by EMK1
What subcellular system could mediate the effects of PAR-1 on epithelial lumen formation? Because PAR-1 homologues have been identified as MT-regulating kinases in other models (Drewes et al., 1998) and apical protein traffic is MT dependent (for review see Grindstaff et al., 1998), we performed experiments to study EMK1s participation in the organization of MTs in WIFB9 and MDCK cells. In WIFB9 cells, MTs run along a horizontal axis with their negative ends concentrated around the MTOC located immediately next to the BC lumina (Meads and Schroer, 1995; Fig. 6, WIFB9, control). In columnar MDCK cells, the MTOC localizes immediately under the apical surface where the sub-apical MT network is present (Bacallao et al., 1989; Fig. 6, MDCK, control). KN-EMK1 expression in polarizing WIFB9 cells inhibited the development of a hepatocyte-like MT organization, resulting in a radial MT array that originated from a juxtanuclear MTOC, which is characteristic of fibroblastic and nonpolarized epithelial cells (Fig. 6, WIFB9, KN-EMK1). Conversely, EMK1 overexpression in MDCK cells during Ca switch induced a liver-like MT organization, with MTOC and converging MTs adjacent to the lateral lumina (Fig. 6, MDCK, EMK1). These experiments demonstrate that EMK1 induces a liver-like MT organization in MDCK cells.
|
|
| Discussion |
|---|
|
|
|---|
|
The use of a dominant-negative kinase and acute protein knockdown in cell culture systems allowed us to discover a role for EMK1 in epithelial morphogenesis that was not apparent in EMK1 knockout mice (Bessone et al., 1999; Hurov et al., 2001). The lack of gross morphogenetic defects in EMK1-KO mice is most likely due to compensation by one of three other EMK kinases that are ubiquitous and act redundantly when expressed in different experimental systems (Ebneth et al., 1999, Sun et al., 2001). As in the case of the caveolin knockout mouse, compensatory mechanisms that work in the context of the entire organism do not always operate in the context of cell culture models (for review see Razani and Lisanti, 2001).
The acquisition of an apico-basolateral MT array during epithelial polarization is regulated by EMK1
In parallel with the effects on lumen formation, inhibition of EMK1 expression also affected MT reorganization associated with epithelial polarization. Inhibition of EMK1 expression at the time when polarity was being established prevented the development of a vertical polarized MT network in MDCK cells (Fig. 7) and of horizontal MTs in WIFB9 cells (Fig. 6). Under these conditions, MDCK and WIFB9 cells exhibited a radial MT array that emanated from the perinuclear region. In contrast, inhibition of EMK1 function in fully polarized MDCK or WIFB9 cells was not sufficient to reverse either MT or lumen organization, suggesting that EMK1 provides an early cue for the acquisition of both epithelial features but is dispensable for their maintenance.
However, overexpression of EMK1 in MDCK cells undergoing polarization promoted both a hepatic lumen polarity and a hepatic MT organization. As with EMK1 inhibition, overexpression of the kinase in fully polarized MDCK cells did not affect lumen polarity. However, the recombinant kinase induced vertical MTs and reduced the apical MT web in fully polarized cells (Fig. 7). These experiments suggest that the primary function of EMK1 is to promote the organization of epithelial-specific MT arrays, which, in turn, induces alterations in the intracellular transport of luminal proteins. In support of this interpretation, we observed alterations in the trafficking mode for apical proteins elicited by EMK1 expression in fully polarized MDCK cells even though their steady-state distribution was unchanged (unpublished data).
Our data demonstrate that epithelial cells undergoing polarization are susceptible to changes in MT distribution regulated by EMK1 that lead to changes in apical protein trafficking and lumen position. In contrast, fully polarized epithelial cells can change their MT distribution and partially modify their apical protein trafficking under the influence of EMK1, but this is not sufficient to alter the position of their lumina.
A model on the regulation of epithelial lumen morphogenesis by EMK1 localized at the apical junctional complex
Endogenous EMK is polarized to the lateral domain (Bohm et al., 1997) and in our hands enriched at the apical junctional complex. Formation of E-cadherinmediated adhesions provides the cue to generate identity of the lateral domain in MDCK cells (for review see Yeaman et al., 1999). Forced induction of cellcell adhesion in centrosome-free cytoplasts obtained from fibroblasts transfected with E-cadherin promotes changes in MT behavior from treadmilling to dynamic instability, which is compatible with stabilization of MT minus ends (Chausovsky et al., 2000). We speculate that newly formed E-cadherinmediated contacts between neighboring epithelial cells undergoing polarization could activate signaling by membrane-bound EMK1 leading to the capture of MT negative ends, resulting in the establishment of a noncentrosomal MT distribution. In turn, this may lead to a lateral shift in the centrosome localization (also promoted by EMK1; Fig. 7), further reinforcing the noncentrosomal MT distribution. Once negative MT ends are captured at cortical sites, minus enddirected MT motors that mediate apical exocytosis (for review see Noda et al., 2001) could transport intracellular vesicles carrying apical markers (e.g., VACs in the Ca switch model) toward the sites of cellcell contact. Our data are consistent with a scenario in which moderate EMK1-signaling levels regulate the growth of the lateral membrane and compaction in polarizing MDCK cells and the relocalization of the "luminal targeting patch," required for the fusion of apical transport vesicles, to the developing apical domain. This process likely involves the capture of MT negative ends by a maturing apical cortical cytoskeleton (Salas et al., 1997, Mogensen et al. 2000) and the relocalization of the MTOC beneath the luminal domain. Indeed, recent results indicate that during polarization of MDCK cells, syntaxin 3 changes from a nonpolar distribution to an apical distribution in a process dependent on MT (Kreitzer et al., 2003). According to the same scenario, higher EMK1-signaling levels prevent the relocalization of the luminal targeting patch to the apical membrane by arresting the transient MT organization at the lateral membrane. Elucidation of the EMK1-signaling cascade, currently a main objective in our laboratory, is essential to experimentally test the details of this model.
| Materials and methods |
|---|
|
|
|---|
cDNA generation and expression
Canine EMK1 was cloned from an MDCK ZAPII library (provided by M. Zerial, Max Planck Institute for Molecular Cell Biology and Genetics, Dresden, Germany) and shows 99.3% similarity with the short splice variant of human EMK1 (GenBank/EMBL/DDBJ accession no. NM 004954). The NH2-terminal 810 bp encoding the kinase domain were deleted in the KN-EMK1 cDNA. Recombinant adenoviruses expressing GFP (the nonenhanced version) or KN-EMK1-myc were generated and propagated as described previously (Cohen et al., 2001). For RT-PCR, 2 µg of total RNA was reverse transcribed with oligo-dT primers; 1 µl of the first strand reaction was amplified with either rat G3PDH primers (Promega) or with EMK1 (primers: 5'caggtgcgggaccagcaga3'; 5'tggctattttggaggcaatgtt3') that completely match the canine, rat, and human sequences. Knockdown of EMK1 by siRNA was performed by cloning the annealed sequences 5'gatccccGAGGTAGCTGTGAAGATCAttcaagagaTGATCTTCACAGCTAC-CTCtttttggaaa3' and 5'agcttttccaaaaaGAGGTAGCTGTGAAGATCAtctcttgaaTGATCTTCACAGCTACCTCggg3' into the vector pSUPER (Brummelkamp et al., 2002; provided by R. Agami, The Netherlands Cancer Institute, Amsterdam, Netherlands). Transient transfection of the RNAi plasmid was performed by nucleofection with AmaxaTM technology using 20 µg of cDNA/4 x 106 cells. Cells were analyzed 48 h after transfection.
Antibodies
A rabbit polyclonal EMK/MARK antibody was raised against a GST-fusion protein with the COOH-terminal 310 aa of mouse EMK2 (EST I.M.A.G.E. clone; GenBank/EMBL/DDBJ accession no. aa162350) that was conserved among MARK family members and affinity purified.
Other antibodies used were as follows: myc, clone 9E10 (Santa Cruz Biotechnology, Inc.); gp135 (clone 3F21D8; provided by G. Ojakian, SUNY Downstate Medical Center, Brooklyn, NY), gp114 (Balcarova-Stander et al., 1984), rat monoclonal ZO-1 (Chemicon), E-cadherin (BD Biosciences), ß-tubulin (clone TUB 2.1; Sigma-Aldrich);
-tubulin (clone GTU-88; Sigma-Aldrich), pericentrin (Covenance), DPPIV (Serotec), and anti-HA4c19 (Hubbard et al., 1985).
Immunolabeling techniques/quantification
For immunofluorescence, MDCK cells were fixed at RT or on ice (for EMK labeling) with 2% PFA; WIFB9 cells were fixed on ice with 3% PFA; and permeabilization was performed with 0.075% saponin. For MT labeling, cells were extracted for 30 s at 37°C with PEM (100 mM Pipes, pH 6.8, 1 mM EGTA, and 1 mM Mg2Cl2) + 0.5% Triton X-100 and fixed in ice-cold methanol. For MT regrowth experiments, cells were kept on ice for 1 h and extracted for 30 s at RT. Confocal microscopy was performed with a model TCS SP2 (Leica) using a 63x oil objective. Presented are individual confocal x-y sections, vertical views, or where indicated x-y-z projections generated with LCS software (Leica). Images were processed with Adobe Photoshop. Phase and wide-field images were acquired with either a 60x oil lens or a 40 or 20x dry objective on a microscope (model E-600; Nikon) equipped with a back-illuminated cooled CCD camera (model 1000-PB; Roper Scientific) and processed with Metamorph software (Universal Imaging Corp.).
Gp135-surface fluorescence was quantified with Metamorph software from 20x-wide field images taken of 10 random fields at the same exposure. To normalize for cell number per surface area, cells in 10 random fields of equal surface area (corresponding to
100 cells in control monolayers) were counted. Similarly, cell compaction was assessed by determination of the cell number per surface area from 20x phase images taken 24 and 48 h after plating control and EMK1-KO cells at confluency (0.6 x 106 cells/cm2). Height of the lateral domain was determined with confocal software (Leica) from x-z sections of 10 images taken with a 63x oil lens; data are from two different experiments.
For transmission EM, cells were fixed in 2% glutaraldehyde/PBS + Ca2+/Mg2+, washed with 0.1M Cacodylate, pH 7.4, postfixed in 1% OsO4, contrasted with 1% aqueous uranyl-acetate, dehydrated, and embedded in Epon-Araldite. Sections were cut perpendicular (Fig. 2) or parallel (Fig. 4) to the filter surface and analyzed in a electron microscope (model 100EX II; JOEL USA, Inc.).
Immunoblots were probed with 125I-protein A and analyzed by phosphorimager (Molecular Dynamics).
Online supplemental material
Fig. S1, Gp114 upon EMK1-KO and EMK1 overexpression in Ca switch assays; Fig. S2, recombinant EMK1 in MDCK and WIFB9 cells; and Fig. S3, KN-EMK1 inhibits lateral lumina in EMK1-MDCK cells. Online supplemental material is available at http://www.jcb.org/cgi/content/full/jcb.200308104/DC1.
| Acknowledgments |
|---|
This work was supported by a Stein Professorship of the Research to Prevent Blindness Foundation (to E. Rodriguez-Boulan), grants GM-34107 (to E. Rodriguez-Boulan) and GM-54712 (to P.J. Brennwald) from the National Institutes of Health, and SDG 0235130N of the American Heart Association (to A. Müsch).
Submitted: 19 August 2003
Accepted: 31 December 2003
| References |
|---|
|
|
|---|
Achler, C., D. Filmer, C. Merte, and D. Drenckhahn. 1989. Role of microtubules in polarized delivery of apical membrane proteins to the brush border of the intestinal epithelium. J. Cell Biol. 109:179189.
Bacallao, R., C. Antony, C. Dotti, E. Karsenti, E.H. Stelzer, and K. Simons. 1989. The subcellular organization of Madin-Darby canine kidney cells during the formation of a polarized epithelium. J. Cell Biol. 109:28172832.
Balcarova-Stander, J., S.E. Pfeiffer, S.D. Fuller, and K. Simons. 1984. Development of cell surface polarity in the epithelial Madin-Darby canine kidney (MDCK) cell line. EMBO J. 3:26872694.[Medline]
Balczon, R., C.E. Varden, and T.A. Schroer. 1999. Role for microtubules in centrosome doubling in Chinese hamster ovary cells. Cell Motil. Cytoskeleton. 42:6072.[CrossRef][Medline]
Bessone, S., F. Vidal, Y. Le Bouc, J. Epelbaum, M.T. Bluet-Pajot, and M. Darmon. 1999. EMK protein kinase-null mice: dwarfism and hypofertility associated with alterations in the somatotrope and prolactin pathways. Dev. Biol. 214:87101.[CrossRef][Medline]
Biernat, J., Y.Z. Wu, T. Timm, Q. Zheng-Fischhofer, E. Mandelkow, L. Meijer, and E.M. Mandelkow. 2002. Protein kinase MARK/PAR-1 is required for neurite outgrowth and establishment of neuronal polarity. Mol. Biol. Cell. 13:40134028.
Bohm, H., V. Brinkmann, M. Drab, A. Henske, and T.V. Kurzchalia. 1997. Mammalian homologues of C. elegans PAR-1 are asymmetrically localized in epithelial cells and may influence their polarity. Curr. Biol. 7:603606.[CrossRef][Medline]
Bre, M.H., R. Pepperkok, A.M. Hill, N. Levilliers, W. Ansorge, E.H. Stelzer, and E. Karsenti. 1990. Regulation of microtubule dynamics and nucleation during polarization in MDCK II cells. J. Cell Biol. 111:30133021.
Brummelkamp, T.R., R. Bernards, and R. Agami. 2002. A system for stable expression of short interfering RNAs in mammalian cells. Science. 296:550553.
Chausovsky, A., A.D. Bershadsky, and G.G. Borisy. 2000. Cadherin-mediated regulation of microtubule dynamics. Nat. Cell Biol. 2:797804.[CrossRef][Medline]
Cohen, D., and A. Müsch. 2003. Apical surface formation in MDCK cells: regulation by the serine/threonine kinase EMK1. Methods. 30:269276.[CrossRef][Medline]
Cohen, D., A. Müsch, and E. Rodriguez-Boulan. 2001. Selective control of basolateral membrane protein polarity by cdc42. Traffic. 2:556564.[CrossRef][Medline]
Cox, D.N., B. Lu, T.Q. Sun, L.T. Williams, and Y.N. Jan. 2001. Drosophila par-1 is required for oocyte differentiation and microtubule organization. Curr. Biol. 11:7587.[CrossRef][Medline]
Decaens, C., P. Rodriguez, C. Bouchaud, and D. Cassio. 1996. Establishment of hepatic cell polarity in the rat hepatoma-human fibroblast hybrid WIF-B9. A biphasic phenomenon going from a simple epithelial polarized phenotype to an hepatic polarized one. J. Cell Sci. 109:16231635.[Abstract]
Doerflinger, H., R. Benton, J.M. Shulman, and D.S. Johnston. 2003. The role of PAR-1 in regulating the polarised microtubule cytoskeleton in the Drosophila follicular epithelium. Development. 130:39653975.
Drewes, G., A. Ebneth, and E.M. Mandelkow. 1998. MAPs, MARKs and microtubule dynamics. Trends Biochem. Sci. 23:307311.[CrossRef][Medline]
Ebneth, A., G. Drewes, and E. Mandelkow. 1999. Phosphorylation of MAP2c and MAP4 by MARK kinases leads to the destabilization of microtubules in cells. Cell Motil. Cytoskeleton. 44:209224.[CrossRef][Medline]
Falck-Pedersen, E. 1998. Use and application of adenovirus expression vectors. Light Microscopy and Cell Structure. Vol. 2 of Cells: A Laboratory Handbook. D. Spector, editor. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 128.
Gilbert, T., A. Le Bivic, A. Quaroni, and E. Rodriguez-Boulan. 1991. Microtubular organization and its involvement in the biogenetic pathways of plasma membrane proteins in Caco-2 intestinal epithelial cells. J. Cell Biol. 113:275288.
Gonzalez-Mariscal, L., R.G. Contreras, J.J. Bolivar, A. Ponce, B. Chavez De Ramirez, and M. Cereijido. 1990. Role of calcium in tight junction formation between epithelial cells. Am. J. Physiol. 259:C978C986.
Grindstaff, K.K., R.L. Bacallao, and W.J. Nelson. 1998. Apiconuclear organization of microtubules does not specify protein delivery from the trans-Golgi network to different membrane domains in polarized epithelial cells. Mol. Biol. Cell. 9:685699.
Guo, S., and K.J. Kemphues. 1995. par-1, a gene required for establishing polarity in C. elegans embryos, encodes a putative Ser/Thr kinase that is asymmetrically distributed. Cell. 81:611620.[CrossRef][Medline]
Hall, H.G., D.A. Farson, and M.J. Bissell. 1982. Lumen formation by epithelial cell lines in response to collagen overlay: a morphogenetic model in culture. Proc. Natl. Acad. Sci. USA. 79:46724676.
Hubbard, A.L., J.R. Bartles, and L.T. Braiterman. 1985. Identification of rat hepatocyte plasma membrane proteins using monoclonal antibodies. J. Cell Biol. 100:11151125.
Hogan, B.L., and P.A. Kolodziej. 2002. Organogenesis: molecular mechanisms of tubulogenesis. Nat. Rev. Genet. 3:513523.[CrossRef][Medline]
Hurd, D.D., and K.J. Kemphues. 2003. PAR-1 is required for morphogenesis of the Caenorhabditis elegans vulva. Dev. Biol. 253:5465.[CrossRef][Medline]
Hurov, J.B., T.S. Stappenbeck, C.M. Zmasek, L.S. White, S.H. Ranganath, J.H. Russell, A.C. Chan, K.M. Murphy, and H. Piwnica-Worms. 2001. Immune system dysfunction and autoimmune disease in mice lacking Emk (Par-1) protein kinase. Mol. Cell. Biol. 21:32063219.
Ihrke, G., E.B. Neufeld, T. Meads, M.R. Shanks, D. Cassio, M. Laurent, T.A. Schroer, R.E. Pagano, and A.L. Hubbard. 1993. WIF-B cells: an in vitro model for studies of hepatocyte polarity. J. Cell Biol. 123:17611775.
Kreitzer, G., J. Schmoranzer, S.H. Low, X. Li, Y. Gan, T. Weimbs, S.M. Simon, and E. Rodriguez-Boulan. 2003. Three-dimensional analysis of post-Golgi carrier exocytosis in epithelial cells. Nat. Cell Biol. 5:126136.[CrossRef][Medline]
Le Bivic, A., Y. Sambuy, K. Mostov, and E. Rodriguez-Boulan. 1990. Vectorial targeting of an endogenous apical membrane sialoglycoprotein and uvomorulin in MDCK cells. J. Cell Biol. 110:15331539.
Mays, R.W., K.A. Beck, and W.J. Nelson. 1994. Organization and function of the cytoskeleton in polarized epithelial cells: a component of the protein sorting machinery. Curr. Opin. Cell Biol. 6:1624.[CrossRef][Medline]
Meads, T., and T.A. Schroer. 1995. Polarity and nucleation of microtubules in polarized epithelial cells. Cell Motil. Cytoskeleton. 32:273288.[CrossRef][Medline]
Mitic, L.L., and J.M. Anderson. 1998. Molecular architecture of tight junctions. Annu. Rev. Physiol. 60:121142.[CrossRef][Medline]
Mogensen, M.M., A. Malik, M. Piel, V. Bouckson-Castaing, and M. Bornens. 2000. Microtubule minus-end anchorage at centrosomal and non-centrosomal sites: the role of ninein. J. Cell Sci. 113:30133023.[Abstract]
Noda, Y., Y. Okada, N. Saito, M. Setou, Y. Xu, Z. Zhang, and N. Hirokawa. 2001. KIFC3, a microtubule minus enddirected motor for the apical transport of annexin XIIIbassociated Triton-insoluble membranes. J. Cell Biol. 155:7788.
O'Brien, L.E., M.M. Zegers, and K.E. Mostov. 2002. Opinion: Building epithelial architecture: insights from three-dimensional culture models. Nat. Rev. Mol. Cell Biol. 3:531537.[CrossRef][Medline]
Ojakian, G.K., and R. Schwimmer. 1988. The polarized distribution of an apical cell surface glycoprotein is maintained by interactions with the cytoskeleton of Madin-Darby canine kidney cells. J. Cell Biol. 107:23772387.
Ojakian, G.K., and R. Schwimmer. 1994. Regulation of epithelial cell surface polarity reversal by beta 1 integrins. J. Cell Sci. 107:561576.[Abstract]
Ojakian, G.K., W.J. Nelson, and K.A. Beck. 1997. Mechanisms for de novo biogenesis of an apical membrane compartment in groups of simple epithelial cells surrounded by extracellular matrix. J. Cell Sci. 110:27812794.[Abstract]
Ojakian, G.K., D.R. Ratcliffe, and R. Schwimmer. 2001. Integrin regulation of cell-cell adhesion during epithelial tubule formation. J. Cell Sci. 114:941952.[Abstract]
Razani, B., and M. Lisanti. 2001. Caveolin-deficient mice: insights into caveolar function human disease. J. Clin. Invest. 108:15531561.[CrossRef][Medline]
Salas, P.J., M.L. Rodriguez, A.L. Viciana, D.E. Vega-Salas, and H.P. Hauri. 1997. The apical submembrane cytoskeleton participates in the organization of the apical pole in epithelial cells. J. Cell Biol. 137:359375.
Shanks, M.S., D. Cassio, O. Leqoc, and A.L. Hubbard. 1994. An improved rat hepatoma hybrid cell line. Generation and comparison with its hepatoma relatives and hepatocytes in vivo. J. Cell Sci. 107:813825.[Abstract]
Shulman, J.M., R. Benton, and D. St Johnston. 2000. The Drosophila homolog of C. elegans PAR-1 organizes the oocyte cytoskeleton and directs oskar mRNA localization to the posterior pole. Cell. 101:377388.[CrossRef][Medline]
Sun, T.Q., B. Lu, J.J. Feng, C. Reinhard, Y.N. Jan, W.J. Fantl, and L.T. Williams. 2001. PAR-1 is a Dishevelled-associated kinase and a positive regulator of Wnt signalling. Nat. Cell Biol. 3:628636.[CrossRef][Medline]
Tomancak, P., F. Piano, V. Riechmann, K.C. Gunsalus, K.J. Kemphues, and A. Ephrussi. 2000. A Drosophila melanogaster homologue of Caenorhabditis elegans par-1 acts at an early step in embryonic-axis formation. Nat. Cell Biol. 2:458460.[CrossRef][Medline]
Tuma, P.L., L.K. Nyasae, and A.L. Hubbard. 2002. Nonpolarized cells selectively sort apical proteins from cell surface to a novel compartment, but lack apical retention mechanisms. Mol. Biol. Cell. 13:34003415.
Vaccari, T., and A. Ephrussi. 2002. The fusome and microtubules enrich Par-1 in the oocyte, where it effects polarization in conjunction with Par-3, BicD, Egl, and dynein. Curr. Biol. 12:15241528.[CrossRef][Medline]
Vega-Salas, D.E., P.J. Salas, and E. Rodriguez-Boulan. 1987. Modulation of the expression of an apical plasma membrane protein of Madin-Darby canine kidney epithelial cells: cellcell interactions control the appearance of a novel intracellular storage compartment. J. Cell Biol. 104:12491259.
Vega-Salas, D.E., P.J.I. Salas, and E. Rodriguez-Boulan. 1988. Exocytosis of vacuolar apical compartment (VAC): a cellcell contact controlled mechanism for the establishment of the apical plasma membrane domain in epithelial cells. J. Cell Biol. 107:17171728.
Yap, A.S., and S.W. Manley. 2001. Microtubule integrity is essential for apical polarization and epithelial morphogenesis in the thyroid. Cell Motil. Cytoskeleton. 48:201212.[CrossRef][Medline]
Yeaman, C., K.K. Grindstaff, and W.J. Nelson. 1999. New perspectives on mechanisms involved in generating epithelial cell polarity. Physiol. Rev. 79:7398.
Zegers, M.M., L.E. O'Brien, W. Yu, A. Datta, and K.E. Mostov. 2003. Epithelial polarity and tubulogenesis in vitro. Trends Cell Biol. 13:169176.[CrossRef][Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|