|
||
Article |
Complete repair of dystrophic skeletal muscle by mesoangioblasts with enhanced migration ability
Correspondence to Giulio Cossu: cossu.giulio{at}hsr.it
|
|
|---|
Efficient delivery of cells to target tissues is a major problem in cell therapy. We report that enhancing delivery of mesoangioblasts leads to a complete reconstitution of downstream skeletal muscles in a mouse model of severe muscular dystrophy (
-sarcoglycan ko). Mesoangioblasts, vessel-associated stem cells, were exposed to several cytokines, among which stromal- derived factor (SDF) 1 or tumor necrosis factor (TNF)
were the most potent in enhancing transmigration in vitro and migration into dystrophic muscle in vivo. Transient expression of
4 integrins or L-selectin also increased several fold migration both in vitro and in vivo. Therefore, combined pretreatment with SDF-1 or TNF-
and expression of
4 integrin leads to massive colonization (>50%) followed by reconstitution of >80% of
-sarcoglycanexpressing fibers, with a fivefold increase in efficiency in comparison with control cells. This study defines the requirements for efficient engraftment of mesoangioblasts and offers a new potent tool to optimize future cell therapy protocols for muscular dystrophies.
| Introduction |
|---|
|
|
|---|
Mesoangioblast extravasation must be directed by selective mesoangioblastendothelial cell recognition. Microarray analysis revealed that mesoangioblasts express E-selectin, ß7 integrin, AlCAM, several cytokines receptors, and CD44 but lack many of the leukocyte molecules implicated in transmigration (Tagliafico et al., 2004). To increase the efficiency of muscle repair by mesoangioblasts, it would be essential to increase their migration to skeletal muscle, with the additional benefit of reducing unspecific trapping in the capillary filters of the body, such as liver and lung. Here, we report that expression of
4 integrin and exposure of cells to SDF-1 or TNF-
improve up to fivefold migration of wild-type (WT) mesoangioblasts to the dystrophic muscles and consequent production of new fibers that express the normal copy of the mutated gene. These results elucidate the migration mechanism of mesoangioblasts and open a therapeutic opportunity for improving efficacy of cell therapy in muscular dystrophy.
| Results |
|---|
|
|
|---|
cytokines induce mesoangioblast transmigration in vitro
|
in the lower chamber caused a tenfold increase of mesoangioblast migration, a significantly more robust effect than that elicited by FGF or high mobility group box (HMGB) 1, previously described as an enhancer of mesoangioblast migration (Palumbo et al., 2004); IL-1 had little effect, whereas IL-6 and -10 had no effect (Fig. 1 B, left). Mesoangioblasts stained at the lower side of the filter, confirming the positive transmigration effect of SDF-1 and TNF-
(Fig. 1 B, right).
This is in accordance with the fact that myotubes secrete these cytokines at a higher rate than myoblasts. As shown in Fig. 1 C, SDF-1 or TNF-
as well as IL-6 and monocyte chemotactic protein 1 were detected at a higher level in the supernatant from myotubes than in the corresponding supernatant from myoblasts. These data suggest that differentiated myotubes may secrete growth factors or cytokines such as SDF-1 or TNF-
that favor mesoangioblast transmigration by either a chemotactic effect and/or by modifying the endothelium barrier.
Mesoangioblast migration in vivo
To assess the ability of mesoangioblasts to migrate in vivo from the vessel lumen to muscle interstitial tissue (see Fig. 8), we injected 5 x 105 GFP-labeled mesoangioblasts into the right femoral artery of WT C57 (previously injected intramuscularly with cardiotoxin [ctx]), X chromosomelinked muscular dystrophy (mdx), and
-SGnull mice. Mice were killed 6, 12, or 24 h after injection, the muscles (quadriceps, gastrocnemius, and tibialis) from treated (right) and contralateral legs as well as filter organs (liver, spleen, and lung) were collected, and RNA was extracted. The percentage of migrated mesoangioblasts in each recipient organ was calculated by real-time PCR for GFP expression as a percentage of the value corresponding to the total number of injected cells. As shown in Fig. 2 A
, mesoangioblasts were able to migrate to the muscles of the treated legs;
10% of injected cells could be recovered, whereas most of injected cells were retained in the different filter organs without reaching the contralateral muscles. We set our time of analysis at 6 h after injection for the in vivo experiments, as we observed that with the exception of ctx-treated mice, the number of injected cells remains constant for the first 12 h after the injection and thereafter decreases to varying extents (up to 50% of the value observed at 6 h; Fig. 2 A) to increase again in the following days (see Fig. 9 A). Interestingly, mesoangioblasts migrate more efficiently to muscles of ctx-treated normal mice or of
-SGnull mice (Fig. 2 A, top and bottom) than to muscles of the mdx mouse (Fig. 2 A, middle). As shown in Fig. 2 B, the presence of a higher concentration of TNF-
(and to a minor extent SDF-1) in muscles from ctx-treated WT or
-SGnull mice than in mdx mice could explain the preferential migration of mesoangioblasts. Although other cytokines were found to be more abundant in the muscles of mdx mice, these did not affect in vitro transmigration of mesoangioblasts (IL-1, -6, and -10) or, alternatively, mesoangioblasts do not express the corresponding receptors (monocyte chemotactic protein 1 and IL-8).
|
-SGnull mice at 2 or 8 mo of age, and different organs were collected after 6 h. As shown in Fig. 3 A
, the number of mesoangioblasts that reached the damaged muscles was reduced to half when the injection was performed on old mice. This effect could be due to different adhesion molecules expressed by vessels in the muscles of young and old mice. Alexa 488labeled mAbs antiMAdCAM-1 and antiE- or antiP-selectin were injected in the tail vein of
-SGnull mice, and after 20 min, their accumulation was studied with intravital video microscopy. As shown in Fig. 3 B, E- and P-selectin were barely detected in the muscles of old
-SGnull mice. In contrast, in young
-SGnull mice, E- and P-selectin were clearly detected on capillaries and small vessels in the muscles. MAdCAM-1 and E- or P-selectin were not detected in muscles from old mdx mice, whereas only MAdCAM-1 was slightly expressed in young mdx mice (unpublished data). mRNA expression analysis confirmed that E- and P-selectins are highly expressed in muscles of 2-mo-old
-SGnull mice but barely detectable in 8-mo-old mice (Fig. 3 C). These results show that in addition to the reduction of the microvasculature that accompanies fat and connective tissue accumulation in aging, dystrophic muscles, reduced expression of adhesion molecules may further impair stem cell migration.
|
-SGnull mice, and after 6 h, quadriceps, gastrocnemius, and tibialis from the treated leg and liver, spleen, and lung were collected, and the percentage of donor cells was calculated by real-time PCR for GFP. As shown in Fig. 4
, mesoangioblasts reached the muscles of the injected leg in higher numbers than the other stem cell populations in both animal models (left). These data show that mesoangioblasts naturally migrate to dystrophic muscle in comparison with the other cells tested. Interestingly, mesenchymal stem cells were recovered preferentially in the lungs (Fig. 4, right). Experiments with acutely isolated, noncultivated EGFP-hematopoietic stem cells were also performed. Even though results are not directly comparable with those obtained with in vitroexpanded cells, we observed that most hematopoietic cells were retained in the liver and the spleen (unpublished data).
|
increases their migration in vitro and in vivo
for 12 h before challenging them in the transwell assay. The results, shown in Fig. 5 A
, clearly indicated that pretreatment with either SDF-1 and TNF-
stimulated mesoangioblast migration to the same extent observed when the same cytokines were present in the lower chamber. Therefore, SDF-1 or TNF-
pretreated GFP mesoangioblasts were injected through the femoral artery of ctx-pretreated WT, mdx, or
-SGnull mice, and after 6 h, muscles and filter organs were collected and analyzed by real-time PCR for presence of GFP. As shown in Fig. 5 B, both SDF-1 and TNF-
had a modest effect on WT mice (probably because of the acute inflammation induced by ctx) but increased about twofold the migration of mesoangioblasts to the injured muscles of dystrophic mice. Consistently, the number of mesoangioblasts detected in the filter organs was reduced to almost half of control.
|
. The possible change in the expression of several candidate surface molecules was first investigated by FACS analysis (Fig. 5 C). Many of the tested molecules were not changed by treatment with either SDF-1 or TNF-
. However, CD44 expression was increased more than twofold by TNF-
and not by SDF-1, whereas FGFR1 expression was increased only by SDF-1. Although these two molecules are involved in migration processes and could explain part of our effects, we performed a microarray analysis for 125 genes, including surface receptors, to look for more candidates genes induced in mesoangioblasts by SDF-1 or TNF-
. 16 genes were modified after pretreatment of mesoangioblasts with either SDF-1 or TNF-
(Fig. 5 D). Caspase-8 (Casp8), caveolin 1 (cav-1), CD44, cadherin 1 (Cdh1), metalloproteinase (MMP) 13, or vascular cell adhesion molecule (VCAM) 1 expression was increased two- to threefold only by TNF-
pretreatment, whereas Itg
v (
v integrin), MMP-14, or neural cell adhesion molecule (NCAM) 1 were induced approximately twofold only by SDF-1 pretreatment. Pretreatment with either TNF-
or SDF-1 increased expression of intercellular adhesion molecule (ICAM) 1, NCAM-2, different MMPs, platelet endothelial cell adhesion molecule (PECAM), and trombospondins. To verify the role in mesoangioblast transmigration of those molecules that appeared to be more potently induced by TNF-
or SDF-1, we repeated the transwell assay in presence of antibodies against VCAM-1,
v integrins, ICAM-1, or CD44 or MMP inhibitor GM1489. As shown in Fig. 5 E, antibodies against CD44 partially inhibited transmigration induced by TNF-
, whereas antibodies against
v integrin inhibited SDF-1induced transmigration. Blocking MMP activity with GM1489 dramatically inhibited transmigration induced by both molecules. Together, these data suggest that TNF-
and SDF-1 increase mesoangioblast transmigration in vitro and migration to muscles in vivo by increasing expression of several molecules, among which CD44 and MMP appeared the most relevant in the case of TNF-
and
v integrin and MMP appeared most relevant in the case of SDF-1.
4 integrin and L-selectin are necessary for efficient mesoangioblast migration in vitro and in vivo
As revealed by microarray analysis (Tagliafico et al., 2004), mesoangioblasts do not express some of the key molecules that control rolling and extravasation of leukocytes and different stem cells such as L-selectin,
4 integrin, or ß2 integrin (Butcher, 1991). Therefore, we transfected mesoangioblasts with vectors expressing these molecules and EGFP, which allowed FACS selection of transfected cells. To verify the expression of these proteins, a Western blot for total lysates of transfected mesoangioblasts were performed (Fig. 6 A
, left). Correct surface expression of these proteins was also verified by flow cytometry analysis (Fig. 6 A, right). Finally, mesoangioblasts transfected with the different constructs or pretreated with TNF-
or SDF-1 were subjected to differentiation assays. Expression of L-selectin or
4 integrin did not interfere with skeletal muscle differentiation of mesoangioblasts in vitro, whereas expression of ß2 integrin inhibited differentiation (Fig. 6 A, bottom).
|
4 (but nor ß2) integrin or L-selectin expression increased mesoangioblast transmigration six- to eightfold, whether or not C2C12-derived myotubes were present in the lower chamber. Thus, expression of the counterpart ligands for these molecules at the surface of the activated endothelium was sufficient to allow mesoangioblast transmigration independent of the presence of myotubes, with a chemoattractant-independent mechanism. Cotransfection of two or all constructs had only a slightly cumulative effect, which was not statistically significant. When
4 integrin or L-selectinexpressing mesoangioblasts were injected into the femoral artery of ctx-treated WT, mdx, or
-SGnull mice, the number of cells that reached downstream muscles was increased approximately twofold with some variability in different mice (Fig. 6 C). In general,
4 integrin appeared to be more efficient than L-selectin. Therefore, expression of
4 integrins and L-selectin by mesoangioblasts improves their migration, possibly by favoring their interaction with the ligands expressed on the endothelium surface.
Pretreatment with TNF-
or SDF-1 of
4 integrinexpressing mesoangioblasts increased their migration to muscles five- to sixfold
We then tested the possibility of additive or synergistic effects of cytokines and adhesion molecules. Mesoangioblasts, previously transfected with
4 integrin or/and L-selectin constructs, were pretreated for 12 h with TNF-
or SDF-1 and then subjected to transmigration assay through endothelium. As shown in Fig. 7 A
, some combinations were able to improve mesoangioblast transmigration in vitro, the most efficient of which was TNF-
treatment of
4 integrinexpressing cells, which migrated in vitro 15-fold more efficiently than control. Therefore, these cells were injected into the femoral artery of the different animal models: results showed that almost 50% of injected cells reached the injured muscles after 6 h, with a concomitant reduction in the number mesoangioblasts detected in filter organs (Fig. 7 B). To follow these modified mesoangioblasts, we performed immunohistology analysis of the tibialis anterior from an
-SGnull mouse whose femoral artery had been previously (6 h) injected with control or modified mesoangioblasts. As shown in Fig. 8 A
(right), TNF-
pretreated,
4 integrintransfected mesoangioblasts (GFP, right) were able to cross the endothelial barrier of vessels (stained with PECAM, right) and localized in the surrounding muscle tissue (green, left) outside of and sometimes underneath laminin (red, left) in a position typical of satellite cells. Untreated mesoangioblasts were less efficient in crossing the vessel wall, and many fewer were found around the muscle fibers. To monitor the distribution of injected cells at 48 h after injection, muscle sections of transplanted mice were stained for GFP, laminin, and PECAM. As shown in Fig. 8 B, all GFP-modified mesoangioblasts were localized in the muscle tissue, mainly outside of the basal lamina and far from vessels, but in some case underneath it, in a position typical of satellite cells. Indeed, as shown in Fig. 8 C, 2 wk after injection, we detected GFP mesoangioblasts expressing the satellite cell Myf-5 (Beauchamp et al., 2000; Fig. 8 C, left) that occupied the typical position of satellite cells (Fig. 8 C, right).
|
|
pretreated,
4 integrinexpressing mesoangioblasts induce enhanced expression of
-SG
pretreated,
4 integrinexpressing mesoangioblasts were injected into the femoral artery of
-SGnull mice, and after 6 h or 1, 15, 30, 60, or 120 d, the tibialis anterior from treated legs was collected and analyzed by real-time-PCR for GFP or
-SG. As shown in Fig. 9 A
, after an initial modest decline, the number of both control and modified mesoangioblasts began to increase by 15 d after the injection and reached a plateau by 1 mo. At all time points, modified mesoangioblasts were four- to sixfold more numerous than control mesoangioblasts. Likewise,
-SG became detectable
15 d after injection, when mesoangioblasts had been incorporated into regenerating fibers and continued to increase thereafter, again at a much higher level in muscles injected with modified mesoangioblasts. As a matter of fact, 4 mo after a single injection, the level of
-SG expression in the tibialis of injected
-SGnull mice was almost 60% of that detected in the corresponding tibialis from a WT mouse. At the same time, the level of expression of
-SG in the tibialis injected with control mesoangioblasts was only 10% of a WT mouse. In agreement with RT-PCR data,
-SG was detected in almost all (>90%) the muscle fibers of the tibialis injected with treated mesoangioblasts, whereas a lower percentage (
20% with a weaker staining) of positive fibers was present in the tibialis injected with control mesoangioblasts (Fig. 9 B). The newly synthesized
-SG protein was also analyzed by Western blot. As shown in Fig. 9 C, after 4 mo, the quantity of protein detected was approximately sixfold higher in muscles injected with treated mesoangioblasts than with control cells. To test whether increased expression of
-SG would correspond to increased motility, mice were subjected to a running test on a treadmill. The number of times that WT mice,
-SGnull mice, either untreated or treated with control or modified (TNF-
pretreated,
4 integrinexpressing) mesoangioblasts, fell into the grid when running was recorded. Fig. 9 D shows that
-SGnull mice injected with modified mesoangioblasts fell into the grid less frequently than noninjected or control mesoangioblastinjected
-SGnull mice. After this exercise test, many of the null mice appeared to be extremely fatigued and took a relatively long time to recover from the exercise, whereas treated mice seemed to recover from the effort much faster. Together, these data show that mesoangioblasts pretreated with TNF-
and transfected with
4 integrins are not only able to more efficiently reach the damaged muscle but also to reconstitute SG-positive fibers with much higher efficiency and improved muscle function.
|
pretreated,
4 integrinexpressing human mesoangioblasts reach damaged mdx-SCID muscles with higher efficiency
or SDF-1 increased human mesoangioblast migration four- to eightfold without significant enhancement of human fibroblast migration.
|
4 integrin, or ß2 integrin and, after transfection, selected the GFP-positive cells with FACS. To verify the correct surface expression of these proteins, transfected human mesoangioblasts were also analyzed by flow cytometry analysis (Fig. 10 B). Fig. 10 C shows that pretreatment of
4 integrin or L-selectinexpressing human mesoangioblasts with TNF-
or SDF-1 increased their ability to cross the endothelial barrier in transwell assays by
18-fold. Therefore, human mesoangioblasts, pretreated with TNF-
and transfected with vectors encoding for
4 integrin or L-selectin were injected into the femoral artery of mdx-SCID mice that do not reject human cells. Fig. 10 D shows that almost 40% of human modified mesoangioblasts reached the muscles 6 h after intrafemoral artery injection, with a concomitant reduction in the number of cells detected in filter organs. Together, these data show that it is possible to increase human mesoangioblast migration to dystrophic muscle with an experimental protocol similar to that developed for mouse mesoangioblasts. | Discussion |
|---|
|
|
|---|
Testing mesoangioblast migratory activity in vitro
We initially measured mesoangioblast migration with a transwell assay, already proven as a reliable indicator of the mechanisms that govern cellular trafficking in vivo (Mohle et al., 1997). Mesoangioblasts cross the endothelium and migrate toward multinucleated myotubes, an in vitro setting mimicking the microenvironment encountered by these cells after intraarterial injection, as myotubes roughly correspond to newly regenerated, immature fibers that may produce factors. Microarray analysis has also shown that mesoangioblasts express several receptors for cytokines, of which CXCR-4 and TNF-R raise the possibility that these cells may respond to SDF-1 and TNF-
. Indeed, we found that SDF-1 and TNF-
were the most potent inducers of mesoangioblast migration, more than HMGB-1, which was previously reported to be an enhancer of mesoangioblast migration (Palumbo et al., 2004).
Mesoangioblasts migrate into skeletal muscles of young mice in vivo more efficiently than in the muscles of old mice
Homing to skeletal muscle in vivo proceeds through multiple mechanisms, which are only partially mimicked by in vitro assays. When WT mesoangioblasts were injected through the femoral artery of ctx-treated WT or dystrophic mice, only a small percentage (
10%) of injected cells reached downstream skeletal muscle, whereas most cells that had probably passed through the capillary network ended in the venous circulation and were trapped in filter organs. Indeed, a very low number of injected cells could be detected in the contralateral muscles. Interestingly, the percentage of donor cells that could be recovered from the muscles of
-SGnull or ctx-treated WT mice was higher than in mdx mice, possibly because of the different cytokine pattern expression in the muscles (Durbeej and Campbell, 2002). Moreover, age turned to be a critical factor for the success of cell transfer. Vessels present in the dystrophic muscle of young but not old mice expressed adhesion molecules necessary for the correct extravasation. The progression of the disease is characterized by reduced regeneration of muscles fibers, which are replaced by scar and fat. Microcirculation is also altered, thus reducing the possible delivery of cells or viral vectors. Our data show that, in addition, reduced expression of adhesion molecules further reduces migration of stem cells. This is an important issue, as it strongly suggests that cell therapy protocols in older patients would have much-reduced chances of success in comparison with younger patients.
Mesoangioblasts migrate to skeletal muscle in vivo more efficiently than other stem cells
Stem cells have the ability to migrate to their target tissue through different routes, including circulation. Neural stem cells are recruited to areas of brain injury even when injected in the general circulation (Pluchino et al., 2003); hematopoietic stem cells naturally home to bone marrow and other hematopoietic organs (Rosu-Myles et al., 2005); finally, mesenchymal stem cells can also circulate and engraft inside bone (Bensidhoum et al., 2004). We compared the natural ability of these different stem cells to colonize the damaged muscles of mdx or
-SGnull mice upon intraarterial injection. We found that mesoangioblasts are able to reach damaged muscles more efficiently than the other stem cells tested, including hematopoietic stem cells (although different experimental conditions prevent a direct comparison), which migrate preferentially to liver and spleen.
Enhancing mesoangioblast migratory activity
Previous work has shown that HMGB-1 stimulates proliferation and migration of mesoangioblasts to dystrophic muscles that expresses this molecule (Palumbo et al., 2004). We confirm those data; however, in a screen for factors and cytokines for which mesoangioblasts are known to express receptors (Tagliafico et al., 2004), we observed that SDF-1 and TNF-
are more potent as chemoattractants. Interestingly, our work shows that pretreatment of donor cells with these cytokines is sufficient to activate or increase expression of certain surface proteins necessary for the migration and extravasation process, immediately suggesting a simple ex vivo treatment of cells that does not require expression in target muscles. We further investigated the mechanisms involved in this migration increase through a low-density array hybridization performed with mesoangioblasts pretreated with TNF-
or SDF-1. The role of the different genes modified by the treatment was studied in the transmigration assay using inhibitors or blocking antibodies. This experiment revealed that TNF-
acts via an MMP- and CD44-dependent mechanism, whereas the effect of SDF-1 was mediated by MMPs and
v integrins.
Mesoangioblasts do not normally express many of the leukocytes molecules needed for an efficient rolling and arrest at blood vessels, which may explain why most of the injected cells do not bind efficiently, flow through the muscle capillary net, and are finally trapped inside filter organs. Therefore, L-selectin,
4 integrin, and ß2 integrin were expressed in mesoangioblasts, forming dimers with other integrins (such as ß1, ß7 or
l,
m) already expressed by these cells. Expression of L-selectin and
4 integrin did not alter the myogenic differentiation of mesoangioblasts, whereas expression of ß2 integrin did, a fact that precludes future use in vivo. The expression of
4 integrin or L-selectin resulted in an eightfold increase of mesoangioblast transmigration in vitro and a twofold increase in the number of mesoangioblasts that reached the damaged muscles, simultaneously reducing their trapping in filter organs. The combined strategies (i.e., pretreatment with TNF-
of mesoangioblasts expressing
4 integrin) resulted in a 15-fold increase of transmigration through endothelium in vitro and more than fivefold enhanced migration in vivo, with >50% of injected cells now present into the downstream muscles. Immunohistology confirmed these data, as many more modified mesoangioblasts could be detected in muscle interstitium and, later, within muscle fibers (as detected by expression of
-SG) or as satellite cells.
Increased migration corresponds to increased muscle repair and motility
Increasing migration to the target tissue has two positive outcomes: (1) it delivers more cells to repair the target tissue and (2) it reduces the number of cells that are trapped in filter organs. This number is large, and in the case of lungs, it may cause respiratory problems that are not evident in mice. In addition, human mesoangioblasts have a finite number of cell divisions, and this may in the end represent a limiting factor if most of them are wasted outside the target tissue. However, increased migration does not necessarily mean increased tissue repair. In principle, if more cells reach the target tissue, they may undergo a reduced number of divisions in vivo and thus give rise to a similar number of differentiated cells. Our data show that this is not the case.
We previously showed that mesoangioblasts are able to regenerate in part the damaged muscles after three injections and long periods (Sampaolesi et al., 2003). Other types of stem cells have also been shown to reconstitute the skeletal muscle of dystrophic mice to various extents (Corbel et al., 2003; De Bari et al., 2003), but a quantitative analysis was not reported. Mesoangioblasts treated with TNF-
and expressing
4 integrin were able to reach damaged muscles and to produce
-SG 30 d after injection with dramatically increased efficiency, allowing treated
-SGnull mice to improve the performance of exercise. 4 mo after a single injection of modified mesoangioblasts,
-SGnull mice expressed almost 60% of the
-SG detected in a WT mouse. Immunostaining of
-SG showed a partial recovery after 30 d and >90% of well-structured fibers expressing
-SG after 4 mo. This corresponded to a significant increase in the ability to run on a treadmill, despite a unilateral treatment.
In the perspective of a cell therapy in patients, it is important to test whether a similar protocol will also work with human cells. Human mesoangioblasts have been recently isolated from fragments of vessels inside biopsies of postnatal human skeletal muscle. Regarding the use of these cells in the present study, it is important to state that they have a morphology and marker expression similar to their murine counterparts, a finite lifespan (at variance with their murine counterparts), and a similar ability to differentiate into different types of solid mesoderm (unpublished data). Human mesoangioblasts were also exposed to TNF-
, which in the case of human cells was more potent than SDF-1, and transfected with either
4 integrin or L-selectin and, under these conditions, reached skeletal muscles of mdx-SCID mice threefold more efficiently than their corresponding untreated cells. Although these data suggest that further work may still be required to optimize human mesoangioblast migration to skeletal muscle, they clearly indicate that the basic migration mechanisms are similar in mouse and human mesoangioblasts and equally susceptible to enhancement by similar cytokines and adhesion molecules.
In conclusion, our results suggest that pretreatment of mesoangioblasts with TNF-
and the presence of
4 integrin are required for the efficient delivery of stem cells to injured muscles in the course of muscular dystrophy. Pretreatment of stem cells with cytokines is a simple procedure, and inclusion of a relatively small cDNA in a viral vector, designed for gene correction, is also a feasible procedure in the context of autologous cell therapy with engineered stem cells. Together, these strategies represent a novel and simple method for improving the migration of stem cells to damaged tissue and could be tailored in the future to different types of stem cells in different cell therapy protocols requiring migration to other target tissues such as the heart or the bone.
| Materials and methods |
|---|
|
|
|---|
4, anti
v, and antiß2 integrins; antiL-selectin; anti-CD44; anti-FGFR1; antiVCAM-1; and antiICAM-1 antibodies were obtained from Serotec. AntiL-selectin mAb Mel-14 was obtained from American Type Culture Collection. AntiE- and antiP-selectin mAbs (RME-1 and RMP-1) were obtained as previously described (Walter et al., 1997; Souza et al., 1999). AntiMAdCAM-1 and anti-PECAM were provided by E. Butcher (Stanford University, Stanford, CA) and E. Dejana (FIRC Institute of Molecular Oncology, Milan, Italy). Anti
-SG and anti-myf5 antibodies were purchased from NovoCastra. Most reagents and some antibodies were purchased from Sigma-Aldrich, unless stated otherwise. All the cytokines used were obtained from PeproTech. GM1489, the MMP inhibitor, was obtained from Calbiochem. Alexa 488 and Alexa F 647 labeling kit were obtained from Invitrogen.
mdx and C57BL10 WT mice were purchased from Charles River Laboratories, and homo-EGFP mice were provided by A. Nagy (Mount Sinai Hospital, Toronto, Canada; Hadjantonakis et al., 1998).
-SGnull mice were a gift from K. Campbell (University of Iowa, Iowa City, IA; Sampaolesi et al., 2003). All mice were handled following institutional guidelines.
Cell cultures
C2C12 mouse myoblasts or L6 rat myoblasts were cultured in Dulbecco's minimal essential medium plus 20% FBS and induced to differentiate in Dulbecco's minimal essential medium plus 2% FBS. D16 mice mesoangioblasts were isolated from the dorsal aorta of mouse embryos (embryonic day 9.5), cloned, and expanded as described previously (Minasi et al., 2002). Mesoangioblasts transduced with a lentiviral vector encoding the GFP protein were used for some experiments. Murine microvascular endothelial H5V cells (a gift form E. Dejana, FIRC Institute of Molecular Oncology) and mouse embryonic fibroblasts 3T3 were grown in Dulbecco's minimal essential medium plus 10% FBS and starved for 12 h before functional experiments. Mesenchymal and hematopoietic stem cells were isolated from homo-EGFP mice using the SpinSep TM kit (StemCell Technologies, Inc.) and checked for purity according to the manufacturer's instructions. Neural stem cells were isolated from the forebrains of embryos (embryonic day 11.5) as previously described (Galli et al., 2000).
Constructs
Murine or human ß2 integrin, L-selectin, and
4 integrin mRNA cloned in a pT7T3D-Pac1 vector were purchased from Research Genetics. Inserts were cloned into pIRES2-EGFP expression vector from CLONTECH Laboratories, Inc., and transfected into mice or human mesoangioblasts with Lipofectamine (Invitrogen). GFP-positive mesoangioblasts were sorted and used for the different experiments.
Differentiation assays
Treated mesoangioblasts were cocultured with L6 cells in low serum (2%). After 3 d, dishes were fixed with 4% PFA, and the number of mouse nuclei stained with DAPI inside myosin-positive cells was counted. The percentage of differentiation was calculated against the total number of cells.
Real-time PCR
Total RNA from different organs was isolated with TRIzol protocol (Invitrogen) and reverse transcribed by Taqman kit (Platinum Taq DNA polymerase; Invitrogen). RT-PCR was performed for E- and P-selectin (E-selectin primers: Fw, CCATGTTCCACGTCAAGGACC; Rw, GCCATGTGATAGGCCACAG; and P-selectin primers: Fw, CCAGTATCTAGACCCGAAGG; Rw, GCCATTCTCTCTCCTCGAAACAC), and mRNA expression was analyzed by agarose gel. Alternatively, real-time quantitative PCR was done on a real-time PCR system (Mx3000P; Stratagene). Each cDNA sample was amplified in duplicate by using the SYBR Green Supermix (Bio-Rad Laboratories) for GFP or
chromosome detection (GFP primers: Fw, AAGTTCATCTGCACCACCG; Rw, TCCTTGAAGAAGATGGTGCG; and
chromosome primers: Fw, AAGCGACCCATGAACGCATT; Rw, TTCGGGTATTTCTCTCTGTC) or the Taqman Universal PCR master mixture containing AmpliTaq Gold DNA with commercial primers (Applied Biosystems) for
-SG detection. Data are expressed as the percentage of migrated cells, which is calculated by comparing the concentration of target genes in our sample with the total input of injected cells. For the Taqman assay, the level of
-SG detected represents the specific signal detected in the sample (mesoangioblast- injected
-SGnull mouse tibialis anterior) compared with a positive control (WT mouse tibialis anterior; i.e., 100% of positive fibers).
In vitro transwell migration assay
8-µm transwell filters (Corning) were coated with 1% gelatin, and endothelial cells H5V (previously preactivated by 12 h of exposure to TNF-
) were plated to confluence on them for 24 h. Confluence of the endothelial monolayer was assessed by measuring the diffusion of BSA from the upper to the lower chamber. At the same time, C2C12 were grown on a p24w plate with or without differentiated medium for 04 d. 104 mice mesoangioblasts, WT or pretreated or transfected, were plated in Dulbecco's minimal essential medium containing 2% serum on the upper side of transwell chamber 24 h after plating H5V cells, and the chamber was then moved to the wells containing differentiated C2C12 or different cytokines. After 6 h of transmigration, migrated mesoangioblasts on the lower side of the filter were fixed in 4% paraformaldehyde, stained with crystal violet, and counted using an inverted microscope (five random fields of the lower face of the transwell membrane at 20x magnification). The results show migrated cells as a percentage of the total number of input cells.
In vivo migration assay
2- or 8-mo-old WT (injected slowly through all the anterior surface of the tibialis with a 27-gauge needle containing 100 µl of 5 µM ctx [Sigma-Aldrich] 12 h before treatment), mdx, or
-SGnull mice were injected through the right femoral artery with 5 x 105 mouse mesoangioblasts. After 6, 12, or 24 h, animals were killed, and different muscles (quadriceps, gastrocnemius, and tibialis) or filtered organs (liver, lung, and spleen) were collected. RNA was extracted, and a real-time PCR for GFP was performed in all the samples as described (see Real-time PCR). Data are represented as a percentage of migrated cells (percentage of GFP detected) to the different organs relative to the input value.
Intravital microscopy
50 µg of Alexa 488labeled mAbs antiE- or antiP-selectin or antiMAdCAM-1 were injected through the tail vein of
-SGnull mice. 20 min later, the animal was anesthetized and perfused through the left ventricle with cold PBS (Homeister et al., 1998). Blood vessels of striated muscles were visualized with a silicon-intensified target video camera (VE-1000 SIT; Dage-MTI) and monitor (SSM-125CE; Sony).
Microarray analysis
For mRNA analysis, total RNA was extracted from treated mesoangioblasts using TRIzol. cDNA was prepared by reverse-transcription reaction and hybridized to the GEArray gene expression array MM-010 (SuperArray) for extracellular matrix and adhesion molecules according to the manufacturer's instruction. Data were subjected to densitometric analysis using GEArray Expression Analysis Suite (SuperArray). RNA levels were expressed as the relative density after normalizing the hybridization signal to ß-actin.
Western blot
Mesoangioblasts were transfected with the different constructs (see Constructs) and lysed directly in Laemmli buffer on ice. Lysates were resolved on 10% SDS-PAGE under reducing conditions, and proteins were transferred to nitrocellulose membrane (Hybond-ECL; GE Healthcare). Membranes were revealed with anti-GFP and anti
4 or antiß2 integrins or antiL-selectin antibodies.
Flow cytometry
Mesoangioblasts pretreated with different cytokines or transfected with distinct constructs were detached with PBS plus 5 mM EDTA on ice and incubated with antibodies against the different surface molecules for 30 min at 4°C. Cells were then incubated with a Alexa 488conjugated antimouse Ig. Finally, fluorescent samples were analyzed in a FACSCalibur flow cytometer (Becton Dickinson).
Cytokines measurements
Supernatants from fibroblasts, myoblasts, or myotube cultures were collected after 4 d of culture and analyzed with the Beadlyte mouse multicytokine-detection system (Upstate) for measuring cytokines according to the manufacturer's instructions. Muscles from different animal models were homogenized and cytokines were measured using the same kit protocol.
Inmunohistology
Tibialis anterior muscles of
-SGnull mice were removed from mice previously injected with mesoangioblasts and frozen in liquid N2 cooled isopentane. Serial muscle sections were fixed with 4% PFA, permeabilized, satured, and immunostained as previously described (Sampaolesi et al., 2003) with anti-GFP, anti
-SG, anti-laminin, anti-myosin, anti-PECAM, or anti-myf5 antibodies. Alexa 488 or 594 or Cyane (Invitrogen) were used as secondary staining Ig and DAPI for nuclear staining. Isotype control antibodies were used as negative staining. Images were taken with a microscope (S100 TV; Carl Zeiss MicroImaging, Inc.).
Treadmill test
-SGnull mice (n = 4 for each of the four groups) injected or not with control or treated mesoangioblasts were run on a treadmill (Columbus Instruments) set at 7 m/min for 2 min before and after 1 mo from injection. WT C57 mice are also presented as healthy control. The back of the treadmill was equipped with a grid that discharged a mild current, a stimulus designed to motivate the animal to keep running on the treadmill. Performance was measured by the number of times a mouse failed to stay on the running belt and fell into the stimulus grid. Running time was limited to 2 min because the majority of the
-SGnull mice could not run any longer.
Statistical analysis
Statistical significance of the differences between the percentage values was assessed by using the Kruskal-Wallis one-way analysis of variance by ranks test.
represents the significance in each independent case.
| Acknowledgments |
|---|
-SGnull mice; and E. Butcher for the antiMadCAM-1 mAb. This work was supported by grants from Cassa di Risparmio Provincie Lombarde, Telethon, Association Francoise contra les Myopathies, Muscular Dystrophy Association, Duchenne Parent Project, Fondation Leducq, European Community, CariVerona, and Italian Ministries of Health and Research. Firb. B.G. Galvez was supported by a Programme 3+3 fellowship from the Centro Nacional de Investigaciones Cardiovasculares, Spain.
Submitted: 15 December 2005
Accepted: 16 June 2006
| References |
|---|
|
|
|---|
Beauchamp, J.R., L. Heslop, D.S.W. Yu, S. Tajbakhsh, R.G. Kelly, A. Wernig, M.E. Buckingham, T.A. Partridge, and P.S. Zammit. 2000. Expression of CD34 and Myf5 defines the majority of quiescent adult skeletal muscle satellite cells. J. Cell Biol. 151:12211234.
Bensidhoum, M., A. Chapel, S. Francois, C. Demarquay, C. Mazurier, L. Fouillard, S. Bouchet, J. Bertho, P. Gourmelon, J. Aigueperse, et al. 2004. Homing of in vitro expanded Stro-1-or Stro-1+ human mesenchymal stem cells into the NOD/SCID mouse and their role in supporting human CD34 cell engraftment. Blood. 103:33133319.
Butcher, E. 1991. Leukocyte-endothelial cell recognition: three (or more) steps to specificity and diversity. Cell. 67:10331036.[CrossRef][Medline]
Corbel, S., A. Lee, L. Yi, J. Duenas, T. Brazelton, H. Blau, and F. Rossi. 2003. Contribution of hematopoietic stem cells to skeletal muscle. Nat. Med. 9:15281532.[CrossRef][Medline]
De Bari, C., F. Dell'Accio, F. Vandenabeele, J. Vermeesch, J. Raymackers, and F. Luyten. 2003. Skeletal muscle repair by adult human mesenchymal stem cells from synovial membrane. J. Cell Biol. 160:909918.
Durbeej, M., and K. Campbell. 2002. Muscular dystrophies involving the dystrophin-glycoprotein complex: an overview of current mouse models. Curr. Opin. Genet. Dev. 12:349361.[CrossRef][Medline]
Fu, S., and J. Liesveld. 2000. Mobilization of hematopoietic stem cells. Blood Rev. 14:205218.[CrossRef][Medline]
Galli, R., U. Borello, A. Gritti, M. Minasi, C. Bjornson, M. Coletta, M. Mora, M.D. Angelis, R. Fiocco, G. Cossu, and A. Vescovi. 2000. Skeletal myogenic potential of human and mouse neural stem cells. Nat. Neurosci. 3:986991.[CrossRef][Medline]
Grabovsky, V., S. Feigelson, C. Chen, D. Bleijs, A. Peled, G. Cinamon, F. Baleux, F. Arenzana-Seisdedos, T. Lapidot, Y. van Kooyk, et al. 2000. Subsecond induction of
4 integrin clustering by immobilized chemokines stimulates leukocyte tethering and rolling on endothelial vascular cell adhesion molecule 1 under flow conditions. J. Exp. Med. 192:495506.
Hadjantonakis, A., M. Gertsenstein, M. Ikawa, M. Okabe, and A. Nagy. 1998. Generating green fluorescent mice by germline transmission of green fluorescent ES cells. Mech. Dev. 76:7990.[CrossRef][Medline]
Homeister, J., M. Zhang, P. Frenette, R. Hynes, D. Wagner, J. Lowe, and R. Marks. 1998. Overlapping functions of E- and P-selectin in neutrophil recruitment during acute inflammation. Blood. 92:23452352.
Laterveer, L., I. Lindley, D. Heemskerk, J. Camps, E. Pauwels, R. Willemze, and W. Fibbe. 1996. Rapid mobilization of hematopoietic progenitor cells in rhesus monkeys by a single intravenous injection of interleukin-8. Blood. 87:781788.
Minasi, M., M. Riminucci, L.D. Angelis, U. Borello, B. Berarducci, A. Innocenzi, A. Caprioli, D. Sirabella, M. Baiocchi, R.D. Maria, et al. 2002. The meso-angioblast: a multipotent, self-renewing cell that originates from the dorsal aorta and differentiates into most mesodermal tissues. Development. 129:27732783.
Mohle, R., M. Moore, R. Nachman, and S. Rafii. 1997. Transendothelial migration of CD34+ and mature hemopoietic cells: an in vitro study using a bone marrow endothelial cell line. Blood. 89:7279.
Palumbo, R., M. Sampaolesi, F.D. Marchis, R. Tonlorenzi, S. Colombetti, A. Mondino, G. Cossu, and M. Bianchi. 2004. Extracellular HMGB1, a signal of tissue damage, induces mesoangioblast migration and proliferation. J. Cell Biol. 164:441449.
Peled, A., V. Grabovsky, L. Habler, J.S. Arenzana-Seisdedos, I. Petit, H. Ben-Hur, T. Lapidot, and R. Alon. 1999. The chemokine SDF-1 stimulates integrin-mediated arrest of CD34+ cells on vascular endothelium under shear flow. J. Clin. Invest. 104:11991211.[Medline]
Pluchino, S., A. Quattrini, E. Brambilla, A. Gritti, G. Salani, G. Dina, R. Galli, U.D. Carro, S. Amadio, A. Bergami, et al. 2003. Injection of adult neurospheres induces recovery in a chronic model of multiple sclerosis. Nature. 422:688694.[CrossRef][Medline]
Rosu-Myles, M., E. Stewart, J. Trowbridge, C. Ito, P. Zandstra, and M. Bhatia. 2005. A unique population of bone marrow cells migrates to skeletal muscle via hepatocyte growth factor/c-met axis. J. Cell Sci. 118:43434352.
Sampaolesi, M., Y. Torrente, A. Innocenzi, R. Tonlorenzi, G. D'Antona, M. Pellegrino, R. Barresi, N. Bresolin, M.D. Angelis, K. Campbell, et al. 2003. Cell therapy of alpha-sarcoglycan null dystrophic mice through intra-arterial delivery of mesoangioblasts. Science. 301:487492.
Souza, H., C. Elia, J. Spencer, and T. MacDonald. 1999. Expression of lymphocyte-endothelial receptor-ligand pairs, alpha4beta7/MAdCAM-1 and OX40/OX40 ligand in the colon and jejunum of patients with inflammatory bowel disease. Gut. 45:856863.
Tagliafico, E., S. Brunelli, A. Bergamaschi, L.D. Angelis, R. Scardigli, D. Galli, R. Battini, P. Bianco, S. Ferrari, G. Cossu, and S. Ferrari. 2004. TGFbeta/BMP activate the smooth muscle/bone differentiation programs in mesoangioblasts. J. Cell Sci. 117:43774388.
Walter, U., L. Ayer, A. Manning, P. Frenette, D. Wagner, R. Hynes, and B. Wolitzky. 1997. Generation and characterization of a novel adhesion function blocking monoclonal antibody recognizing both rat and mouse E-selectin. Hybridoma. 16:355361.[Medline]
Related Article
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|