|
||
Article |
Drosophila melanogaster Cad99C, the orthologue of human Usher cadherin PCDH15, regulates the length of microvilli
Correspondence to Dorothea Godt: dgodt{at}zoo.utoronto.ca
|
|
|---|
Actin-based protrusions can form prominent structures on the apical surface of epithelial cells, such as microvilli. Several cytoplasmic factors have been identified that control the dynamics of actin filaments in microvilli. However, it remains unclear whether the plasma membrane participates actively in microvillus formation. In this paper, we analyze the function of Drosophila melanogaster cadherin Cad99C in the microvilli of ovarian follicle cells. Cad99C contributes to eggshell formation and female fertility and is expressed in follicle cells, which produce the eggshells. Cad99C specifically localizes to apical microvilli. Loss of Cad99C function results in shortened and disorganized microvilli, whereas overexpression of Cad99C leads to a dramatic increase of microvillus length. Cad99C that lacks most of the cytoplasmic domain, including potential PDZ domainbinding sites, still promotes excessive microvillus outgrowth, suggesting that the amount of the extracellular domain determines microvillus length. This study reveals Cad99C as a critical regulator of microvillus length, the first example of a transmembrane protein that is involved in this process.
| Introduction |
|---|
|
|
|---|
Among the molecules that serve a critical function in the formation and regulation of microvillus growth are several F-actin cross-linking proteins, including villin, epsin, fimbrin, and fascin (for reviews see DeRosier and Tilney, 2000; Müller and Littlewood-Evans, 2001; Lin et al., 2005). Epsin can induce microvillus elongation in vitro probably by affecting the actin treadmilling process (Loomis et al., 2003; Sekerkova et al., 2004), and epsin mutant deaf jerker mice have shortened hair cell stereocilia (Zheng et al., 2000). Additional actin-binding factors that control microvillus size colocalize with the tip complex, which is thought to nucleate the microfilament bundle and to regulate actin polymerization at barbed ends. They comprise myosin XVa and its binding partner whirlin, which promote concentration-dependent elongation of hair cell stereocilia (Belyantseva et al., 2003, 2005; Mburu et al., 2003; for review see Lin et al., 2005). EPS-8, another actin-binding protein located at a microvillus tip, regulates microvillus length through its barbed-end capping function in the intestine of Caenorhabditis elegans (Croce et al., 2004). In the early Drosophila melanogaster embryo, absence of the Abelson kinase causes abnormally long microvilli, which correlates with an ectopic accumulation of F-actin and its growth promoting factor Enabled in the apical cell cortex (Grevengoed et al., 2003).
Observations like these suggested that microfilaments and their binding factors may be sufficient for microvillus formation and elongation and that the plasma membrane may serve only as an anchor for the core bundle (for review see Borisy and Svitkina, 2000). That coupling to the plasma membrane is important is suggested by the finding that ezrin, an ERM (ezrinradixinMoesin) protein that likely forms a link between actin filaments and the plasma membrane, induces microvilli in cell culture (Gautreau et al., 2000). Deficiency of ezrin, which appears to organize the terminal web of microvilli, causes shortened, irregular intestinal microvilli in mice (Saotome et al., 2004). Similarly, the terminal webassociated ERM protein Moesin in D. melanogaster is required for normal organization of microvilli in rhabdomeres, and an excessive formation of irregular microvilli results from expressing constitutively active Moesin (Karagiosis and Ready, 2004). However, there has been no evidence so far that would implicate specific integral membrane proteins as regulators of microvillus growth.
Some proteins that have received considerable attention in recent years as important organizers of hair cell stereocilia are protocadherin 15 (PCDH15), cadherin 23 (CDH23), myosin VIIa, harmonin, and SANS. Mutations in these genes are responsible for Usher syndrome type 1 (USH1), a genetic disorder that combines congenital deafness, vestibular dysfunction, and retinitis pigmentosa in humans (for review see Petit, 2001; Ahmed et al., 2003b; Frolenkov et al., 2004). The phenotype of mice mutant for any USH1 gene is characterized by splayed and disorganized stereocilia and consequently it was proposed that the two USH1 cadherins may contribute to the links that visibly connect neighboring stereocilia (for review see Frolenkov et al., 2004). For CDH23, this model is supported by the observations that it colocalizes with lateral and tip links, is needed for tip link integrity, and can mediate homophilic adhesion (Siemens et al., 2004; Söllner et al., 2004; Michel et al., 2005). The molecular function of PCDH15, however, has not been elucidated. In this paper, we report that Cad99C, the fly orthologue of PCDH15, is a component of microvilli and show by loss- and gain-of-function analysis that Cad99C promotes microvillus elongation in a concentration-dependent manner. Our data also suggest that Cad99C acts through a mechanism that does not involve adhesion between microvilli.
| Results |
|---|
|
|
|---|
|
|
Cad99C loss-of-function mutations cause female sterility
The chromosomal interval 99C is poorly characterized, and available deletions are haplolethal. To determine the function of Cad99C, we generated mutations by imprecise excision of two P elements. GE21034 is inserted upstream of the sequences that have been reported to represent exon 1 of Cad99C, and GE23478 is located in intron 1 (Fig. 2 A; Schlichting et al., 2005; http://genexel.com/eng/htm/genisys.htm). Both P element insertions were homozygous viable. However, whereas GE21034 appeared fully fertile, GE23478 females showed reduced fertility that was fully restored by excision of GE23478, indicating that the P element insertion was responsible for this defect. Several excision lines were female sterile (but male fertile; see next section) and had subtle bristle and eye defects (unpublished data). These lines failed to complement each other, and molecular analysis showed that they represent genomic deletions within Cad99C (Fig. 2 A). In Cad99C21-6, we detected a small deletion removing exon 1, which is noncoding. The largest deletions are Cad99C21-8 and Cad99C21-5, with the latter removing most of the coding sequence for the extracellular domain (CDs 18 and part of CD 9).
Cad99C antibodies, raised against a portion of the extracellular (CDs 10 and 11) and cytoplasmic domains (Fig. 2 B), were used to probe Cad99C expression in ovaries of wild-type and homozygous Cad99C mutant females, respectively. Immunoblots identified three protein bands in wild type that were absent in mutants that lack exon 1Cad99C21-5, Cad99C21-6, and Cad99C21-8 (Fig. 2 C). Cad99C protein was also strongly reduced in ovaries that expressed Cad99C double-stranded RNA (dsRNA) causing RNA interference (RNAi; Fig. 2 C). The major band corresponds to
217 kD, which is 30 kD larger than the predicted size of Cad99C, a difference that is partly attributable to N-linked glycosylation (unpublished data). Two weak additional bands (195 and 172 kD) varied in intensity between preparations (inverse proportional to the intensity of the major band) and may represent degraded or otherwise modified Cad99C protein. Together, our results suggest that we isolated null mutations for Cad99C and that this gene is not essential for viability but required for female fertility.
Eggshell formation is compromised in Cad99C mutants
The female-sterile phenotype of Cad99C mutants is caused by defects in eggshell formation as revealed by the following analysis. Cad99C21-5, Cad99C21-8, or Cad99C21-9 mutant females laid
50% fewer eggs than wild-type females, and <2% of those eggs (n > 300 per genotype) produced larvae. These larvae developed into flies that only displayed defects if they were homozygous mutants, and those defects are the same as in homozygous mutants derived from heterozygous mothers, suggesting that maternal loss of Cad99C has no effect on postembryonic development. The majority of eggs from Cad99C mutant females collapsed soon after deposition (Fig. 3, AC), and even noncollapsed eggs were penetrable to the vital dyes neutral red and trypan blue (Fig. 3, DH), which do not stain wild-type eggs (Mahowald, 1972; LeMosy and Hashimoto, 2000). These defects suggested that eggshells, which normally restrict permeability and prevent desiccation (Limbourg and Zalokar, 1973; Mahowald and Kambysellis, 1980), are compromised. Eggs from mutant females were also highly intolerant to sodium hydrochlorite. Hydrochlorite treatment of wild-type eggs removes the outer eggshell, the chorion, but leaves the inner eggshell, the vitelline membrane (VM), intact (Limbourg and Zalokar, 1973). Disintegration of eggs from Cad99C mutant females in hydrochlorite suggests that the VM is not functional (Fig. 3 I). The VM normally forms a continuous layer of homogeneous thickness in late follicles (Mahowald and Kambysellis, 1980), whereas the VM of Cad99C mutant follicles varied in thickness and contained numerous holes (Fig. 3, J and K). These holes are likely the cause for the observed desiccation of eggs. The variability in eggshell defects may explain why mutant females are not fully sterile, allowing a few embryos to develop. The importance of Cad99C for proper eggshell formation is consistent with its expression in follicle cells that secrete the eggshell material.
|
|
Cad99C mutations affect length, shape, and arrangement of follicle cell microvilli
To analyze microvillus formation in the absence of Cad99C, we examined the distribution of F-actin and the membrane marker CD8-GFP. In wild type, F-actin is seen in microvilli of follicle cells and is enriched in the cortex of follicle cells and oocyte (Fig. 5 A). In Cad99C mutant follicles, F-actin staining is strongly reduced in the space between follicle cells and oocyte, suggesting defective microvilli (Fig. 5 B). CD8::GFP labeling revealed a regular microvillus brush border in wild-type follicle cells (Fig. 5, C' and F), whereas Cad99C mutant follicle cells displayed a range of defects of microvilli (Fig. 5, D, E, and G). In all mutant follicles, microvilli appeared substantially shorter than in wild type (Fig. 5, D and E). In many cases, apical protrusions appeared reduced in number, and they formed an irregular spiky pattern, suggesting that microvilli are abnormally shaped and may be clumped. In other cases, no obvious protrusions were detected or only few microvilli with an abnormal, wavy shape protruded from the apical surface (Fig. 5, E and G). Expression of Cad99C dsRNA caused the same type of microvilli defects as Cad99C mutations (Fig. 5 H). The persistent strong CD8::GFP labeling of the apical membrane domain even in cases where no protrusions were detected indicates that a substantial amount of membrane material is retained apically. These findings argue against a complete loss of microvilli and suggest that microvilli are strongly shortened and may also be collapsed against the apical cell surface. Together, these data show that Cad99C is essential to form microvilli of normal length and organization in follicle cells.
|
Overexpression of Cad99C increases microvillus length
To determine whether Cad99C is a limiting factor for microvillus outgrowth, we overexpressed full-length Cad99C (Cad99C-FL; Fig. 6 H) in follicle cells. Cad99C-FL expression induced a striking increase in the length of apical microvilli (Fig. 6 A). These long cellular protrusions, which sometimes exceeded the apicalbasal length of the follicle cells, projected into the narrow space between follicle cells and oocyte (Fig. 6, A, E, and F). Very long extensions showed small knoblike dilatations. Interestingly, the vitelline bodies deposited between the overlong microvilli also appeared enlarged (Fig. 6 A'). Furthermore, expression of Cad99C-FL rescued microvillus formation in a Cad99C mutant background (Fig. 6 B). To investigate the importance of cytoplasmic interactions for Cad99C function, we expressed a transgenic protein (Cad99C
cyt::GFP; Fig. 6 H) in which GFP replaces a large portion of the cytoplasmic tail, including the PDZ-binding sites. Strikingly, Cad99C
cyt::GFP induced abnormally tall microvilli that fanned out from the apical surface and enlarged vitelline bodies similar to Cad99C-FL. This effect was observed in a wild-type (Fig. 6 C) and in a Cad99C mutant background (Fig. 6, D and G). These data suggest that Cad99C levels determine the length of microvilli and show that the majority of the cytoplasmic domain (256 out of 287 amino acids) can be deleted without affecting the potential of Cad99C to promote microvillus outgrowth.
|
| Discussion |
|---|
|
|
|---|
|
Cad99C has an evolutionarily conserved function in microvillus biogenesis
Cad99C specifically localizes to the plasma membrane of microvilli and is distributed throughout their entire length. PCDH15 shows a similar subcellular distribution in stereocilia on the surface of hair cells in the cochlea (Ahmed et al., 2003a). In PCDH15 mutant mice (Ames waltzer) and zebrafish (orbiter), stereocilia are splayed and their arrangement is severely disturbed, causing deafness (Alagramam et al., 2000, 2001; Raphael et al., 2001; Seiler et al., 2005). The function of PCDH15 in stereocilia, however, has remained unclear. Our study indicates that its D. melanogaster orthologue Cad99C is a potent regulator of microvillus size. Interestingly, PCDH15 is found at a higher concentration in the longer stereocilia of a staircase-like bundle of hair cell stereocilia (Ahmed et al., 2003a), and an irregular shortening of stereocilia in Ames waltzer mice was described previously (Alagramam et al., 2000; Raphael et al., 2001). This raises the possibility that PCDH15 regulates the length of stereocilia similar to Cad99C. In addition to being required for size regulation, Cad99C is also important for the normal shape and arrangement of microvilli. It will be interesting to determine in future studies whether the effect on size and on shape and arrangement of microvilli/stereocilia reflects two distinct functions of Cad99C/PCDH15 or whether they are two consequences of the same molecular function. Together, we propose that Cad99C/PCDH15-type cadherins have an evolutionarily conserved role in microvillus biogenesis.
During the course of evolution, Cad99C/PCDH15 cadherins have adapted to act in apparently very different apical actin-based protrusions, such as the follicle cell microvilli of fly ovaries and the complex stereocilia of the vertebrate cochlea. Moreover, loss of Cad99C causes subtle defects in eye rhabdomeres and mechanosensory bristles (unpublished data), indicating that Cad99C is also required for other actin-based protrusions. Similar to PCDH15, which is more widely expressed in epithelial tissues (Murcia and Woychik, 2001; Ahmed et al., 2003a), Cad99C is found on the apical surface of several ectodermal epithelia during D. melanogaster development, including the imaginal discs (Fig. S2, AC, available at http://www.jcb.org/cgi/content/full/jcb.200507072/DC1; Schlichting et al., 2005). In wing imaginal discs as in the follicular epithelium, overexpression of Cad99C induces the formation of very large apical protrusions (Fig. S2, D and E). However, there are epithelial tissues that possess a microvillus brush border but do not express Cad99C at detectable levels, including the midgut (unpublished data). Cad99C is therefore not a general component of microvilli and may serve a biological function that is specifically required in a subset of microvilli. Alternatively, another member of the cadherin superfamily or other membrane protein might take the place of Cad99C in the microvilli of tissues that lack this cadherin.
A working model for Cad99C function
It is tempting to speculate that, as a cadherin, Cad99C may mediate homophilic adhesion between microvilli. However, follicle cell microvilli in wild type and after overexpression of Cad99C are clearly separated from each other, implying that Cad99C mediates neither homophilic nor heterophilic interactions between microvilli while promoting their outgrowth. This conclusion is corroborated by the behavior of cell clones that either lack or overexpress Cad99C. In imaginal discs where Cad99C is concentrated at the apical interface between cells, cell clones with reduced or increased levels of Cad99C expression have wiggly boundaries, indicating that they do not sort out from wild-type cells (Fig. S2 D; Schlichting et al., 2005; unpublished data). Furthermore, Cad99C located ectopically in the lateral membrane of follicle cells when overexpressed is not enriched at the border between Cad99C overexpressing cells compared with borders between wild-type and overexpressing cells (Fig. 6, B and D) as would be expected from a homophilic adhesion molecule. Similarly, in imaginal discs, the distribution of Cad99C along cell boundaries is uniform and independent of the concentration of Cad99C in neighboring cells (Fig. S2 D). Hence, our findings argue against a function of Cad99C in adhesion between adjacent plasma membranes.
A parallel bundle of actin filaments and associated factors that control their cross-linking and turnover are instrumental for the formation and stability of microvilli (for reviews see Bartles, 2000; DeRosier and Tilney, 2000; Lin et al., 2005). To what extent the plasma membrane of microvilli contributes to microvillus morphogenesis either by linking to the actin core or independent of it remains largely unexplored. PCDH15 appears to influence the actin cytoskeleton of stereocilia as the amount of F-actin in stereocilia of PCDH15 mutant hair cells was reduced (Raphael et al., 2001). This effect is possibly mediated through its proposed interactions with the PDZ domain protein harmonin (Adato et al., 2005; Reiners et al., 2005). Among the USH1-associated proteins, harmonin has a central function, as it can also bind to CDH23, myosin VIIa, and SANS (Boëda et al., 2002; Siemens et al., 2002; Weil et al., 2003; Adato et al., 2005), and is able to interact with actin filaments promoting their bundling in cell culture (Boëda et al., 2002), thereby potentially linking cadherins on the cell surface to the actin cytoskeleton.
Unexpectedly, we found that a truncated form of Cad99C that lacks most of the cytoplasmic tail, including the putative PDZ domainbinding sites, causes the same excessive lengthening of microvilli as the full-length protein, even in a Cad99C mutant background. This shows that the PDZ domainbinding sites do not have an essential positive regulatory function in microvillus outgrowth. We cannot rule out that the remaining 31 juxtamembrane cytoplasmic amino acids interact with a cytoplasmic factor, but this short sequence contains no known motifs and is not conserved. Therefore, it seems likely that the membrane-bound extracellular domain of Cad99C is sufficient to promote microvillus extension independent of endogenous Cad99C. How does the extracellular domain of Cad99C control microvillus size? Our data are consistent with two attractive models for Cad99C activity (Fig. 7 C). The CDs of Cad99C could influence the microvillus actin core by binding to an extracellular ligand, which directly or indirectly connects to the actin bundle promoting polymerization. Alternatively, the Cad99C extracellular domain might stabilize the plasma membrane of a microvillus. This may be important because to lengthen a cellular protrusion, the force created by actin polymerization has to overcome the counteracting force caused by tension in the plasma membrane envelope while it is pushed outward (for review see Lin et al., 2005). Stabilization of the plasma membrane might alleviate the tension, allowing actin polymerization to proceed. The CDs of Cad99C could stabilize the plasma membrane either by binding to the extracellular matrix or by self-assembling into an extracellular meshwork that forms a supporting scaffold surrounding the microvillus. The striking conservation of the Cad99C/PCDH15 extracellular domains may reflect the geometric constraints imposed by such a scaffold. The latter model in particular would be consistent with the concentration dependency of Cad99C activity and with its effect on the size and shape of microvilli.
| Materials and methods |
|---|
|
|
|---|
UAS expression lines used were UAS-Cad99C-RNAi (6-5D, chromosome X), UAS-Cad99C-FL (T2 and T5, chromosome X), UAS-Cad99C
cyt::GFP (1810, chromosome X; for details see next paragraph), and UAS-CD8::GFP (Lee and Luo, 1999). Gal4 driver lines used were da-Gal4 (P[GAL4-da.G32]UH1; Wodarz et al., 1995) and Act5c>CD2>Gal4 (Pignoni et al., 1997). To induce expression of UAS-Cad99C-FL and UAS-Cad99C
cyt::GFP in a Cad99C mutant background, a third chromosome carrying both Act5c>CD2>Gal4 and Cad99C21-6 was generated by meiotic recombination. Expression of FLPase (P[hsFLP]1; Golic, 1991), which activates the Act5c>CD2>Gal4 FLPout cassette to clonally express Gal4 that in turn drives expression of UAS-constructs (Pignoni et al., 1997), was induced by a heat shock at 37°C (air incubator). For phenotypic analysis, females were heat shocked once for 15 or 30 min and dissected 2 d later to get mosaic ovaries with wild-type and UAS transgeneexpressing cells; for Western blot analysis, females were heat shocked for 2 x 2 h for 2 d and then dissected to get ovaries, in which most follicle cells expressed UAS-Cad99C-RNAi. Oregon R was used as wild type.
Cad99C transgenes
Cad99C-FL, a 5.6-kb Cad99C cDNA that consists of a partial 5' UTR (125 bp) and full-length coding region (5,118 bp) and 3' UTR (391 bp), was generated from three overlapping cDNAs: EST LD23053 (Stapleton et al., 2002), MM1, and MM2. MM1 and MM2 were generated by RT-PCR via primers GGCTCCACTAGCGTAGGC and CCCTCGTCGTTGTCAGTG and CATCTTGGTGGTGAACGAGG and GCTATTGGCTTCCATTGACTC, respectively, and confirmed by sequencing. To generate Cad99C
cyt::GFP, a fragment of Cad99C-Fl lacking 1,166 bp at the 3' end was subcloned into pEGFP-N2 (CLONTECH Laboratories, Inc.) to express a fusion protein, in which GFP replaces the COOH-terminal region of Cad99C, deleting 256 of the 287 amino acids of the Cad99C cytoplasmic domain. A Cad99C-RNAi transgene was generated that allows induced expression of dsRNA for the purpose of RNAi (for review see Lee and Carthew, 2003). 1.1 kb of Cad99C coding sequence (3421,436 bp of EST LD23053) in reverse (3'5') orientation was attached to a 0.5-kb linker containing two Cad99C introns (amplified with primers CGTAGAGAAGTACAGTGCGG and GCAGCCGCTATAGATGAAC using genomic wild-type DNA as a template), which was followed by a 0.7-kb fragment of the 1.1-kb Cad99C coding sequence (7471,436 bp of EST LD23053) in forward (5'3') orientation. Constructs Cad99C-FL, Cad99C
cyt::GFP, and Cad99C-RNAi were subcloned into a transformation vector (pUAST; Brand and Perrimon, 1993) to generate transgenic flies following standard procedures.
Eggshell analysis
To determine oviposition rates, batches of 21 females (45 d old, well fed) were allowed to lay eggs on yeasted apple juice agar plates for periods of 17 h at 25°C. To test the resistance of eggs to water loss, eggs (02.5 h old) were collected and kept on apple juice agar plates at 24°C, and desiccated eggs were counted every 2 h. To test the tolerance of eggs to hypochlorite, batches of 50 eggs (noncollapsed, 04 h old) were incubated in 2.6% sodium hypochlorite in PBS. Permeability of eggshells to vital dyes was tested by incubating eggs (noncollapsed, 07 h old) in 1% trypan blue or neutral red in PBS for 1 h, after which they were mounted in PBS and viewed immediately. Histological preparations were done according to Tepass and Hartenstein (1994).
Cad99C antibodies and detection of proteins and RNA
To generate Cad99C antibodies, peptides corresponding to aa 10901303 (extracellular peptide) and 14981701 (cytoplasmic peptide) of Cad99C were expressed and extracted as GST-fusion proteins and used to immunize guinea pigs and rats, respectively. Specificity of antisera was confirmed by comparing wild-type and Cad99C mutant tissue samples in Western blot analysis and by immunostaining. For immunostaining, primary antibodies used were polyclonal guinea pig
-Cad99C (GP5 1:3,000), rabbit
-GFP (1:100; CLONTECH Laboratories, Inc.), rabbit
-DPatj (1:250; Tanentzapf et al., 2000), rabbit
-Nudel (NNDL, 1:400; LeMosy et al., 1998), rat
-Yolkless (No. 156, 1:150; Schönbaum et al., 2000), monoclonal rat
-DE-cadherin (DEcad2, 1:50; Oda et al., 1994), and mouse
-Arm (N2-71A1, 1:100; Peifer et al., 1993). Secondary antibodies (1:400) were conjugated to Cy3, Cy5 (Jackson ImmunoResearch Laboratories), or Alexa-488 (Invitrogen). F-actin was visualized with Phalloidin-Rhodamine (1:20; Invitrogen). For Western blot analysis, proteins from wild-type and Cad99C mutant adult ovaries were separated on a 6% SDS-PAGE gel, blotted onto a 0.1-µm nitrocellulose membrane (Schleicher & Schuell) using a methanol-free transfer, and detected with guinea pig
-Cad99C (GP5 1:10.000) or rat
-Cad99C (R7 1:1.000), and mouse
-Arm (N2-71A1, 1:500; Peifer et al., 1993) primary antibodies, HRP-conjugated secondary antibodies (1:1,000; Jackson ImmunoResearch Laboratories), and the ECL visualization system (GE Healthcare). Broad-range protein standards (prestained [GIBCO BRL] and unstained [Bio-Rad Laboratories]) were used to determine the molecular weight of proteins. For tissue in situ hybridizations, cDNA LD23053 (Stapleton et al., 2002) was used to generate a digoxigenin-labeled (Roche) DNA probe for Cad99C.
Imaging
Fluorescent images from preparations mounted in Vectashield (Vector Laboratories) were generated with a scanning laser confocal microscope (LSM510; Carl Zeiss MicroImaging, Inc.) using 40x/1.4 and 100x/1.4 Plan-Apo objectives. Confocal images displayed in Figs. 46 were taken at 6585% anteriorposterior egg chamber length. Histological images were generated with an Axioskop (100x/1.4 Plan-Apo objective; Carl Zeiss MicroImaging, Inc.), and images of eggs were generated with a Stemi SV11 (Carl Zeiss MicroImaging, Inc.), using a digital camera (AxioCam) and Axiovision 2.05 or 4.3 software (Carl Zeiss MicroImaging, Inc.). All imaging was done at RT. Figures were processed using Photoshop 7 and Illustrator 10 (Adobe Systems) and graphs were generated with Prism 4 (GraphPad Software).
Online supplemental material
Fig. S1 shows sequence alignment of the CDs of Cad99C and PCDH15 and consensus sites for binding of Ca2+. Fig. S2 shows that Cad99C is located on the apical surface of the wing disc epithelium and induces long apical protrusions when overexpressed. Online supplemental material is available at http://www.jcb.org/cgi/content/full/jcb.200507072/DC1.
| Acknowledgments |
|---|
This work was funded by grants MOP-42528 and MOP-74510 from the Canadian Institute of Health Research (to D. Godt).
Submitted: 15 July 2005
Accepted: 29 September 2005
| References |
|---|
|
|
|---|
Adato, A., V. Michel, Y. Kikkawa, J. Reiners, K.N. Alagramam, D. Weil, H. Yonekawa, U. Wolfrum, A. El-Amraoui, and C. Petit. 2005. Interactions in the network of Usher syndrome type 1 proteins. Hum. Mol. Genet. 14:347356.
Ahmed, Z.M., S. Riazuddin, J. Ahmad, S.L. Bernstein, Y. Guo, M.F. Sabar, P. Sieving, A.J. Griffith, T.B. Friedman, I.A. Belyantseva, and E.R. Wilcox. 2003a. PCDH15 is expressed in the neurosensory epithelium of the eye and ear and mutant alleles are responsible for both USH1F and DFNB23. Hum. Mol. Genet. 12:32153223.
Ahmed, Z.M., S. Riazuddin, and E.R. Wilcox. 2003b. The molecular genetics of Usher syndrome. Clin. Genet. 63:431444.[CrossRef][Medline]
Alagramam, K.N., J. Zahorsky-Reeves, C.G. Wright, K.S. Pawlowski, L.C. Erway, L. Stubbs, and R.P. Woychik. 2000. Neuroepithelial defects of the inner ear in a new allele of the mouse mutation Ames waltzer. Hear. Res. 148:181191.[CrossRef][Medline]
Alagramam, K.N., C.L. Murcia, H.Y. Kwon, K.S. Pawlowski, C.G. Wright, and R.P. Woychik. 2001. The mouse Ames waltzer hearing-loss mutant is caused by mutation of Pcdh15, a novel protocadherin gene. Nat. Genet. 27:99102.[Medline]
Bartles, J.R. 2000. Parallel actin bundles and their multiple actin-bundling proteins. Curr. Opin. Cell Biol. 12:7278.[CrossRef][Medline]
Belyantseva, I.A., E.T. Boger, and T.B. Friedman. 2003. Myosin XVa localizes to the tips of inner ear sensory cell stereocilia and is essential for staircase formation of the hair bundle. Proc. Natl. Acad. Sci. USA. 100:1395813963.
Belyantseva, I.A., E.T. Boger, S. Naz, G.I. Frolenkov, J.R. Sellers, Z.M. Ahmed, A.J. Griffith, and T.B. Friedman. 2005. Myosin-XVa is required for tip localization of whirlin and differential elongation of hair-cell stereocilia. Nat. Cell Biol. 7:148156.[CrossRef][Medline]
Boëda, B., A. El-Amraoui, A. Bahloul, R. Goodyear, L. Daviet, S. Blanchard, I. Perfettini, K.R. Fath, S. Shorte, J. Reiners, et al. 2002. Myosin VIIa, harmonin and cadherin 23, three Usher I gene products that cooperate to shape the sensory hair cell bundle. EMBO J. 21:66896699.[CrossRef][Medline]
Borisy, G.G., and T.M. Svitkina. 2000. Actin machinery: pushing the envelope. Curr. Opin. Cell Biol. 12:104112.[CrossRef][Medline]
Brand, A.H., and N. Perrimon. 1993. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118:401415.[Abstract]
Celniker, S.E., D.A. Wheeler, B. Kronmiller, J.W. Carlson, A. Halpern, S. Patel, M. Adams, M. Champe, S.P. Dugan, E. Frise, et al. 2002. Finishing a whole-genome shotgun: release 3 of the Drosophila melanogaster euchromatic genome sequence. Genome Biol. 3:Research0079.10079.14.
Croce, A., G. Cassata, A. Disanza, M.C. Gagliani, C. Tacchetti, M.G. Malabarba, M.F. Carlier, G. Scita, R. Baumeister, and P.P. Di Fiore. 2004. A novel actin barbed-end-capping activity in EPS-8 regulates apical morphogenesis in intestinal cells of Caenorhabditis elegans. Nat. Cell Biol. 6:11731179.[CrossRef][Medline]
DeRosier, D.J., and L.G. Tilney. 2000. F-actin bundles are derivatives of microvilli: what does this tell us about how bundles might form? J. Cell Biol. 148:16.[CrossRef]
Frolenkov, G.I., I.A. Belyantseva, T.B. Friedman, and A.J. Griffith. 2004. Genetic insights into the morphogenesis of inner ear hair cells. Nat. Rev. Genet. 5:489498.[CrossRef][Medline]
Gautreau, A., D. Louvard, and M. Arpin. 2000. Morphogenic effects of ezrin require a phosphorylation-induced transition from oligomers to monomers at the plasma membrane. J. Cell Biol. 150:193203.
Golic, K.G. 1991. Site-specific recombination between homologous chromosomes in Drosophila. Science. 252:958961.
Grevengoed, E.E., D.T. Fox, J. Gates, and M. Peifer. 2003. Balancing different types of actin polymerization at distinct sites: roles for Abelson kinase and Enabled. J. Cell Biol. 163:12671279.
Hill, E., I.D. Broadbent, C. Chothia, and J. Pettitt. 2001. Cadherin superfamily proteins in Caenorhabditis elegans and Drosophila melanogaster. J. Mol. Biol. 305:10111024.[CrossRef][Medline]
Horne-Badovinac, S., and D. Bilder. 2005. Mass transit: epithelial morphogenesis in the Drosophila egg chamber. Dev. Dyn. 232:559574.[CrossRef][Medline]
Karagiosis, S.A., and D.F. Ready. 2004. Moesin contributes an essential structural role in Drosophila photoreceptor morphogenesis. Development. 131:725732.
Koch, A.W., K.L. Manzur, and W. Shan. 2004. Structure-based models of cadherin-mediated cell adhesion: the evolution continues. Cell. Mol. Life Sci. 61:18841895.[Medline]
Lee, T., and L. Luo. 1999. Mosaic analysis with a repressible cell marker for studies of gene function in neuronal morphogenesis. Neuron. 22:451461.[CrossRef][Medline]
Lee, Y.S., and R.W. Carthew. 2003. Making a better RNAi vector for Drosophila: use of intron spacers. Methods. 30:322329.[CrossRef][Medline]
LeMosy, E.K., and C. Hashimoto. 2000. The nudel protease of Drosophila is required for eggshell biogenesis in addition to embryonic patterning. Dev. Biol. 217:352361.[CrossRef][Medline]
LeMosy, E.K., D. Kemler, and C. Hashimoto. 1998. Role of Nudel protease activation in triggering dorsoventral polarization of the Drosophila embryo. Development. 125:40454053.[Abstract]
Limbourg, B., and M. Zalokar. 1973. Permeabilization of Drosophila eggs. Dev. Biol. 35:382387.[CrossRef][Medline]
Lin, H.W., M.E. Schneider, and B. Kachar. 2005. When size matters: the dynamic regulation of stereocilia lengths. Curr. Opin. Cell Biol. 17:5561.[CrossRef][Medline]
Loomis, P.A., L. Zheng, G. Sekerkova, B. Changyaleket, E. Mugnaini, and J.R. Bartles. 2003. Espin cross-links cause the elongation of microvillus-type parallel actin bundles in vivo. J. Cell Biol. 163:10451055.
Mahowald, A.P. 1972. Ultrastructural observations on oogenesis in Drosophila. J. Morphol. 137:2948.[CrossRef][Medline]
Mahowald, A.P., and M.P. Kambysellis. 1980. Oogenesis. The Genetics and Biology of Drosophila. Vol. 2. M. Ashburner and T.R.F. Wright, editors. Academic Press, New York. 141224.
Mburu, P., M. Mustapha, A. Varela, D. Weil, A. El-Amraoui, R.H. Holme, A. Rump, R.E. Hardisty, S. Blanchard, R.S. Coimbra, et al. 2003. Defects in whirlin, a PDZ domain molecule involved in stereocilia elongation, cause deafness in the whirler mouse and families with DFNB31. Nat. Genet. 34:421428.[CrossRef][Medline]
Michel, V., R.J. Goodyear, D. Weil, W. Marcotti, I. Perfettini, U. Wolfrum, C.J. Kros, G.P. Richardson, and C. Petit. 2005. Cadherin 23 is a component of the transient lateral links in the developing hair bundles of cochlear sensory cells. Dev. Biol. 280:281294.[CrossRef][Medline]
Müller, U., and A. Littlewood-Evans. 2001. Mechanisms that regulate mechanosensory hair cell differentiation. Trends Cell Biol. 11:334342.[CrossRef][Medline]
Murcia, C.L., and R.P. Woychik. 2001. Expression of Pcdh15 in the inner ear, nervous system and various epithelia of the developing embryo. Mech. Dev. 105:163166.[CrossRef][Medline]
Oda, H., T. Uemura, Y. Harada, Y. Iwai, and M. Takeichi. 1994. A Drosophila homolog of cadherin associated with armadillo and essential for embryonic cell-cell adhesion. Dev. Biol. 165:716726.[CrossRef][Medline]
Patel, S.D., C.P. Chen, F. Bahna, B. Honig, and L. Shapiro. 2003. Cadherin-mediated cell-cell adhesion: sticking together as a family. Curr. Opin. Struct. Biol. 13:690698.[CrossRef][Medline]
Peifer, M., S. Orsulic, D. Sweeton, and E. Wieschaus. 1993. A role for the Drosophila segment polarity gene armadillo in cell adhesion and cytoskeletal integrity during oogenesis. Development. 118:11911207.[Abstract]
Petit, C. 2001. Usher syndrome: from genetics to pathogenesis. Annu. Rev. Genomics Hum. Genet. 2:271297.[CrossRef][Medline]
Pignoni, F., B. Hu, K.H. Zavitz, J. Xiao, P.A. Garrity, and S.L. Zipursky. 1997. The eye-specification proteins So and Eya form a complex and regulate multiple steps in Drosophila eye development. Cell. 91:881891.[CrossRef][Medline]
Raphael, Y., K.N. Kobayashi, G.A. Dootz, L.A. Beyer, D.F. Dolan, and M. Burmeister. 2001. Severe vestibular and auditory impairment in three alleles of Ames waltzer (av) mice. Hear. Res. 151:237249.[CrossRef][Medline]
Reiners, J., B. Reidel, A. El-Amraoui, B. Boeda, I. Huber, J. Reiners, T. Marker, K. Jurgens, B. Reidel, and U. Wolfrum. 2005. Photoreceptor expression of the Usher syndrome type 1 protein protocadherin 15 (USH1F) and its interaction with the scaffold protein harmonin (USH1C). Mol. Vis. 11:347355.[Medline]
Rzadzinska, A.K., M.E. Schneider, C. Davies, G.P. Riordan, and B. Kachar. 2004. An actin molecular treadmill and myosins maintain stereocilia functional architecture and self-renewal. J. Cell Biol. 164:887897.
Saotome, I., M. Curto, and A.I. McClatchey. 2004. Ezrin is essential for epithelial organization and villus morphogenesis in the developing intestine. Dev. Cell. 6:855864.[CrossRef][Medline]
Schlichting, K., F. Demontis, and C. Dahmann. 2005. Cadherin Cad99C is regulated by Hedgehog signaling in Drosophila. Dev. Biol. 279:142154.[CrossRef][Medline]
Schönbaum, C.P., J.J. Perrino, and A.P. Mahowald. 2000. Regulation of the vitellogenin receptor during Drosophila melanogaster oogenesis. Mol. Biol. Cell. 11:511521.
Seiler, C., K.C. Finger-Baier, O. Rinner, Y.V. Makhankov, H. Schwarz, S.C. Neuhauss, and T. Nicolson. 2005. Duplicated genes with split functions: independent roles of protocadherin15 orthologues in zebrafish hearing and vision. Development. 132:615623.
Sekerkova, G., L. Zheng, P.A. Loomis, B. Changyaleket, D.S. Whitlon, E. Mugnaini, and J.R. Bartles. 2004. Espins are multifunctional actin cytoskeletal regulatory proteins in the microvilli of chemosensory and mechanosensory cells. J. Neurosci. 24:54455456.
Sheng, M., and C. Sala. 2001. PDZ domains and the organization of supramolecular complexes. Annu. Rev. Neurosci. 24:129.[CrossRef][Medline]
Siemens, J., P. Kazmierczak, A. Reynolds, M. Sticker, A. Littlewood-Evans, and U. Muller. 2002. The Usher syndrome proteins cadherin 23 and harmonin form a complex by means of PDZ-domain interactions. Proc. Natl. Acad. Sci. USA. 99:1494614951.
Siemens, J., C. Lillo, R.A. Dumont, A. Reynolds, D.S. Williams, P.G. Gillespie, and U. Müller. 2004. Cadherin 23 is a component of the tip link in hair-cell stereocilia. Nature. 428:950955.[CrossRef][Medline]
Söllner, C., G.J. Rauch, J. Siemens, R. Geisler, S.C. Schuster, U. Muller, and T. Nicolson. 2004. Mutations in cadherin 23 affect tip links in zebrafish sensory hair cells. Nature. 428:955959.[CrossRef][Medline]
Spradling, A.C. 1993. Developmental genetics of oogenesis. The Development of Drosophila melanogaster. M. Bate and A. Martinez-Arias, editors. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 170.
Stapleton, M., G. Liao, P. Brokstein, L. Hong, P. Carninci, T. Shiraki, Y. Hayashizaki, M. Champe, J. Pacleb, K. Wan, et al. 2002. The Drosophila gene collection: identification of putative full-length cDNAs for 70% of D. melanogaster genes. Genome Res. 12:12941300.
Tanentzapf, G., C. Smith, J. McGlade, and U. Tepass. 2000. Apical, lateral, and basal polarization cues contribute to the development of the follicular epithelium during Drosophila oogenesis. J. Cell Biol. 151:891904.
Tepass, U., and V. Hartenstein. 1994. The development of cellular junctions in the Drosophila embryo. Dev. Biol. 161:563596.[CrossRef][Medline]
Tepass, U., K. Truong, D. Godt, M. Ikura, and M. Peifer. 2000. Cadherins in embryonic and neural morphogenesis. Nat. Rev. Mol. Cell Biol. 1:91100.[CrossRef][Medline]
Weil, D., A. El-Amraoui, S. Masmoudi, M. Mustapha, Y. Kikkawa, S. Laine, S. Delmaghani, A. Adato, S. Nadifi, Z.B. Zina, et al. 2003. Usher syndrome type I G (USH1G) is caused by mutations in the gene encoding SANS, a protein that associates with the USH1C protein, harmonin. Hum. Mol. Genet. 12:463471.
Wodarz, A., U. Hinz, M. Engelbert, and E. Knust. 1995. Expression of crumbs confers apical character on plasma membrane domains of ectodermal epithelia of Drosophila. Cell. 82:6776.[CrossRef][Medline]
Zheng, L., G. Sekerkova, K. Vranich, L.G. Tilney, E. Mugnaini, and J.R. Bartles. 2000. The deaf jerker mouse has a mutation in the gene encoding the espin actin-bundling proteins of hair cell stereocilia and lacks espins. Cell. 102:377385.[CrossRef][Medline]
Related Article
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|