|
||
Article |
Ect2 and MgcRacGAP regulate the activation and function of Cdc42 in mitosis
Correspondence to Shuh Narumiya: snaru{at}mfour.med.kyoto-u.ac.jp
|
|
|---|
Although Rho regulates cytokinesis, little was known about the functions in mitosis of Cdc42 and Rac. We recently suggested that Cdc42 works in metaphase by regulating bi-orient attachment of spindle microtubules to kinetochores. We now confirm the role of Cdc42 by RNA interference and identify the mechanisms for activation and down-regulation of Cdc42. Using a pull-down assay, we found that the level of GTP-Cdc42 elevates in metaphase, whereas the level of GTP-Rac does not change significantly in mitosis. Overexpression of dominant-negative mutants of Ect2 and MgcRacGAP, a Rho GTPase guanine nucleotide exchange factor and GTPase activating protein, respectively, or depletion of Ect2 by RNA interference suppresses this change of GTP-Cdc42 in mitosis. Depletion of Ect2 also impairs microtubule attachment to kinetochores and causes prometaphase delay and abnormal chromosomal segregation, as does depletion of Cdc42 or expression of the Ect2 and MgcRacGAP mutants. These results suggest that Ect2 and MgcRacGAP regulate the activation and function of Cdc42 in mitosis.
Abbreviations used in this paper: CRIB, Cdc42-Racinteracting binding domain; DH, Dbl homology; GAP, GTPase activating protein; GEF, guanine nucleotide exchange factor; MT, microtubule; PH, pleckstrin homology; RNAi, RNA interference.
| Introduction |
|---|
|
|
|---|
Rho GTPases control a variety of cellular processes such as cell adhesion, cell motility, and cell contraction through induction of specific types of actin cytoskeleton and by local regulation of MT dynamics (Etienne-Manneville and Hall, 2002). Although the role of Rho in induction and maintenance of the contractile ring during cytokinesis has been well documented (Kishi et al., 1993; Mabuchi et al., 1993), the role for other Rho GTPases in the regulation of mitotic events was, until recently, unknown. Clostridium difficile toxin B is known to inactivate all members of Rho GTPases by selective glucosylation of the critical threonine residue (Aktories et al., 2000). We have recently found that treatment of HeLa cells with toxin B delays the progression of mitosis in prometaphase and that expression of Cdc42 mutants but not those of Rac1 or RhoA mimics this phenotype (Yasuda et al., 2004). In these cells, spindle MTs fail to bind to chromosomes in the correct bipolar manner, and chromosomes fail to congress at the metaphase plate. These findings suggest that Cdc42 plays an important role in regulating the attachment of spindle MTs to the kinetochore.
Here, we extend this study to confirm the role of Cdc42 in mitosis by RNA interference (RNAi) and to further identify the regulatory mechanisms for activation and down-regulation of this Rho GTPase during cell division. Like other small GTPases, Rho GTPases cycle between the GDP-bound inactive state and the GTP-bound active state. The exchange of bound GDP for GTP is catalyzed by guanine nucleotide exchange factors (GEFs), whereas the hydrolysis of GTP by the GTPases is accelerated by GTPase activating proteins (GAPs; Zheng, 2001; Moon and Zheng, 2003). Previous studies showed that activation of Rho in mitosis is regulated by the action of a Rho exchanger, Ect2, and by the action of a Rho GAP, MgcRacGAP.
Ect2 is a GEF for Rho GTPases, containing the hallmark Dbl homology (DH) domain and pleckstrin homology (PH) domain tandem motif (Miki et al., 1993). Prokopenko et al. (1999) showed in Drosophila melanogaster that Pebble, the Ect2 orthologue, interacts genetically with RhoA and is required for the formation of the contractile ring and initiation of cytokinesis. Tatsumoto et al. (1999) found in mammalian cells that the inhibition of Ect2 function, either by overexpression of deletion mutants lacking the DH and PH domains or by injection of anti-Ect2 antibodies, generated multinucleated cells, indicating that Ect2 is involved in cytokinesis. They further reported that Ect2, which is localized exclusively in the nucleus of interphase cells, is released into the cytoplasm upon nuclear membrane breakdown, is localized on the spindles in metaphase, and accumulates in the cleavage furrow in telophase and then in the midbody at the end of cytokinesis. Using the pull-down assay, we previously verified the importance of Ect2 in mitotic activation of RhoA in HeLa cells (Kimura et al., 2000). We showed that GTP-RhoA accumulates in telophase, and that this accumulation can be abolished by expression of dominant-negative forms of Ect2 in synchronized HeLa cells. Although these studies have established a role for Ect2 in Rho activation and cytokinesis, little is known about its action on other Rho GTPases in mitosis. Ect2 catalyzes in vitro GDP-GTP exchange for Rac1 and Cdc42 as potently as for Rho (Tatsumoto et al., 1999).
MgcRacGAP is a Rho GAP conserved from Caenorhabditis elegans and Drosophila to mammals (Agnel et al., 1992; Toure et al., 1998; Jantsch-Plunger et al., 2000; Kawashima et al., 2000). Hirose et al. (2001) expressed a catalytically inactive mutant of MgcRacGAP, MgcRacGAPR386A, and found production of multinucleate cells by this expression and suggested that this GAP is required for cytokinesis. MgcRacGAP exhibits a similar spatio-temporal localization to that of Ect2: it is present in the nucleus of interphase cells, localizes to the spindle in metaphase and anaphase, and accumulates in the midbody at the end of cytokinesis (Hirose et al., 2001). Jantsch-Plunger et al. (2000) found that a mutation in cyk-4, a MgcRacGAP orthologue in C. elegans, caused disassembly of the central spindle and failure of cytokinesis. Together these results suggest that MgcRacGAP/CYK-4 acts on RhoA and regulates cytokinesis. However, CYK-4 stimulates GTP hydrolysis of not only RhoA but also Rac1 and Cdc42 in vitro. Furthermore, in vitro MgcRacGAP exhibits greater activity toward Rac1 and Cdc42 than toward RhoA (Kawashima et al., 2000). These results raise the possibility that this molecule may also function to regulate Cdc42 and Rac1 in mitosis.
In the present work, we have adopted a variety of strategies to address the aforementioned questions. We have first synchronized HeLa cells and performed pull-down assays for the GTP-bound form of Cdc42 and Rac-1 to identify mitosis-associated changes in the activation of these two GTPases. We have examined the effects of the expression of the dominant-negative forms of Ect2 and MgcRacGAP, or RNAi of Ect2, on the level of GTP-bound Cdc42 and Rac1 during mitosis. We have also investigated mitotic phenotypes of cells either subjected to RNAi for Cdc42 and Ect2, or overexpressing the aforementioned Ect2 and MgcRacGAP mutants. Our results indicate that Ect2 and MgcRacGAP regulate the activation and function of Cdc42 in mitosis.
| Results |
|---|
|
|
|---|
|
Next, we investigated the involvement of MgcRacGAP in the regulation of Cdc42 activation in mitosis. To this end, we used MgcRacGAPR386A, a mutant that is devoid of GAP activity and that is known to produce multinucleate cells when overexpressed (Hirose et al., 2001). We transfected thymidine-synchronized HeLa cells with this GAP mutant and overexpressed the mutant protein in mitotic cells. The lysates of the transfected cells were then subjected to the pull-down assay. Overexpression of MgcRacGAPR386A elevated the amount of GTP-Cdc42 in prometaphase to a level comparable to that found in metaphase in control cells (Fig. 1 C), resulting in premature accumulation of GTP-Cdc42. Curiously, MgcRacGAPR386A expression tended to suppress the Cdc42 activation thereafter (see Discussion). In contrast, the MgcRacGAPR386A expression had little effect on the activation of Rac1 (Fig. 1 C).
We confirmed the aforementioned findings by depletion of endogenous Ect2 with RNAi. As shown in Fig. 2 A, the treatment of HeLa cells with RNAi for Ect2 potently suppressed the expression of the endogenous protein to <20% of that found in control cells after 48 h. We then examined the accumulation of GTP-Cdc42 in cells subjected to RNAi. Although cells subjected to control RNAi exhibited an accumulation of GTP-Cdc42 in metaphase, no accumulation was found in cells subjected to Ect2 RNAi (Fig. 2 B). We also wished to verify the role of MgcRacGAP by RNAi, but we were unable to obtain a significant decrease of this protein by the RNAi strategy we used for Ect2. These results suggest that Ect2 and MgcRacGAP regulate the level of GTP-Cdc42 in mitosis, the former activating Cdc42 in metaphase and the latter suppressing Cdc42 activation in prometaphase. Interestingly, neither Ect2 nor MgcRacGAP appears to regulate Rac activation in mitosis, although they show catalytic activity toward Rac in vitro.
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
Regulation of Cdc42 in mitosis by Ect2 and MgcRacGAP is intriguing, given previous findings that the two molecules regulate Rho in mitosis (Tatsumoto et al., 1999; Kimura et al., 2000; Jantsch-Plunger et al., 2000; Hirose et al., 2001; Minoshima et al., 2003). These results, together with our current findings, indicate that the same GEF and GAP can regulate two different Rho GTPases, Cdc42 and Rho, in different phases of mitosis. Both Ect2 and MgcRacGAP are present in interphase nuclei, are released to the cytoplasm after nuclear envelope breakdown, associate with the spindle MTs, and change their localization during cell division (Tatsumoto et al., 1999; Hirose et al., 2001). These results indicate that they associate with different proteins in different phases of mitosis and/or are modified differently. It is tempting to think that such interactions and/or modifications determine not only their localization but also their specificity. For example, the NH2-terminal domain of Ect2 that we used in these experiments contains the tandem BRCT domains. It was reported recently that the tandem BRCT domains have affinity for phospho-proteins (Yu et al., 2003). Therefore, it is likely that the BRCT domain of Ect2 binds to specific phosphorylated proteins, which in turn provide signals that dictate the specificity of Ect2. Ect2 might bind to different phospho-proteins in metaphase and telophase, which then may provide the phase-specific specificity of this exchanger. Moreover, a subpopulation of Ect2 is phosphorylated early in mitosis (Tatsumoto et al., 1999; Kimura et al., 2000). Experimental evidence for, and an implication of such an interaction and modification, are clearer for MgcRacGAP. Recently, Ban et al. (2004) reported that MgcRacGAP binds PRC1, a mitotic CDK substrate, and that this binding inhibits MgcRacGAP activity toward Cdc42 in metaphase. This finding can explain how Cdc42 is activated in metaphase in spite of its colocalization with MgcRacGAP on the metaphase spindle (Fig. 7 B). It is also known that covalent modification of MgcRacGAP changes its substrate specificity. Minoshima et al. (2003) found that phosphorylation of MgcRacGAP by Aurora kinase B induces latent GAP activity toward RhoA, and this activity is important for down-regulation of Rho at the end of cytokinesis. Thus, it appears that both Ect2 and MgcRacGAP work on Cdc42 around metaphase, whereas they act on RhoA late in mitosis. It is intriguing that the expression of MgcRacGAPR386A elevated the level of GTP-Cdc42 in prometaphase but tended to suppress the Cdc42 activation in metaphase. We do not have an experimental explanation for the latter effect. It may be a secondary effect due to the prometaphase arrest induced by this MgcRacGAP mutant. In addition, Somers and Saint (2003) found association of a Drosophila MgcRacGAP orthologue, RacGAP50C, with a Drosophila Ect2 orthologue, Pebble, during mitosis. Therefore, it is possible that overexpressed MgcRacGAPR386A binds to endogenous Ect2 and affects its activity.
Here, we performed RNAi for Cdc42 and Ect2 and found that depletion of either protein induces prometaphase delay, which is essentially similar to that found in cells subjected to toxin B treatment, overexpression of Cdc42 mutants, and RNAi for mDia3 (Yasuda et al., 2004). Furthermore, we found that expression of MgcRacGAPR386A also interfered with the transition to metaphase in a similar way. This, although apparently paradoxical, is consistent with our finding that both dominant-active and dominant-negative Cdc42 mutant induced the delay in prometaphase, and can be explained by misorientation of the spindle MTs by ectopic expression of an excess amount of active Cdc42. Although dominant-active and dominant-negative Cdc42 mutants induce the opposing actin phenotypes, they cause the same phenotype with respect to MT targeting in interphase cells (Etienne-Manneville and Hall, 2001). These results not only corroborated the role of Cdc42 in the MT attachment to kinetochores but also that Ect2 and MgcRacGAP regulate this Cdc42 function. In contrast, previous studies have shown that interfering with Ect2 and MgcRaGAP causes cytokinesis failure, which led the authors to suggest that Ect2 and MgcRacGAP are linked mainly with RhoA (Tatsumoto et al., 1999; Jantsch-Plunger et al., 2000; Kimura et al., 2000; Hirose et al., 2001). However, though not explicitly described in the previous papers, the tetraploid nucleus in these cells was abnormal in shape. Furthermore, Van de Putte et al. (2001) reported that homozygous disruption of the gene for MgcRacGAP resulted in death of E3.54 embryos due to the failure of chromosomal segregation. In addition, expression of active forms of Pak, an effector of Cdc42, resulted in the production of cells with multiple spindles (Vadlamudi et al., 2000), and an endogenous Pak isoform, Pak 1, was shown to localize at the kinetochore in mitotic cells (Li et al., 2002). Recently, Tatsumoto et al. (2003) used Xenopus laevis mitotic extracts and examined in vitro the effect on mitosis of anti-Ect2 antibody as well as dominant-negative forms of Ect2 and Rho GTPases. They found that addition of either anti-Ect2 antibody or dominant-negative Ect2 or Cdc42 interfered with normal progression of metaphase by causing many misaligned chromosomes, a phenotype very similar to that found in HeLa cells in this study. These results add further support to the role of Ect2 and Cdc42 in mitosis.
Thus, our current findings indicate that Cdc42 is essential in mitosis. Curiously, however, Chen et al. (2000) established a Cdc42 null cell line from ES cells by disruption of the Cdc42 gene, and reported that the Cdc42-null ES cells can proliferate normally. These findings suggest a possibility that other Cdc42-related GTPases such as TC10 and Chp may compensate for the absence of Cdc42. Indeed, the mitotic phenotype in Cdc42 RNAi cells appear milder than that found in toxin Btreated cells. Recently, we found that RNAi for all of the five Cdc42-related GTPases induces a more dramatic phenotype than that of RNAi for Cdc42 alone (unpublished data).
An interesting question is where Cdc42 is localized and functions in mitosis. Our immunofluorescence study showed that Cdc42 localizes on the mitotic spindle of HeLa cells during prometaphase and metaphase and is concentrated in the central spindle in anaphase and in the bridge MTs in the midbody at the end of cell division. This Cdc42 localization is consistent with the reported localization of Ect2 during cell division (Tatsumoto et al., 1999). Association of these molecules with spindle MTs was also suggested by a recent proteome study of isolated midbody preparation (Skop et al., 2004). Interestingly, Ect2-N1 accumulates in the vicinity of the kinetochores of metaphase cells (Fig. 7 D). Ect2 may generate GTP-bound Cdc42 around the kinetochores of metaphase chromosomes. Together, our results provide evidence that Ect2 and MgcRacGAP regulate the activation and function of Cdc42 spatio-temporally in mitosis, the former catalyzing the guanine nucleotide exchange of Cdc42 to activate Cdc42 in metaphase, and the latter facilitating the GTP hydrolysis of Cdc42 in prometaphase.
| Materials and methods |
|---|
|
|
|---|
Plasmids, siRNA preparation, and transfection
pGEX4T1-CRIB-Pak has been described previously (Matsuo et al., 2002). Ect2 cDNA was provided by T. Miki (National Institutes of Health, Bethesda, MD). pCEV32F-Ect2-N1 has been described previously (Kimura et al., 2000). pEGFP-Ect2-N1 was generated by digestion of pCEV32F-Ect2-N1 with BamHI and EcoRI and inserted into BglIIEcoRIdigested pEGFP-C1. pEGFP-EB1, pEGFP-histone H2Bk, pEGFP-Cdc42G12V, and pDsRed2-histone H2Bk have been described previously (Yasuda et al., 2004).
To generate siRNA against Ect2 and Cdc42, we used the BLOCK-iT RNAi-TOPO Transcription and the BLOCK-iT Dicer RNAi kits (Invitrogen). In brief, the NH2-terminal 1,000 nucleotides of Ect2, starting from the first methionine, were amplified by PCR using the primers ATGGCTGAAAATAGTGTATTAACATCCACT and ATTTCTTGAGCTCAGGAGTATTTGCCTTTT. The full coding sequence of Cdc42 (G25K, Homo sapiens) was amplified by using the primers ATGCAGACAATTAAGTGTGTTGTTGTGGGCGA and TCATAGCAGCACACACCTGCGGCTCTTCTT. The PCR fragments obtained were linked to the T7 promoter and amplified again by PCR. The T7-linked PCR products were used for transcription of single stranded RNA and subsequently annealed with complementary RNA to obtain double stranded RNA. As control RNAi, we used RNA duplex for the Escherichia coli LacZ gene as provided by the manufacturer. The RNA duplexes obtained were cleaved into 2123 nucleotide fragments with Dicer enzyme.
Transfection was performed using Lipofectamine-Plus Reagent (Invitrogen). A total of 1 or 4 µg of plasmid DNA was used to transfect HeLa cells in a well of a 6-well plate or a 10-cm dish, respectively. To transfect siRNA into HeLa cells, we used Lipofectamine 2000 (Invitrogen). For immunofluorescence, we used 0.3 µg of siRNA together with 0.5 µg of pEGFP-histone H2B and 6 µl of Lipofectamine 2000 diluted in Opti-MEM. The mixture was added to one well of a 6-well plate and incubated for 2 h at 37°C with 5% CO2. For time-lapse imaging, the cells were transfected with pEGFP-EB1 and pDsRed2-histone H2Bk, together with 0.3 µg of siRNA for either Ect2 or Cdc42 or both. The medium was replaced by DME containing 10% FCS and allowed to incubate for 48 h before observation.
Cell culture and synchronization
HeLa S3 cells were maintained in DME supplemented with 10% FCS and antibiotics at 37°C and with 5% CO2. Cells were synchronized at early S phase by the double thymidine block as described previously (Bostock et al., 1971). In brief, cells were seeded at a density of 2 x 105 per dish onto 10-cm dishes. After overnight culture, the medium was replaced by DME containing 10 mM thymidine and 5% FCS, and the cells were incubated for 12 h. The thymidine-containing medium was removed and the cells were washed twice with PBS without divalent cations. The cells were further cultured in DME containing 10% FCS for 10 h, and then subjected to the second thymidine block for 12 h. The cells were washed twice with PBS and placed in fresh DME containing 10% FCS. Cells were collected in G2 phase, prometaphase, metaphase, telophase, and G1 phase as described previously (Kimura et al., 2000). The cells were either frozen immediately for pull-down assays or used for immunofluorescence. In overexpression experiments, we prolonged the time of the second thymidine block to 15 h, during which we transfected cells using Lipofectamine Plus, 8 to 11 h after the addition of thymidine. For cell cycle analysis, we cotransfected cells with siRNA and pEGFP-histone H2Bk, stained the cells with propidium iodide, and subsequently examined the progression of cells expressing EGFP-histone H2Bk by flow cytometry (Darzynkiewicz, 1994).
Pull-down assays
Recombinant GST-Pak-CRIB was prepared and conjugated with glutathione-Sepharose 4B (Amersham Biosciences) as described previously (Matsuo et al., 2002). Frozen HeLa S3 cells were suspended in the lysis buffer containing 50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 2 mM MgCl2, 1% NP-40, and 10% glycerol supplemented with 10 mM NaF, 1 mM NaVO4, 100 µg/ml PMSF, 5 µg/ml leupeptin, and 5 µg/ml pepstatin. The cell suspension was incubated for 15 min at 4°C with continuous agitation and centrifuged at 18,000 g for 15 min at 4°C. Supernatant was saved and sonicated on ice for 1 s 10 times. Protein concentration was determined by the Lowry method, and 800 µg of the supernatant protein was incubated with 40 µg of GST-CRIB-Pak for 30 min at 4°C. The beads were spun down and washed three times with the lysis buffer. One fourth or one eighth of the precipitates were subjected to SDS-PAGE to determine the amounts of GTP-Rac and GTP-Cdc42, respectively, and one twenty fifth of the supernatant was used to determine the total amounts of Rac and Cdc42. Separated proteins were transferred onto nitrocellulose membranes (Schleicher & Schuell; BA 83). The membranes were blotted with antibodies to Cdc42 (P-1) and Rac1. After the density of each band was determined, the amount of GTP-Cdc42 was calculated by (the density of each GTP-Cdc42 band x 8)/(the density of the total Cdc42 band in the G2 phase of each blot x 25), and expressed as a percentage of the total amount. The amount of GTP-Rac was calculated similarly. The pull-down assay for RhoA was performed as described previously (Kimura et al., 2000).
Time-lapse live imaging
HeLa cells were seeded on 35-mm glass-bottomed dishes (MatTek) and after overnight culture the cells were transfected with pEGFP-EB1 and pDsRed2-histone H2Bk, together with siRNA of Ect2 or Cdc42 or both, as described in the section Plasmids, siRNA preparation, and transfection. After 48 h, the dish was placed on a temperature-controlled stage maintained at 37°C with 5% CO2. Live-imaging was performed on an inverted microscope (model DMIRE2; Leica) with 63x NA 1.3 lenses equipped with a high pressure lamp (Xenon). EGFP, DsRed, and brightfield images were taken with a camera (model CoolSNAP HQ) driven by AS MDW software (Leica). Sequential time-lapse images were acquired every 2.5 min for control RNAi or at 5-min intervals for Ect2 and Cdc42 RNAi. For the cells shown in Fig. 4 (A and B), one Z section was recorded at each time interval. For the cell shown in Fig. 4 C, a collection of 20 Z sections at 0.5-µm step intervals were acquired. The images obtained from Fig. 4 (B and C) were processed by deconvolution using a nonblind method and analyzed with AS MDW and Deblur software (Leica).
Immunofluorescence
Cells collected at various times of mitosis were washed with PBS before fixation with 3.7% PFA in PBS at 37°C for 15 min. The cells were washed three times with PBS and permeabilized with 0.5% Triton X-100 in PBS for 5 min, followed by three washes with PBS. For kinetochore and Mad2 staining, the cells were preextracted with 0.5% Triton X-100 in PHEM buffer (60 mM Pipes, 25 mM Hepes, 10 mM EGTA, and 1 mM Mg-acetate, pH 6.9) for 1 min on ice just before fixation with 3.7% PFA in PBS (Dujardin et al., 1998). After immersion in 100 mM glycine in PBS for 30 min, samples were incubated with 3% BSA in PBS for 30 min. The samples were incubated for 1 h at RT or 4°C overnight with indicated combinations of the following primary antibodies: antiß-tubulin (1:200), anti-Mad2 (Covance; 1:100), and CREST serum (1:500). After three washes with PBS, the samples were incubated with appropriate secondary antibodies coupled to Alexa Fluor 488, Alexa Fluor 594, or Alexa Fluor 647 (Molecular Probes) and DAPI (WAKO). The samples were washed three times with PBS before mounting on glass slides. For detection of Cdc42, cells on the coverslips were rinsed with PHEM solution and extracted with 0.5% Triton X-100 in PHEM for 1 min before fixation with 3.7% PFA in PBS at RT. Antibodies to Cdc42 and MgcRacGAP were used at 1:200 and 1:1,000 dilution, respectively. Immunofluorescence for mDia3 has been described previously (Yasuda et al., 2004).
For high-resolution imaging, fluorescence images were obtained with a microscope (model IX70; Olympus) using oil immersion objective lenses (PlanApo 60, NA 1.4; and PlanApo 100, NA 1.4) and high-selectivity filters under the control of softWoRx software. Serial optical section data (1530 focal planes at 0.5-µm intervals for 60x or 0.2-µm intervals for 100x objectives) were collected on a Peltier-cooled charge-coupled device (Photometrics) and computationally processed by a three-dimensional deconvolution method (Agard et al., 1989).
Online supplemental material
Fig. S1 shows the mitotic phenotype of HeLa cells expressing CRIB-Pak. Videos 13 show mitosis of HeLa cells transfected with control siRNA, Ect2 siRNA, and Cdc42 siRNA, respectively. Online supplemental material is available at http://www.jcb.org/cgi/content/full/jcb. 200408085/DC1.
| Acknowledgments |
|---|
F. Oceguera-Yanez was a recipient of the Monbukagakushou scholarship. This work was supported by grants from a Grant-in-Aid for Specially Promoted Research to S. Narumiya and a Grant-in-Aid for Scientific Research (B) to T. Haraguchi and Y. Hiraoka from the Ministry of Education, Culture, Sports, Science and Technology of Japan; a grant from the Ministry of Health, Labor and Welfare of Japan; and a Core Research for Evolutionary Science and Technology grant from the Japan Science and Technology Agency to T. Haraguchi and Y. Hiraoka.
Submitted: 13 August 2004
Accepted: 18 November 2004
| References |
|---|
|
|
|---|
Agard, D.A., Y. Hiraoka, P. Shaw, and J.W. Sedat. 1989. Fluorescence microscopy in three dimensions. Methods Cell Biol. 30:353377.[Medline]
Agnel, M., L. Roder, C. Vola, and R. Griffin-Shea. 1992. A Drosophila rotund transcript expressed during spermatogenesis and imaginal disc morphogenesis encodes a protein which is similar to human Rac GTPase-activating (racGAP) proteins. Mol. Cell. Biol. 12:51115122.
Aktories, K., G. Schmidt, and I. Just. 2000. Rho GTPases as targets of bacterial protein toxins. Biol. Chem. 381:421426.[CrossRef][Medline]
Ban, R., Y. Irino, K. Fukami, and H. Tanaka. 2004. Human mitotic spindle-associated protein PRC1 inhibits MgcRacGAP activity toward Cdc42 during the metaphase. J. Biol. Chem. 279:1639416402.
Bostock, C.J., D.M. Prescott, and J.B. Kirkpatrick. 1971. An evaluation of the double thymidine block for synchronizing mammalian cells at the G1-S border. Exp. Cell Res. 68:163168.[CrossRef][Medline]
Chen, F., L. Ma, M.C. Parrini, X. Mao, M. Lopez, C. Wu, P.W. Marks, L. Davidson, D.J. Kwiatkowski, T. Kirchhausen, et al. 2000. Cdc42 is required for PIP(2)-induced actin polymerization and early development but not for cell viability. Curr. Biol. 10:758765.[CrossRef][Medline]
Cleveland, D.W., Y. Mao, and K.F. Sullivan. 2003. Centromeres and kinetochores: from epigenetics to mitotic checkpoint signaling. Cell. 112:407421.[CrossRef][Medline]
Darzynkiewicz, Z. 1994. Cell cycle analysis by flow cytometry. Cell Biology: A Laboratory Handbook. Vol. 1. J.E. Celis, editor. Academic Press, New York. 261271.
Dujardin, D., U.I. Wacker, A. Moreau, T.A. Schroer, J.E. Rickard, and J.R. De Mey. 1998. Evidence for a role of CLIP-170 in the establishment of metaphase chromosome alignment. J. Cell Biol. 141:849862.
Etienne-Manneville, S., and A. Hall. 2001. Integrin-mediated activation of Cdc42 controls cell polarity in migrating astrocytes through PKC
. Cell. 106:489498.[CrossRef][Medline]
Etienne-Manneville, S., and A. Hall. 2002. Rho GTPases in cell biology. Nature. 420:629635.[CrossRef][Medline]
Hirose, K., T. Kawashima, I. Iwamoto, T. Nosaka, and T. Kitamura. 2001. MgcRacGAP is involved in cytokinesis through associating with mitotic spindle and midbody. J. Biol. Chem. 276:58215828.
Jantsch-Plunger, V., P. Gönczy, A. Romano, H. Schnabel, D. Hamill, R. Schnabel, A.A. Hyman, and M. Glotzer. 2000. CYK-4: A Rho family GTPase activating protein (GAP) required for central spindle formation and cytokinesis. J. Cell Biol. 149:13911404.
Kawashima, T., K. Hirose, T. Satoh, A. Kaneko, Y. Ikeda, Y. Kaziro, T. Nosaka, and T. Kitamura. 2000. MgcRacGAP is involved in the control of growth and differentiation of hematopoietic cells. Blood. 96:21162124.
Kimura, K., T. Tsuji, Y. Takada, T. Miki, and S. Narumiya. 2000. Accumulation of GTP-bound RhoA during cytokinesis and a critical role of ECT2 in this accumulation. J. Biol. Chem. 275:1723317236.
Kishi, K., T. Sasaki, S. Kuroda, T. Itoh, and Y. Takai. 1993. Regulation of cytoplasmic division of Xenopus embryo by rho p21 and its inhibitory GDP/GTP exchange protein (rho GDI). J. Cell Biol. 120:11871195.
Li, F., L. Adam, R.K. Vadlamudi, H. Zhou, S. Sen, J. Chernoff, M. Mandal, and R. Kumar. 2002. p21-activated kinase 1 interacts with and phosphorylates histone H3 in breast cancer cells. EMBO Rep. 3:767773.[CrossRef][Medline]
Mabuchi, I., Y. Hamaguchi, H. Fujimoto, N. Morii, M. Mishima, and S. Narumiya. 1993. A rho-like protein is involved in the organisation of the contractile ring in dividing sand dollar eggs. Zygote. 1:325331.[Medline]
Matsuo, N., M. Hoshino, M. Yoshizawa, and Y. Nabeshima. 2002. Characterization of STEF, a guanine nucleotide exchange factor for Rac1, required for neurite growth. J. Biol. Chem. 277:28602868.
Miki, T., C.L. Smith, J.E. Long, A. Eva, and T.P. Fleming. 1993. Oncogene ect2 is related to regulators of small GTP-binding proteins. Nature. 362:462465.[CrossRef][Medline]
Minoshima, Y., T. Kawashima, K. Hirose, Y. Tonozuka, A. Kawajiri, Y.C. Bao, X. Deng, M. Tatsuka, S. Narumiya, W.S. May Jr., et al. 2003. Phosphorylation by Aurora B converts MgcRacGAP to a RhoGAP during cytokinesis. Dev. Cell. 4:549560.[CrossRef][Medline]
Moon, S.Y., and Y. Zheng. 2003. Rho GTPase-activating proteins in cell regulation. Trends Cell Biol. 13:1322.[CrossRef][Medline]
Prokopenko, S.N., A. Brumby, L. O'Keefe, L. Prior, Y. He, R. Saint and H.J. Bellen. 1999. A putative exchange factor for Rho1 GTPase is required for initiation of cytokinesis in Drosophila. Genes Dev. 13:23012314.
Skop, A.R., H. Liu, J. Yates III, B.J. Meyer, and R. Heald. 2004. Dissection of the mammalian midbody proteome reveals conserved cytokinesis mechanisms. Science. 305:6166.
Somers, W.G., and R. Saint. 2003. A RhoGEF and Rho family GTPase-activating protein complex links the contractile ring to cortical microtubules at the onset of cytokinesis. Dev. Cell. 4:2939.[CrossRef][Medline]
Tatsumoto, T., X. Xie, R. Blumenthal, I. Okamoto, and T. Miki. 1999. Human ECT2 is an exchange factor for Rho GTPases, phosphorylated in G2/M phases, and involved in cytokinesis. J. Cell Biol. 147:921928.
Tatsumoto, T., H. Sakata, M. Dasso, and T. Miki. 2003. Potential roles of the nucleotide exchange factor ECT2 and Cdc42 GTPase in spindle assembly in Xenopus egg cell-free extracts. J. Cell. Biochem. 90:892900.[CrossRef][Medline]
Toure, A., O. Dorseuil, L. Morin, P. Timmons, B. Jegou, L. Reibel, and G. Gacon. 1998. MgcRacGAP, a new human GTPase-activating protein for Rac and Cdc42 similar to Drosophila rotundRacGAP gene product, is expressed in male germ cells. J. Biol. Chem. 273:60196023.
Vadlamudi, R.K., L. Adam, R.A. Wang, M. Mandal, D. Nguyen, A. Sahin, J. Chernoff, M.C. Hung, and R. Kumar. 2000. Regulatable expression of p21-activated kinase-1 promotes anchorage-independent growth and abnormal organization of mitotic spindles in human epithelial breast cancer cells. J. Biol. Chem. 275:3623836244.
Van de Putte, T., A. Zwijsen, O. Lonnoy, V. Rybin, M. Cozijnsen, A. Francis, V. Baekelandt, C.A. Kozak, M. Zerial, and D. Huylebroeck. 2001. Mice with a homozygous gene trap vector insertion in mgcRacGAP die during pre-implantation development. Mech. Dev. 102:3344.[CrossRef][Medline]
Wang, Y.L. 2001. The mechanism of cytokinesis: reconsideration and reconciliation. Cell Struct. Funct. 26:633638.[CrossRef][Medline]
Wittmann, T., A. Hyman, and A. Desai. 2001. The spindle: a dynamic assembly of microtubules and motors. Nat. Cell Biol. 3:E28E34.[CrossRef][Medline]
Yasuda, S., F. Oceguera-Yanez, T. Kato, M. Okamoto, S. Yonemura, Y. Terada, T. Ishizaki, and S. Narumiya. 2004. Cdc42 and mDia3 regulate microtubule attachment to kinetochores. Nature. 428:767771.[CrossRef][Medline]
Yu, X., C.C.S. Chini, M. He, G. Mer, and J. Chen. 2003. The BRCT domain is a phospho-protein binding domain. Science. 302:639642.
Zheng, Y. 2001. Dbl family guanine nucleotide exchange factors. Trends Biochem. Sci. 26:724732.[CrossRef][Medline]
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|