|
||
Article |
Pax3 and Pax7 have distinct and overlapping functions in adult muscle progenitor cells
Correspondence to Margaret Buckingham: margab{at}pasteur.fr
|
|
|---|
The growth and repair of skeletal muscle after birth depends on satellite cells that are characterized by the expression of Pax7. We show that Pax3, the paralogue of Pax7, is also present in both quiescent and activated satellite cells in many skeletal muscles. Dominant-negative forms of both Pax3 and -7 repress MyoD, but do not interfere with the expression of the other myogenic determination factor, Myf5, which, together with Pax3/7, regulates the myogenic differentiation of these cells. In Pax7 mutants, satellite cells are progressively lost in both Pax3-expressing and -nonexpressing muscles. We show that this is caused by satellite cell death, with effects on the cell cycle. Manipulation of the dominant-negative forms of these factors in satellite cell cultures demonstrates that Pax3 cannot replace the antiapoptotic function of Pax7. These findings underline the importance of cell survival in controlling the stem cell populations of adult tissues and demonstrate a role for upstream factors in this context.
Abbreviations used in this paper: ß-galactosidase, ß-gal; PI, propidium iodide.
| Introduction |
|---|
|
|
|---|
Satellite cells, the myogenic progenitor cells of postnatal muscle, lie under the basal lamina of muscle fibers in a quiescent state until they become activated, proliferate, and form new skeletal muscle, which occurs during postnatal growth and in response to damage (Bischoff and Heintz, 1994). Myogenic regulatory genes are expressed during this process; Myf5 is already expressed in quiescent satellite cells (Beauchamp et al., 2000), and MyoD is expressed as the cells become activated and subsequently differentiate with the expression of myogenin (Yablonka-Reuveni and Rivera, 1994). Myf5:MyoD double mutants have not yet been examined in this adult context because of the perinatal lethality of the original Myf5 mutant. However, in the absence of MyoD, muscle regeneration is less efficient and the balance between proliferation and differentiation of myosatellite cells appears to be affected (Megeney et al., 1996). The most striking result, however, came from the examination of Pax7 mutant mice (Seale et al., 2000). Pax7 is present in satellite cells, and in its absence muscle regeneration is severely affected. Satellite cells were not observed in the mutant, leading to the proposal that Pax7 is essential for the specification of adult muscle progenitor cells (Seale et al., 2000). However, it has recently been shown that satellite cells are present in the Pax7 mutant, although in decreasing numbers as the mice mature, and it has been suggested that their proliferation is compromised in the absence of Pax7 (Oustanina et al., 2004). Pax7 is present in quiescent satellite cells and during their activation, but is down-regulated when they differentiate. A proportion of activated satellite cells remain undifferentiated, retain Pax7 expression, and are thought to reconstitute the satellite cell pool (Olguin and Olwin, 2004; Zammit et al., 2004). Therefore, Pax7 appears to play a predominant role in adult muscle progenitor cells. The presence of Pax3, however, has been noted after satellite cell activation, leading to the proposal that it is implicated in their proliferation (Conboy and Rando, 2002). It was also noted that the expression of a Pax3nLacZ allele can be detected in quiescent satellite cells (Buckingham et al., 2003).
We now investigate the role of Pax7 in relation to Pax3, which we show is expressed in the quiescent satellite cells of a major subset of skeletal muscles. We show that both Pax3 and -7 control MyoD activation, and therefore regulate myogenesis in the adult. However, we demonstrate that in the absence of Pax7 satellite cells are progressively lost postnatally because of apoptosis accompanied by cell cycle defects. Pax7 has a critical antiapoptotic function in activated satellite cells for which Pax3 does not compensate. These results underline the critical role of upstream regulators of tissue formation and regeneration in assuring progenitor cell survival.
| Results |
|---|
|
|
|---|
50% of forelimb muscles express Pax3. As in the embryo (Relaix et al., 2004), expression of Pax3 is not detectable in head muscles. Most ventral trunk muscles are positive, with a striking juxtaposition in the rib area, where intercostal muscles are mainly negative, whereas body wall muscles such as the serratus caudalis dorsalis are positive (Fig. 1 C). This difference is confirmed by semiquantitative RT-PCR analysis of Pax3 versus -7 transcripts in the tibialis anterior hindlimb muscle compared with the diaphragm (Fig. 1 D). The Pax3 protein is also present, as shown by Western blot analysis of different muscles (Fig. 1 D'). The Pax3nlacZ/+-expressing cells are found to be associated with muscle fibers (Fig. 1, E and F). The Pax3/7 protein is transcriptionally active in adult muscle, as indicated by activation of the P34 reporter transgene in which Pax3/7 binding sites regulate nLacZ expression (Fig.1, G and G'; Relaix et al., 2004). These Pax3-expressing nuclei are present in satellite cells, as shown by coimmunolocalization of ß-gal with the satellite cell markers CD34 and M-cadherin and by the inclusion of ß-galpositive cells within the basal lamina of the muscle fiber (Fig. 1, HK'). Because Pax7 is present in satellite cells (Seale et al., 2000), the question of Pax3 expression in relation to Pax7 was addressed. In the diaphragm, the majority of Pax7-positive satellite cells also coexpress Pax3. About 15% of the cells only label with Pax7, and, occasionally, cells that express only Pax3 are also detected (<3%; Fig. 1, LN'). We therefore conclude that Pax3, like Pax7, is expressed in quiescent satellite cells and that the frequency of this event varies between muscles. There is no direct relation to fiber type (Kelly and Rubenstein, 1994) because the diaphragm muscle (type IIX, IIA, and I fibers) is positive, whereas in the hindlimb the soleus (type I and IIA) is negative. Similarly, in the hindlimb the gastrocnemius (mostly type IIB) is negative, whereas other fast muscles (type IIA and IIB) in the trunk and forelimb have Pax3-expressing satellite cells.
|
20%) express both Pax genes (Fig. 2, PR). The distribution of these two types of colonies from different muscle sources is quantified in Fig. 2 S. To confirm that Pax3 is not activated in satellite cells that only express Pax7, we isolated these cells using flow cytometry. Based on the isolation of GFP-positive satellite cells from the diaphragm muscle, we had previously established the gating window that contains these cells (Montarras et al., 2005), which is shown as a boxed area (R2) in Fig. 2 (T and U). When satellite cells isolated on this basis from the diaphragm muscle are cultured and reanalyzed by flow cytometry, they remain Pax3 (GFP)-positive (Fig. 2 T). However, when Pax3-negative satellite cells are sorted from the muscle of the lower hindlimb and cultured, no GFP-positive cells were found in the R2 window after re-sorting by flow cytometry (Fig. 2 U). These results demonstrate that activated satellite cells from Pax3-negative muscles, do not activate this Pax gene in cell culture.
|
|
15% of wild type). Similarly, single fiber experiments with the extensor digitorum longus hindlimb muscle (Fig. S1, available at http://www.jcb.org/cgi/content/full/jcb.200508044/DC1) show that satellite cells are still present in the mutant, but that their number is reduced to
10% of normal levels at P10. The number of myonuclei is also reduced by
50% at this stage (Fig. S1 F) and muscle fibers are smaller (not depicted), consistent with the reduced size of mutant mice (Mansouri et al., 1996; Seale et al., 2000). The number of ß-galpositive satellite cells were counted on sections of Pax7LacZ/LacZ muscles and compared with heterozygotes at P2 and P11 (Fig. 4 E). At P2 there is only a small reduction (
18%) in the numbers of satellite cells in trunk, diaphragm, or hindlimb muscles. By P11, this reduction is striking (
83%) and is similar for all three muscle sources, whether Pax3 is expressed in most satellite cells (e.g., diaphragm) or not (hindlimb). This demonstrates that Pax3 cannot compensate for Pax7 function during the postnatal development of skeletal muscle. This is not because of a failure in myogenesis in the mutant satellite cells. MyoD is still expressed and, as in wild-type cultures (Fig. 3), its expression is inhibited by a dominant-negative form of Pax3 (Fig. 4, F and G).
|
|
Apoptosis of satellite cells in the absence of Pax7
To investigate the survival of satellite cells in postnatal muscle in vivo, in the absence of Pax7, we used an antibody to the activated form of caspase-3 to label cells undergoing apoptosis (Patel et al., 1996). Coimmunohistochemistry was performed with an antibody to desmin, which marks activated satellite cells as they assume a myoblast phenotype (Creuzet et al., 1998), as well as muscle fibers. In the postnatal trunk muscle of Pax7 mutant mice, activated caspase-3labeled cells are observed, whereas in control mice labeled cells are not detected (Fig. 6, AD). These results are quantitated in Fig. 6 E. The decrease observed from P0 to P6 reflects the decreasing numbers of satellite cells in the mutant. These cells also express desmin, suggesting that they correspond to activated satellite cells, probably contributing to the postnatal growth of muscle (Fig. 6, A and B, arrowheads). The identification of these cells was confirmed by labeling with a laminin (Fig. 6 C) or ß-gal antibody (Fig. 6 D). The latter detects Pax7 transcription, which marks satellite cells. During postnatal development, apoptotic cells were detected in all trunk and limb muscles examined in the Pax7 mutant, whereas they were very rare in the muscles of normal mice (Fig. 6 E). Therefore, we conclude that Pax7 has an antiapoptotic function and that in its absence satellite cells die, despite the presence of Pax3.
|
|
| Discussion |
|---|
|
|
|---|
Muscle progenitor cell specification and Pax3 expression in a subset of skeletal muscles
At birth the great majority of satellite cells are still present in the trunk and limb muscles of Pax7 mutant mice (Oustanina et al., 2004), showing that Pax7 is not required for satellite cell specification as previously suggested (Seale et al., 2000). During prenatal development, a Pax3/7 population of myogenic progenitor cells is present and these somite-derived cells take up a satellite cell position in late fetal muscle (Gros et al., 2005). It is only when both Pax3 and -7 are absent that these cells die or fail to enter the myogenic program, with a major deficit in skeletal muscle in the double mutant (Relaix et al., 2005). We would therefore propose that satellite cell progenitors are specified prenatally by the action of Pax3 in the Pax7 mutant.
It is not clear why Pax3 should be present in the quiescent, as well as in the activated satellite cells of some muscles and not others. Most hindlimb muscles, usually used as a source of satellite cells (Seale et al., 2000; Conboy and Rando, 2002), and some forelimb and trunk muscles are negative for Pax3. Even within a muscle that is positive, like the diaphragm, some satellite cells express only Pax7. These differences do not correlate with fiber type and, thus, they do not correlate with the type of innervation. A correlation with the embryological origin of the muscle is also not evident (Tajbakhsh and Buckingham, 2000).
Heterogeneity between muscles is a well known feature of myopathies in which the mutation of a gene expressed in all muscles may have a pathological effect on particular muscle groups (Hadchouel et al., 2003). It is also evident from the study of regulatory genes in the embryo that different sites of myogenesis are coordinated by different regulatory strategies. This is illustrated by the number of distinct sequences that control the spatiotemporal activation of the Myf5 gene (Buchberger et al., 2003; Hadchouel et al., 2003) or by the effects of mutations in genes encoding homeobox proteins, such as Lbx1 (Schafer and Braun, 1999; Brohmann et al., 2000; Gross et al., 2000) or Meox2 (Mankoo et al., 1999), which lead to the loss of certain limb muscles and not others. Understanding the basis of such myogenic heterogeneity represents a challenge for the muscle field, which has tended not to think in these terms because of the apparently generalized effects of the MyoD family of myogenic regulatory factors in the embryo.
The role of Pax3 and -7 in myogenesis
Myogenesis in the embryo is initially orchestrated by the myogenic regulatory factors Myf5 and Mrf4 that, together with Pax3, lead to the subsequent activation of MyoD. Mrf4 is not detectable in adult satellite cells (unpublished data), although it is expressed when they differentiate (Cooper et al., 1999), and this gene does not play a role as a determination factor during late embryonic and fetal development (Kassar-Duchossoy et al., 2004, 2005). However, we show that the genetic hierarchy that controls the onset of myogenesis in the embryo is conserved in the adult and that Pax3/7 and Myf5 control the entry of cells into the myogenic program, acting in parallel genetic pathways. In the absence of all three factors, skeletal muscle differentiation does not occur, whereas in satellite cells from the Myf5 mutant or from Pax3-negative hindlimb muscles of the Pax7 mutant, myogenin is activated and the cells differentiate. In keeping with previous observations on MyoD mutant embryos (Rudnicki et al., 1992), Myf5 can activate myogenin directly, whereas activation of myogenesis by Pax3/7 depends on MyoD, as shown in the experiments reported here (Tajbakhsh et al., 1997). Expression of Myf5 in satellite cells, which we show is not affected by dominant-negative forms of Pax3 or -7, suggests that these cells have progressed beyond the progenitor cell state, characterized by the presence of Pax3/7 and the absence of any myogenic regulatory factor (Gros et al., 2005; Kassar-Duchossoy et al., 2005; Relaix et al., 2005). In prenatal progenitor cells, expression of both Myf5 and MyoD depends on the presence of Pax3/7 factors (Relaix et al., 2005).
Dominant-negative forms of Pax3 or -7 down-regulate MyoD expression in the presence of Myf5. Presumably, the engrailed repression domain present in these constructs overrides transcriptional activation by Myf5. The direct repression exerted by these constructs was demonstrated by their effect on the P34 reporter transgene, which is dependent on Pax3/7 binding sites. In these experiments, and in situations where Pax3DN or -7DN are expressed at a lower level, as indicated by the GFP reporter, with only partial repression of MyoD, we have never detected any difference between the two Pax dominant-negative forms. Furthermore, satellite cells isolated from hindlimb muscles expressing only Pax7 down-regulate MyoD in the presence of Pax3DN. We therefore conclude that Pax3 and -7 play a similar role in the activation of MyoD and subsequent skeletal muscle differentiation. In experiments with adenoviral vectors in which Pax3 or -7 were overexpressed in satellite cells, we saw no down-regulation of MyoD. This is in contrast to the results of the study conducted by Olguin and Olwin (2004), although in the C2 myogenic cell line, we did see some effect on MyoD (unpublished data). This may be a question of the cell system and the extent of overexpression, but we conclude that Pax3 and -7 normally act as activators of the myogenic program. The overexpression of MyoD that we observe in embryos that express the constitutively active PAX3-FKHR protein is consistent with this role. We show that Pax3, like Pax7 (Olguin and Olwin, 2004; Zammit et al., 2004), is rapidly down-regulated as satellite cells begin to differentiate. We observed the presence of Pax3/7-positive, MyoD-negative cells in older cultures in which differentiated myotubes were present. These cells probably correspond to reserve cells that will reconstitute the satellite cell pool, taking up a satellite cell position on newly formed fibers (Zammit et al., 2004).
Satellite cell proliferation
In satellite cultures from hindlimb muscles, we frequently saw colonies that expressed only Pax7, with no detectable expression of the Pax3 reporter. In contrast, Pax7-positive satellite cells from the tibialis anterior muscle, also used in our experiments, have been reported to systematically activate Pax3 in culture and it has been proposed that Pax3 is necessary for their proliferation (Conboy and Rando, 2002). This discrepancy may reflect problems with the Pax3 antibody used, which, in our experience, works poorly on cultured cells and may show cross-reactivity with Pax7. This is why we rely on different Pax3 reporter lines, which consistently give reproducible results (Relaix et al., 2003, 2004, 2005). When we isolate satellite cells from Pax3GFP/+ mice by flow cytometry after injury of the tibialis anterior, these cells remain Pax3 (GFP)-negative (Montarras et al., 2005), consistent with our ex vivo observations. Grafting experiments (Montarras et al., 2005), in addition to cell culture observations, show that satellite cells retain their Pax3-positive or -negative status independent of their environment.
In the Pax7 mutant, satellite cells are present and can differentiate into skeletal muscle (Oustanina et al., 2004), but, as we show, there is a progressive loss of these cells during postnatal development. Their loss is equally evident in muscles where Pax3 is also expressed in satellite cells. This indicates that there must be a function of Pax7 for which Pax3 cannot compensate. It had been suggested that there may be a proliferative defect in satellite cells in the absence of Pax7 (Oustanina et al., 2004). We examined the proliferation of satellite cell cultures from Pax7 mutant mice and observed a 2530% reduction compared with wild type. This was seen with Pax3-positive myogenic colonies from the diaphragm, as well as from Pax3-negative hindlimb muscles. All of the cells were still cycling, but the cell cycle was perturbed, with relatively more cells in S and G2 phases. We suggest that this effect may be attributable to the loss of cells in G1 caused by apoptosis (Abrams and White, 2004).
Pax7 and satellite cell survival
We show that apoptosis, marked by activated caspase-3, occurs in the skeletal muscle of the Pax7 mutant. This is detectable immediately after birth and appears to occur in activated satellite cells, marked by desmin expression that would normally contribute to muscle growth. This suggests that self-renewal of satellite cells takes place via an activated cell state, as previously proposed (Zammit et al., 2004). We do not detect cell death in cultured satellite cells from Pax7 mutant mice. This may be because the presence of serum in the medium provides some protection or because dying cells detach rapidly precluding detection with markers of apoptosis. Muscles, such as the diaphragm, in which Pax3 is expressed, have more satellite cells, giving rise to myogenic colonies when satellite cell loss in vivo is still relatively minor (1520%). However, by 15 d after birth only 5% of satellite cells remain in Pax3-expressing as well as Pax3-negative muscles. The difference between Pax3 and -7 is demonstrated by the flow cytometry experiments on satellite cells expressing dominant-negative constructs. Pax3DN at high levels does have some effect on the viability of the satellite cells in which it is expressed, but Pax7DN is much more potent, suggesting that the antiapoptotic targets of these two Pax factors are different in postnatal muscle. In the embryo, muscle progenitor cells in the somite are lost in the absence of Pax3, which is necessary for the survival of the hypaxial dermomyotome. Pax7 is not normally expressed in these cells, but can rescue this function (Relaix et al., 2004). The expression of a single Pax3/7 gene in the muscle progenitor cells present in the somites of the cephalochordate Amphioxus (Holland et al., 1999) also suggests that Pax3 and -7 have similar functions in this embryonic context and that the distinct antiapoptotic activity of Pax7 evolved during vertebrate radiation, perhaps in response to the requirements of postnatal muscle growth and regeneration.
Members of the Pax gene family, which play key roles in the formation of other tissues (Tremblay and Gruss, 1994; Chi and Epstein, 2002), have been implicated in several functions discussed here for Pax3 and -7 in the skeletal muscle context. In addition to affecting cell fate choices, roles in proliferation and cell survival have been described. Notably, in the latter context, cells that do not express Pax2 in the developing inner ear undergo apoptosis (Li et al., 2004) and apoptosis is seen in mesodermal cells, which would normally form the pronephros during kidney development, in the absence of Pax2 and -8, which are required for the emergence of the nephric cell lineage (Bouchard et al., 2002). Furthermore, Pax2 has been shown to prevent apoptosis in renal cell cultures (Torban et al., 2000; Cai et al., 2005) related to its function during later nephrogenesis (Porteous et al., 2000). In a screen of human cancer cell lines from a range of tissues, PAX gene expression was frequently observed, and repression of its expression led to apoptosis (Muratovska et al., 2003). The antiapoptotic function of Pax7, which we describe here in postnatal skeletal muscle, is therefore not unique to this Pax subgroup. A role for Pax proteins in assuring the survival of the progenitor cells in which they regulate cell fate determinants may be widespread. The fine-tuning of such an antiapoptotic function in progenitor cells in the adult may also be critical in regulating the maintenance of stem cell populations during tissue growth and regeneration.
| Materials and methods |
|---|
|
|
|---|
Cell culture
Cells were prepared from muscle tissue of mice at different time points after birth by enzymatic dissociation, as previously described (Pinset and Montarras, 1998; Montarras et al., 2000). Cells were plated on gelatin-coated dishes in a 1:1 mixture (vol/vol) of Ham's F12 and DME (GIBCO BRL) containing 20% (vol/vol) fetal calf serum (AbCys) and 2% (vol/vol) ultroser (Biosepra). This medium, which supports both the proliferation and differentiation of muscle cells (Montarras et al., 2000), was used in all experiments. To allow the formation of colonies of muscle cells, primary cultures were plated at a density of 100 and 200 cells/cm2. When plated under these conditions cultures were highly enriched in myogenic colonies. The number of mononucleated cells to be plated was determined by counting after labeling an aliquot with 5 µg/ml of the DNA dye bis-benzimide (Hoeschst).
Single fiber preparation and culture were performed according to Beauchamp et al. (2000).
Immunocytochemical analysis
Cells were treated as previously described (Montarras et al., 2000). In brief, after fixation with 4% (wt/vol) paraformaldehyde and permeabilization with 0.2% (wt/vol) Triton X-100, cells were incubated with antibodies diluted in PBS containing 0.2% (wt/vol) gelatin. All incubations were at room temperature. For immunofluorescence, cells were mounted in mowiol (Calbiochem) after the staining of DNA with 5 µg/ml bis-benzimide in the penultimate PBS wash.
Antibodies used were as follows: Myf5, rabbit polyclonal (Lindon et al., 2000), at a 1:1,000 dilution; MyoD, either a rabbit polyclonal (Santa Cruz Biotechnology, Inc.), at a 1:200 dilution, or a mouse monoclonal (clone 5.8A; DAKO), at a 1:200 dilution; troponin T, mouse monoclonal (clone JLT12, Sigma-Aldrich), at a 1:200 dilution; desmin, mouse monoclonal (clone D33; DakoCytomation), at a 1:200 dilution; laminin, rabbit polyclonal (Sigma-Aldrich), at a 1:200 dilution; M-cadherin, mouse monoclonal (clone 12G4; Nanotools GmBh), at a 1:200 dilution; antiactive caspase-3, rabbit polyclonal (BD Biosciences), at a 1:250 dilution; cyclin A, a rabbit polyclonal (gift from A. Fernandez and N. Lamb, Institut de Génétique Humaine, Montpellier, France), at a 1:200 dilution; Ki67, a mouse monoclonal (BD Biosciences), at a 1:100 dilution; Pax7, mouse monoclonal (Developmental Studies Hybridoma Bank), at a 1:100 dilution; Pax3, mouse monoclonal (provided by M. Bronner-Fraser, California Institute of Technology, Pasadena, CA), at a 1:100 dilution; ß-gal, either rabbit polyclonal (Invitrogen), at a 1:4,000 dilution in cell culture experiments, or another rabbit polyclonal used on sections (provided by J.-F. Nicolas, Institut Pasteur, Paris, France), at a 1:500 dilution, or mouse monoclonal (clone Gal13; DakoCytomation), at a 1:100 dilution. Secondary antibodies were coupled to a fluorochrome, either Alexa 488 or 594 (Invitrogen), at a 1:250 dilution.
For X-Gal (Roche) staining, single fibers were fixed for 30 min with 4% paraformaldehyde in PBS, on ice. Fibers were rinsed twice with PBS, and then stained with X-Gal, using 0.4 mg/ml X-Gal in 2 mM MgCl2, 0.02% NP-40, 0.1 M PBS, pH 7.5, 20 mM K4Fe(CN)6, and 20 mM K3Fe(CN)6 for 416 h at 37°C, with shaking. Fibers were rinsed in PBS, postfixed overnight in 4% paraformaldehyde, and mounted after washing in PBS-buffered mowiol with DAPI. Similar conditions were used for X-Gal staining of sections. X-Gal staining of cells was performed after a 5-min fixation in 4% paraformaldehyde in the same solution used for fibers, but without NP-40.
Images of cultured cells and sections were acquired using an Axiophot or an Apotome equipped with an Axiocam camera and Axiovision software (Carl Zeiss MicroImaging, Inc.). Neofluar lenses, 40x, NA 0.75, and 20x, NA 0.50, were used. Images were optimized globally for contrast and brightness and assembled using Photoshop CS software (Adobe).
Analysis of extracts by semiquantitative RT-PCR
RNA extracts were prepared from tibialis anterior and diaphragm muscles of 8-wk-old mice, using TRIzol (Invitrogen). Reverse transcripts were generated using Power Script reverse transcriptase (BD Biosciences). The primers for Pax3 were DPax3-740 (TGCCCTCAGTGAGTTCTATCAGC) and RPax3-1100 (GCTAAACCAGACCTGCACTCGGGC), which generate a 360-bp PCR fragment. The primers for Pax7 were Dpax7-140 (TGGAAGTGTCCACCCCTCTTGGC) and RPax7-650 (ATCCAGACGGTTCCCTTTGTCGCC), which generate a 510-bp PCR fragment. Three other primer pairs were used and gave similar results. PCR products were separated on 1.5% agarose gels, using standard techniques, and revealed by UV light (Image Master CVS; GE Healthcare).
Analysis of extracts by Western blotting
Protein extracts were prepared and analyzed by Western blotting, as previously described (Lindon et al., 2000). The antitubulin antibody (clone 5HI; BD Biosciences) was used at a 1:2,000 dilution and the Pax3 antibody at a 1:400 dilution.
Preparation of adenoviral vectors and cell infection
Adenoviral vectors were generated using standard molecular biology techniques. In brief, dominant-negative Pax3 and -7 constructs were made by fusing in-frame sequences encoding the D. melanogaster engrailed repression domain (298 amino acids; Han and Manley, 1993) to the first 340 amino acids of murine Pax7 (to generate the Pax7DN construct) or the first 374 amino acids of Pax3 (to generate the Pax3DN construct). Dominant-negative activity of Pax7DN and -3DN was verified by cotransfection in 293 cells with a plasmid containing polymerized Pax3/7 binding sites (Epstein et al., 1996) in front of a thymidine kinase (Herpes virus) minimal promoter followed by a LacZ reporter gene. Before their introduction into the adenovector, Pax7DN and -3DN were cloned into the Adtrack-CMV shuttle vector and recombinant adenoviruses with a GFP reporter sequence were generated as described previously (He et al., 1996). High-titer viral stocks were prepared by repeated infection into the packaging cell line 293T. Viruses were purified by CsCl banding followed by passage through a 2.5-ml Sephadex G25 column (GE Healthcare) for desalting and stored in aliquots at 80°C. The titer of each preparation was determined after infection of 293 cells by limiting dilution of virus and detection of GFP expression.
Primary cultures of muscle cells were infected 3 d after plating on 35-mm dishes. The medium was removed, but a film of medium (0.3 ml) was left to prevent drying and virus was added to each dish for 30 min at 37°C at a multiplicity of infection of 530 (Results). 1.5 ml of medium was added to the cells that were analyzed 3 d later by immunofluorescence and flow cytometry.
Flow cytometry
Flow cytometric analysis and characterization of (Pax3) GFP-positive cells present in skeletal muscles of adult Pax3GFP/+ mice have permitted us to define parameters for isolating adult muscle progenitor cells both from Pax3-expressing muscles (e.g., diaphragm) and non-Pax3expressing muscles (e.g., lower hindlimb muscles; Montarras et al., 2005). In the case of the latter, this was on the basis of the size and granularity of CD34+ cells. GFP-positive muscle progenitor cells from diaphragm muscle and GFP-negative muscle progenitor cells from lower hindlimb muscles, isolated by flow cytometry, were maintained in culture for 6 d as proliferating cells before a second flow cytometric analysis for detecting the presence of GFP-positive cells.
Flow cytometry analysis was performed with an LSR analyzer (Becton Dickinson) and cell sorting was performed with a Moflo (Cytomation, Inc.). Antibody against CD34 was a mouse monoclonal clone (clone Ram [34]; Becton Dickinson), coupled to biotin, and detected with streptavidin coupled to phycoerythrin. Cell death was measured by PI staining of adenovirus-infected cells, which were identified by GFP fluorescence. Cells were trypsinized and pooled with the culture supernatants before addition of 1 µg/ml PI and flow cytometry. Each determination was from triplicate plates.
Online supplemental material
Fig. S1 presents an analysis of satellite cells present on single fibers isolated from the extensor digitorum longus hindlimb muscle of Pax7+/ and Pax7/ mice at P10. Online supplemental material is available at http://www.jcb.org/cgi/content/full/jcb.200508044/DC1.
| Acknowledgments |
|---|
This work was supported by the Pasteur Institute, the Centre National de la Recherche Scientifique (M. Buckingham and S. Tajbakhsh), and the Institut National de la Santé et de la Recherche Medicale (INSERM; A. Cumano), with additional grants from the Association Française contre les Myopathies (M. Buckingham and D. Montarras), the "Cellules Souches" Grand Programme Horizontal of the Pasteur Institute (M. Buckingham, A. Cumano, and S. Tajbakhsh), the "EuroStemCell" Integrated Project (M. Buckingham, A. Cumano, and S. Tajbakhsh), and the Myogenic Research Network of Excellence (M. Buckingham and S. Tajbakhsh) of the European Union Sixth Framework Programme. F. Relaix is an INSERM fellow. B. Gayraud-Morel is supported by a fellowship from the Agency for Cancer Research.
Submitted: 4 August 2005
Accepted: 23 November 2005
| References |
|---|
|
|
|---|
Abrams, J.M., and M.A. White. 2004. Coordination of cell death and the cell cycle: linking proliferation to death through private and communal couplers. Curr. Opin. Cell Biol. 16:634638.[CrossRef][Medline]
Auerbach, R. 1954. Analysis of the developmental effects of a lethal mutation in the house mouse. J. Exp. Zool. 127:305329.[CrossRef]
Beauchamp, J.R., L. Heslop, D.S. Yu, S. Tajbakhsh, R.G. Kelly, A. Wernig, M.E. Buckingham, T.A. Partridge, and P.S. Zammit. 2000. Expression of CD34 and Myf5 defines the majority of quiescent adult skeletal muscle satellite cells. J. Cell Biol. 151:12211234.
Ben-Yair, R., and C. Kalcheim. 2005. Lineage analysis of the avian dermomyotome sheet reveals the existence of single cells with both dermal and muscle progenitor fates. Development. 132:689701.
Bischoff, R., and C. Heintz. 1994. Enhancement of skeletal muscle regeneration. Dev. Dyn. 201:4154.[Medline]
Bober, E., T. Franz, H.H. Arnold, P. Gruss, and P. Tremblay. 1994. Pax-3 is required for the development of limb muscles: a possible role for the migration of dermomyotomal muscle progenitor cells. Development. 120:603612.[Abstract]
Bouchard, M., A. Souabni, M. Mandler, A. Neubuser, and M. Busslinger. 2002. Nephric lineage specification by Pax2 and Pax8. Genes Dev. 16:29582970.
Braun, T., M.A. Rudnicki, H.H. Arnold, and R. Jaenisch. 1992. Targeted inactivation of the muscle regulatory gene Myf-5 results in abnormal rib development and perinatal death. Cell. 71:369382.[CrossRef][Medline]
Brohmann, H., K. Jagla, and C. Birchmeier. 2000. The role of Lbx1 in migration of muscle precursor cells. Development. 127:437445.[Abstract]
Buchberger, A., N. Nomokonova, and H.H. Arnold. 2003. Myf5 expression in somites and limb buds of mouse embryos is controlled by two distinct distal enhancer activities. Development. 130:32973307.
Buckingham, M., L. Bajard, T. Chang, P. Daubas, J. Hadchouel, S. Meilhac, D. Montarras, D. Rocancourt, and F. Relaix. 2003. The formation of skeletal muscle: from somite to limb. J. Anat. 202:5968.[CrossRef][Medline]
Cai, Q., N.I. Dmitrieva, J.D. Ferraris, H.L. Brooks, B.W. van Balkom, and M. Burg. 2005. Pax2 expression occurs in renal medullary epithelial cells in vivo and in cell culture, is osmoregulated, and promotes osmotic tolerance. Proc. Natl. Acad. Sci. USA. 102:503508.
Chi, N., and J.A. Epstein. 2002. Getting your Pax straight: Pax proteins in development and disease. Trends Genet. 18:4147.[CrossRef][Medline]
Conboy, I.M., and T.A. Rando. 2002. The regulation of notch signaling controls satellite cell activation and cell fate determination in postnatal myogenesis. Dev. Cell. 3:397409.[CrossRef][Medline]
Cooper, R.N., S. Tajbakhsh, V. Mouly, G. Cossu, M. Buckingham, and G.S. Butler-Browne. 1999. In vivo satellite cell activation via Myf5 and MyoD in regenerating mouse skeletal muscle. J. Cell Sci. 112:28952901.[Abstract]
Creuzet, S., L. Lescaudron, Z. Li, and J. Fontaine-Perus. 1998. MyoD, myogenin, and desmin-nls-lacZ transgene emphasize the distinct patterns of satellite cell activation in growth and regeneration. Exp. Cell Res. 243:241253.[CrossRef][Medline]
Epstein, J.A., D.N. Shapiro, J. Cheng, P.Y. Lam, and R.L. Maas. 1996. Pax3 modulates expression of the c-Met receptor during limb muscle development. Proc. Natl. Acad. Sci. USA. 93:42134218.
Franz, T., R. Kothary, M.A. Surani, Z. Halata, and M. Grim. 1993. The Splotch mutation interferes with muscle development in the limbs. Anat. Embryol. (Berl.). 187:153160.[Medline]
Girard, F., U. Strausfeld, A. Fernandez, and N.J. Lamb. 1991. Cyclin A is required for the onset of DNA replication in mammalian fibroblasts. Cell. 67:11691179.[CrossRef][Medline]
Goulding, M., A. Lumsden, and A.J. Paquette. 1994. Regulation of Pax-3 expression in the dermomyotome and its role in muscle development. Development. 120:957971.[Abstract]
Gros, J., M. Manceau, V. Thome, and C. Marcelle. 2005. A common somitic origin for embryonic muscle progenitors and satellite cells. Nature. 435:954958.[CrossRef][Medline]
Gross, M.K., L. Moran-Rivard, T. Velasquez, M.N. Nakatsu, K. Jagla, and M. Goulding. 2000. Lbx1 is required for muscle precursor migration along a lateral pathway into the limb. Development. 127:413424.[Abstract]
Hadchouel, J., J.J. Carvajal, P. Daubas, L. Bajard, T. Chang, D. Rocancourt, D. Cox, D. Summerbell, S. Tajbakhsh, P.W. Rigby, and M. Buckingham. 2003. Analysis of a key regulatory region upstream of the Myf5 gene reveals multiple phases of myogenesis, orchestrated at each site by a combination of elements dispersed throughout the locus. Development. 130:34153426.
Han, K., and J.L. Manley. 1993. Functional domains of the Drosophila Engrailed protein. EMBO J. 12:27232733.[Medline]
He, X.S., M. Rivkina, and W.S. Robinson. 1996. Construction of adenoviral and retroviral vectors coexpressing the genes encoding the hepatitis B surface antigen and B7-1 protein. Gene. 175:121125.[CrossRef][Medline]
Holland, L.Z., M. Schubert, Z. Kozmik, and N.D. Holland. 1999. AmphiPax3/7, an amphioxus paired box gene: insights into chordate myogenesis, neurogenesis, and the possible evolutionary precursor of definitive vertebrate neural crest. Evol. Dev. 1:153165.[CrossRef][Medline]
Kassar-Duchossoy, L., B. Gayraud-Morel, D. Gomes, D. Rocancourt, M. Buckingham, V. Shinin, and S. Tajbakhsh. 2004. Mrf4 determines skeletal muscle identity in Myf5:Myod double-mutant mice. Nature. 431:466471.[CrossRef][Medline]
Kassar-Duchossoy, L., E. Giacone, B. Gayraud-Morel, A. Jory, D. Gomes, and S. Tajbakhsh. 2005. Pax3/Pax7 mark a novel population of primitive myogenic cells during development. Genes Dev. 19:14261431.
Kelly, A.M., and N.A. Rubenstein. 1994. The diversity of muscle fiber types and its origin during development. In Myology. Vol. I. 2nd edition. A.G. Engel and C. Franzini-Armstrong, editors. McGraw-Hill Inc., New York. 119133.
Li, H., H. Liu, C.E. Corrales, H. Mutai, and S. Heller. 2004. Correlation of Pax-2 expression with cell proliferation in the developing chicken inner ear. J. Neurobiol. 60:6170.[CrossRef][Medline]
Lindon, C., O. Albagli, P. Domeyne, D. Montarras, and C. Pinset. 2000. Constitutive instability of muscle regulatory factor Myf5 is distinct from its mitosis-specific disappearance, which requires a D-box-like motif overlapping the basic domain. Mol. Cell. Biol. 20:89238932.
Mankoo, B.S., N.S. Collins, P. Ashby, E. Grigorieva, L.H. Pevny, A. Candia, C.V. Wright, P.W. Rigby, and V. Pachnis. 1999. Mox2 is a component of the genetic hierarchy controlling limb muscle development. Nature. 400:6973.[CrossRef][Medline]
Mansouri, A., A. Stoykova, M. Torres, and P. Gruss. 1996. Dysgenesis of cephalic neural crest derivatives in Pax7/ mutant mice. Development. 122:831838.[Abstract]
Matteucci, C., S. Grelli, E. De Smaele, C. Fontana, and A. Mastino. 1999. Identification of nuclei from apoptotic, necrotic, and viable lymphoid cells by using multiparameter flow cytometry. Cytometry. 35:145153.[CrossRef][Medline]
Megeney, L.A., B. Kablar, K. Garrett, J.E. Anderson, and M.A. Rudnicki. 1996. MyoD is required for myogenic stem cell function in adult skeletal muscle. Genes Dev. 10:11731183.
Montarras, D., C. Lindon, C. Pinset, and P. Domeyne. 2000. Cultured myf5 null and myoD null muscle precursor cells display distinct growth defects. Biol. Cell. 92:565572.[CrossRef][Medline]
Montarras, D., J. Morgan, C. Collins, F. Relaix, S. Zaffran, A. Cumano, T. Partridge, and M. Buckingham. 2005. Direct isolation of satellite cells for skeletal muscle regeneration. Science. 309:20642067.
Muratovska, A., C. Zhou, S. He, P. Goodyer, and M.R. Eccles. 2003. Paired-Box genes are frequently expressed in cancer and often required for cancer cell survival. Oncogene. 22:79897997.[CrossRef][Medline]
Olguin, H.C., and B.B. Olwin. 2004. Pax-7 up-regulation inhibits myogenesis and cell cycle progression in satellite cells: a potential mechanism for self-renewal. Dev. Biol. 275:375388.[CrossRef][Medline]
Oustanina, S., G. Hause, and T. Braun. 2004. Pax7 directs postnatal renewal and propagation of myogenic satellite cells but not their specification. EMBO J. 23:34303439.[CrossRef][Medline]
Patel, T., G.J. Gores, and S.H. Kaufmann. 1996. The role of proteases during apoptosis. FASEB J. 10:587597.[Abstract]
Peschiaroli, A., R. Figliola, L. Coltella, A. Strom, A. Valentini, I. D'Agnano, and R. Maione. 2002. MyoD induces apoptosis in the absence of RB function through a p21(WAF1)-dependent re-localization of cyclin/cdk complexes to the nucleus. Oncogene. 21:81148127.[CrossRef][Medline]
Pinset, C., and D. Montarras. 1998. Cell systems for ex vivo studies of myogenesis: A protocol for the isolation of stable muscle cell populations from newborn to adult mice. In Cell Biology: A Laboratory Handbook. Vol. 1. J.E. Celis, editor. Academic Press, Inc., Orlando, FL. 226232.
Porteous, S., E. Torban, N.P. Cho, H. Cunliffe, L. Chua, L. McNoe, T. Ward, C. Souza, P. Gus, R. Giugliani, et al. 2000. Primary renal hypoplasia in humans and mice with PAX2 mutations: evidence of increased apoptosis in fetal kidneys of Pax2(1Neu) +/ mutant mice. Hum. Mol. Genet. 9:111.
Relaix, F., M. Polimeni, D. Rocancourt, C. Ponzetto, B.W. Schafer, and M. Buckingham. 2003. The transcriptional activator PAX3-FKHR rescues the defects of Pax3 mutant mice but induces a myogenic gain-of-function phenotype with ligand-independent activation of Met signaling in vivo. Genes Dev. 17:29502965.
Relaix, F., D. Rocancourt, A. Mansouri, and M. Buckingham. 2004. Divergent functions of murine Pax3 and Pax7 in limb muscle development. Genes Dev. 18:10881105.
Relaix, F., D. Rocancourt, A. Mansouri, and M. Buckingham. 2005. A Pax3/Pax7-dependent population of skeletal muscle progenitor cells. Nature. 435:948953.[CrossRef][Medline]
Rudnicki, M.A., T. Braun, S. Hinuma, and R. Jaenisch. 1992. Inactivation of MyoD in mice leads to up-regulation of the myogenic HLH gene Myf-5 and results in apparently normal muscle development. Cell. 71:383390.[CrossRef][Medline]
Schafer, K., and T. Braun. 1999. Early specification of limb muscle precursor cells by the homeobox gene Lbx1h. Nat. Genet. 23:213216.[CrossRef][Medline]
Scholzen, T., and J. Gerdes. 2000. The Ki-67 protein: from the known and the unknown. J. Cell. Physiol. 182:311322.[CrossRef][Medline]
Seale, P., L.A. Sabourin, A. Girgis-Gabardo, A. Mansouri, P. Gruss, and M.A. Rudnicki. 2000. Pax7 is required for the specification of myogenic satellite cells. Cell. 102:777786.[CrossRef][Medline]
Tajbakhsh, S., and M. Buckingham. 2000. The birth of muscle progenitor cells in the mouse: spatiotemporal considerations. Curr. Top. Dev. Biol. 48:225268.[Medline]
Tajbakhsh, S., D. Rocancourt, and M. Buckingham. 1996. Muscle progenitor cells failing to respond to positional cues adopt non-myogenic fates in myf-5 null mice. Nature. 384:266270.[CrossRef][Medline]
Tajbakhsh, S., D. Rocancourt, G. Cossu, and M. Buckingham. 1997. Redefining the genetic hierarchies controlling skeletal myogenesis: Pax-3 and Myf-5 act upstream of MyoD. Cell. 89:127138.[CrossRef][Medline]
Torban, E., M.R. Eccles, J. Favor, and P.R. Goodyer. 2000. PAX2 suppresses apoptosis in renal collecting duct cells. Am. J. Pathol. 157:833842.
Tremblay, P., and P. Gruss. 1994. Pax: genes for mice and men. Pharmacol. Ther. 61:205226.[CrossRef][Medline]
Yablonka-Reuveni, Z., and A.J. Rivera. 1994. Temporal expression of regulatory and structural muscle proteins during myogenesis of satellite cells on isolated adult rat fibers. Dev. Biol. 164:588603.[CrossRef][Medline]
Zammit, P.S., J.P. Golding, Y. Nagata, V. Hudon, T.A. Partridge, and J.R. Beauchamp. 2004. Muscle satellite cells adopt divergent fates: a mechanism for self-renewal? J. Cell Biol. 166:347357.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|