|
||
Report |
Correspondence to Lukas A. Huber: Lukas.A.Huber{at}i-med.ac.at
|
|
|---|
Abbreviations used in this paper: EGFR, EGF receptor; ERK, extracellular signal-regulated kinase; KSR, kinase suppressor of Ras; LBPA, lysobisphosphatidic acid; MEF, mouse embryonic fibroblast; MEK, MAPK and ERK kinase; MORE, Mox2Cre; MP1, MEK1 partner; MVB, multivesicular body; RAF, Ras-activated factor; wt, wild type.
| Introduction |
|---|
|
|
|---|
Signaling specificity could be mediated by scaffold and adaptor proteins that trigger the formation of specific signaling complexes at different subcellular locations (Morrison and Davis, 2003; Teis and Huber, 2003). Two scaffold proteins are known to facilitate ERK activation in mammalian cells: the kinase suppressor of Ras 1 (KSR1) and MEK1 partner (MP1). KSR1 was identified as a positive modulator of Ras/MAPK signaling (Kornfeld et al., 1995; Therrien et al., 1995). Upon EGF stimulation, KSR1 is recruited to the plasma membrane, where it enhances MEK and ERK activation (Muller et al., 2001). MP1 was identified in a yeast two-hybrid screen as a specific binding partner of MEK1 (Schaeffer et al., 1998). MP1 is recruited to late endosomes by the adaptor protein p14 (Teis et al., 2002). MP1 and p14 are structurally almost identical and form a very stable heterodimeric complex (Kurzbauer et al., 2004) that is required for ERK activation on endosomes (Teis et al., 2002; Pullikuth et al., 2005). However, the biological significance of p14MP1-facilitated ERK signaling was not known, and it was unclear whether KSR and the p14MP1 complex would function in a redundant manner.
In this study, we show that the p14MP1-MEK1 complex is specifically required to regulate endosomal traffic and cellular proliferation. Conditional gene targeting of p14 in mice reveals its essential function during early embryogenesis and skin development. These findings demonstrate a crucial function of the p14MP1-MEK1 signaling complex in the regulation of tissue homeostasis.
| Results and discussion |
|---|
|
|
|---|
To determine whether p14 was essential for mouse development, heterozygous p14/+ mice were intercrossed. No homozygous p14/ mice were identified in a total of >200 offspring (Table I).
Instead, p14/+ mice were born at a 2:1 ratio over their wild-type (wt) littermates, which was a clear indication of embryonic lethality. Embryos from p14/+ intercrosses were analyzed at different embryonic stages. No phenotypic abnormalities could be detected at embryonic day (E) 6.5. At E8.5,
25% of the embryos (n = 50) were grossly growth retarded with severe developmental defects and were homozygous mutants (Fig. 1 A).
By E10.5, no p14/ embryos were detected (n = 70; Table I). To assess whether the death of p14/ embryos was caused by placental defects, we used Mox2Cre (MORE) mice to delete p14 specifically in the epiblast (Tallquist and Soriano, 2000). Epiblast-restricted p14 deletion also caused embryonic lethality before E10.5 (n = 86; Table I). These data suggested that the embryonic lethality of p14/ mice was not caused by placental defects but was the result of defects in the developing embryo.
|
|
Ectopically expressed myc-MP1 localized to late endosomes in p14f/ MEFs, whereas myc-MP1 mislocalized to the cytoplasm in p14/ MEFs (Fig. 1 C). Reexpression of p14 restored MP1 protein levels (Fig. 1 B, third lane) and its endosomal localization (Fig. 1 C). Thus, p14 is essential to recruit MP1 to late endosomes, which, in turn, is required for efficient and sustained EGF-induced MEK and ERK signaling (Fig. 1 D).
The p14MP1 heterodimer interacts with MEK1 (Schaeffer et al., 1998; Teis et al., 2002; Pullikuth et al., 2005). Because MEK1 has been implicated in regulating endosomal dynamics and Golgi disassembly during mitosis (Acharya et al., 1998; Pelkmans et al., 2005), we next asked whether the p14MP1-MEK1 complex regulates endosomal transport.
The steady-state localization of early endosomes (EEA1) was not altered in p14/ and Mek1/ MEFs (Fig. 2 A). However, late endosomes, multivesicular bodies (MVBs; lysobisphosphatidic acid [LBPA]), and lysosomes (LAMP1) were displaced to the cell periphery (Fig. 2 A, arrows). Reexpression of p14 restored the perinuclear localization of late endosomes (Fig. 2 C). A mutant p14caax, which resides at the plasma membrane (Teis et al., 2002), did not restore proper endosomal localization (Fig. 2 C). This finding demonstrates a crucial role of p14 in the regulation of late endosomes. To investigate whether the positioning of late endosomes requires p14MP1-MEK1 signaling, we determined the localization of MVBs and lysosomes in MEFs in which MEK1 was deleted (Mek1/ MEFs; Fig. 2 A). MVBs and lysosomes were displaced to the cell periphery in Mek1/ MEFs (Fig. 2 A, arrows), which is reminiscent of their mislocalization in p14/ MEFs. Early as well as late endosomes and lysosomes were not affected in KSR1/ MEFs (Fig. 2 A).
|
80% of late endosomes and lysosomes were located in a perinuclear region (within 20 µm of the nucleus), and 20% were >20 µm away. Notably,
40% of all late endosomes and lysosomes in the p14/ and Mek1/ MEFs were >20 µm away from the nucleus. However, the total number of late endosomes and lysosomes was not changed (Fig. 2 B and Fig. S2 B). These findings indicate that the p14MP1-MEK1 complex but not KSR1 is required to regulate the distribution of late endosomes. To determine whether the p14MP1-MEK1 signaling complex is required for efficient transport from early endosomes to late endosomes and lysosomes, we used different endocytic cargos. The p14MP1-MEK1 complex does not regulate the uptake or endosomal traffic of transferrin or dextran (Fig. S2 A). EGF-induced endocytosis of the EGF receptor (EGFR) into early endosomes was not affected (Fig. 2 D, 10 min). In p14f/ and KSR1/ MEFs, EGF colocalized with LAMP1-positive late endosomes (Fig. 2 D, 30 min; arrows). However, no colocalization of EGF with LAMP1 was detected in p14/ and Mek1/ MEFs (Fig. 2 D, 30 min). To further assess the defect in endocytic EGFR traffic, we used quantitative immunoblot analysis of EGFR degradation (Fig. 2 E and Fig. S2 C). 60 min after EGF stimulation, >60% of total EGFR was degraded in the p14f/ MEF, whereas only 30% of total EGFR was degraded in the p14/ MEF (Fig. 2 E and Fig. S2 B). Together, these findings show that late endosomal sorting of activated cell surface receptors is a specific function of the p14MP1-MEK1 signaling complex.
p14 is required for epidermal development
We next addressed how altered late endocytic traffic and reduced ERK signaling would affect tissue homeostasis. Because EGFR and ERK signaling are critical regulators of epidermal proliferation and differentiation, we performed the conditional deletion of p14 in the epidermis. p14f/f were crossed with K5-Cre2 transgenic mice (Tarutani et al., 1997) and bred further to generate p14f/f;K5-Cre2 (p14
ep) animals. PCR analysis from epidermal DNA and Western blot analysis from epidermal lysates demonstrated that p14 was specifically deleted in the epidermis but not in the dermis (Fig. 3 F and Fig. S1, D and E).
p14
ep mice were born alive but died shortly after birth. E18.5 embryos were alive but displayed dramatic skin defects. p14
ep skin appeared erythemic and moist as compared with p14
ep/+ control littermates (Fig. 3 A). The p14
ep epidermis consisted of only a few (four or less) cell layers, and nucleated cells were frequently found in the uppermost cell layer (Fig. 3 A, arrow). The stratum corneum and granular layers were not defined. This indicated compromised terminal differentiation, which resulted in a fatal skin barrier defect (Fig. 3 B) and rapid dehydration, finally causing the perinatal death of the p14
ep mice. These findings demonstrated an essential function of p14 in the development of the epidermis.
|
ep/+ epidermis (Fig. 3 D, inset). However, in p14
ep epidermis, EGFR expression was not restricted to the basal cell layer and extended frequently into suprabasal cell layers (Fig. 3 D, inset), indicating an impaired degradation of EGFR. The failure to down-regulate the EGFR in the suprabasal cell layers resulted in unscheduled and strong suprabasal keratin 6 expression (Fig. 3 E). Keratin 6 expression is known to be induced by suprabasal EGFR expression (Jiang et al., 1993). The expression of keratins 14, 10, and 1 was only mildly affected (Fig. S1 G). Thus, impairment of late endosomal transport and subsequent suprabasal accumulation of the EGFR might result in unscheduled keratin 6 expression, which caused the disastrous failure of the epidermal development of p14
ep animals.
The p14MP1 complex regulates cellular proliferation
Induction of keratin 6 indicates a pathological status of the epidermis and is frequently associated with hyperproliferation. However, the p14
ep epidermis was much thinner compared with the p14
ep/+ epidermis (Fig. 3 A). Cell death was not increased as monitored by TUNEL analysis and activated caspase-3 immunofluorescence staining (Fig. S1 H). Therefore, we investigated whether cell cycle progression was affected in the p14
ep epidermis.
To detect keratinocytes in S phase, pregnant animals at 18.5 d of gestation were injected with BrdU. 1 h later, embryonic skin was collected and analyzed by immunofluorescence analysis. BrdU-positive cells resided in the basal cell layer of p14
ep/+ and p14
ep epidermis. The number of BrdU-positive cells in the p14
ep epidermis was reduced to 54% (Fig. 4, A and C).
The mitotic index of the epidermis was determined by immunofluorescence microscopy with antiphosphohistone H3 antibody. Mitotic cells localized to the basal layer of p14
ep/+ and p14
ep epidermis. The number of mitotic cells in the p14
ep epidermis was reduced to 50% (Fig. 4, B and C). These findings suggested that endosomal p14MP1-MEK1 signaling regulates proliferation in the epidermis.
|
ep keratinocytes exhibited no or extremely poor growth. Therefore, we used MEFs to determine whether p14 regulates proliferation. An equal number of p14f/ and p14/ MEFs were plated and grown for 3 d. After 3 d, p14f/ MEFs grew twice as fast compared with p14/ MEFs (Fig. 4 D). Importantly, the growth defect in continuously growing cultures was fully restored by the retroviral reexpression of wt p14 in p14/ MEFs (Fig. 4 D). To address whether cellular proliferation requires the endosomal localization of p14, we used the p14caax mutant, which efficiently retargets the p14MP1 complex from endosomes to the plasma membrane (Wunderlich et al., 2001). The p14caax mutant could not rescue the growth defect of p14/ MEFs (Fig. 4 D). This indicates that only an endosomal p14MP1 complex provides certain spatial information that is required for cell cycle progression. These findings substantiated a link between endosomal signaling and the regulation of proliferation.
To determine the mitotic index, MEFs were growth arrested by contact inhibition and 48-h serum starvation. MEFs were released from the growth arrest by subconfluent replating in either FCS- or EGF-containing medium (EGF data is not depicted; results were similar to those from FCS-treated cells). After 24 h in FCS, the mitotic p14f/ MEFs had increased from 5 to 24%, whereas the number of mitotic p14/ MEFs changed from 4 to 6% (Fig. 4 D). Expression of the mutant p14caax did not restore the defects in mitotic entry (Fig. 4 D) nor did the overexpression of MEK1 or MP1 in p14/ MEFs (not depicted). The reexpression of p14 in p14/ MEFs fully restored mitogenic proliferation (Fig. 4 D), showing that endosomal p14MP1-MEK1 signaling regulates proliferation in a cell-autonomous manner. The defects of mitogenic entry were also reflected by reduced BrdU incorporation after mitogenic stimulation (Fig. S1 F), indicating a delay in S-phase entry. Next, we determined how the loss of p14 would affect entry into mitosis upon mitogenic stimulation using propidium iodide FACS analysis. 6 h after release from the growth arrest into FCS-containing medium, 44% of the p14f/ MEFs had entered S phase. In contrast, only 17% of the p14/ MEFs had entered S phase, and 70% were still in G1 phase (Fig. 4 E).
In conclusion, p14 is the adaptor protein that recruits the scaffold protein MP1 to late endosomes. There, MP1 interacts with MEK1, which, in turn, controls the late endosomal traffic of activated cell surface receptors and endosomal ERK activation. This provides the spatial and temporal resolution of ERK signaling that is required to promote proliferation in vivo. Thus, our findings indicate that cells coordinate extracellular signaling and endosomal traffic to regulate proliferation during tissue homeostasis.
| Materials and methods |
|---|
|
|
|---|
PCR genotyping, Southern blots, and Western blots
For genotyping, DNA was extracted from tails according to standard protocols. For genotyping of the epidermis tail, the epidermis was separated from dermis by dispase II (Roche) digest, and DNA was extracted according to standard protocols. For Southern blots, 10 µg KpnI-digested DNA were probed by using a 450-bp external probe (primers 219220). Primer sequences are listed in the supplemental material. Western blots were performed as previously described (Teis et al., 2002).
Histology, semithin sections, and immunofluorescence
Isolated skin pieces were embedded in optimal cutting temperatureTissue-Tek on dry ice. Immunofluorescence was performed on 6-µm frozen sections as previously described (Vasioukhin et al., 2001) and were analyzed using a confocal microscope (LSM510 Meta; Carl Zeiss MicroImaging, Inc.; for details, see supplemental material). For semithin section microscopy, skin was fixed with glutaraldehyde (2.5% vol/vol in 0.1 M sodium cacodylate buffer, pH 7.4) followed by unbuffered aqueous osmium tetroxide (1% wt/vol) and unbuffered aqueous uranyl acetate (0.5% wt/vol). Specimens were embedded in Epon epoxy resin. 500-nm semithin sections were stained with Toluidine blue. Immunofluorescence on MEFs was performed as previously described (Teis et al., 2002) and was analyzed using a microscope (Axioplan2 or confocal LSM510 Meta; Carl Zeiss MicroImaging, Inc.; for details, see supplemental material).
Antibodies and endocytic cargos
Primary antibodies were used according to the manufacturer's instructions. Anti-ERK1/2, antiphospho-ERK1/2, antiphospho-AKT, antiphospho-MEK1/2, antiphospho-p38, and antiphospho-JNK1/2 were purchased from Cell Signaling Technology. Antikeratins 1, 6, 10, and 14 were obtained from Covance. Antiß-integrin 4 and antimouse Lamp1 antibody were purchased from BD Biosciences. Anti-Ki67 was obtained from Novacastra, anti-BrdU was purchased from Roche, and antiphosphohistone 3 was purchased from Upstate Biotechnology. Anti-EGFR and -EEA1 antibodies were obtained from Fitzgerald and Santa Cruz Biotechnology, Inc., and anti-LAMP1 was purchased from BD Biosciences. The LBPA antibody was a gift from J. Gruenberg (University of Geneva, Geneva, Switzerland). Anti-p14 and -MP1 antibodies were described previously (Teis et al., 2002). Fluorescently labeled secondary antibodies are listed in the supplemental materials. MEFs were stimulated with 50 ng/ml AlexaFluor594-transferrin or 100 ng/ml of fluorescently labeled EGF for 10 and 30 min or were incubated with 3 mg/ml AlexaFluor488-dextran for 15 and 45 min.
BrdU labeling
Pregnant animals at day 18.5 of gestation were injected intraperitoneally with 1 ml/100 g bodyweight of a 10-mM BrdU (Roche) solution. Embryonic skin was removed and embedded in optimal cutting temperature Tissue-Tek. Tissue culture cells were incubated for 30 min with 10 µM BrdU. Samples were processed according to the manufacturer's instructions.
Isolation of epidermis
To separate the epidermis from dermis, skin was incubated (dermis facing down) in Dispase II (Roche) for 30 min at 32°C. To extract proteins, isolated epidermis was incubated in protein lysis buffer (50 mM Tris-HCl, 200 mM NaCl, 1% Triton X-100, 10% glycerol, 5 mM Na4P2O7, 2 mM Na3OV4, 50 mM NaF, 20 mM ß-glycerophosphate, and protease inhibitors) and mechanically disrupted using a mixer mill tissue homogenizer (MM 301; Retsch).
Generation of the p14 knockout cell line and MEF cell culture
MEFs were generated from day 13.5 p14f/ embryos. p14f/ MEFs were immortalized with E1A retrovirus and were subsequently infected with either a control adenovirus or with an adenovirus-expressing Cre (gift from M. Cotten, GPC Biotech, Munich, Germany). Single-cell clones were selected and scored for p14 protein by Western blotting. For experiments involving starvation and mitogenic stimulation, MEFs were grown on fibronectin-coated dishes (10 µg/ml fibronectin). MEFs were growth arrested by contact inhibition and 48-h serum starvation. MEFs were released from the growth arrest by subconfluent replating in FCS-containing medium. KSR1/ and KSR1+/+ MEFs were provided by A.S. Shaw (Washington University School of Medicine, St. Louis, MO; Nguyen et al., 2002). MEK1/ and MEK1+/+ MEFs were gifts from M. Baccarini (University of Vienna and Medical University of Vienna, Vienna, Austria; Giroux et al., 1999; Galabova-Kovacs et al., 2006).
Epidermal barrier assay
Embryos were incubated for 8 h at 37°C in staining solution (1.3 mM MgCl2, 100 mM NaPO4, 3 mM K3Fe(CN)6, 3 mM K4Fe(CN)6, and 1 mg/ml X-Gal, pH 4.5, with HCl) according to Hardman et al. (1998).
Generation of retrovirus and infection
Mouse p14 and the p14caax cDNAs were subcloned into the retroviral transfer vector MMP (Klein et al., 2000). For retroviral gene transfer, embryonic fibroblasts were transduced at an MOI of 5 in the presence of 8 µg/ml polybrene (Sigma-Aldrich).
Statistics
The epidermis of at least four different mice for the respective phenotype was analyzed by counting positive cells per random field of view (at least 25). The mean was calculated with a SD in a confidence interval of P < 0.001. Growth curves of MEFs were evaluated in three independent experiments.
Endosome distance analysis
Images of LAMP1 immunofluorescence were acquired using a CCD camera (AxioCam HRC; Carl Zeiss MicroImaging, Inc.) on an epifluorescence microscope (Axiovert; Carl Zeiss MicroImaging, Inc.) at 16-bit data depth. Image analysis was performed with MATLAB software (The MathWorks) using custom-designed scripts. Nuclei were identified using the DAPI nuclear counterstain. The position of the geometric center of the nucleus was calculated for each cell and used as a parameter representative of the cell center. Individual endosomes were identified on the basis of their fluorescence intensities using a local thresholding approach. Endosome distances were binned in units of 2 µm in the range of 0 to 40 µm (from the nuclear center). The number of endosomes in each bin was used for further analysis. 24 p14f/ (1,804 late endosomes), 20 Mek1+/+ (3,351 late endosomes), and 19 p14/ cell (1,795 late endosomes) and 21 Mek1/ (3,783) MEFs were analyzed. Results are given in relative frequencies (percentages) for each distance. Extreme cells (Fig. S2 B) were excluded from evaluation. A chi-square independence test was performed on the original data (sum of all endosomes per bin). Endosome distance distributions were found to be significantly different (P < 0.001).
Acquisition and processing of images
An imaging microscope (Axioplan2; Carl Zeiss MicroImaging, Inc.) with a 100x NA 1.3 oil objective (AxioPlan NeoFluar; Carl Zeiss MicroImaging, Inc.) was used for all images shown in Fig. 2 A and Fig. S2 B. For the acquisition of images, a camera (AxioCam HRc; Carl Zeiss MicroImaging, Inc.) and AxioVs40V4.5.0.0 software (Carl Zeiss MicroImaging, Inc.) were used. All fluorochromes (AlexaFluor568 donkey antigoat IgG [H+L], AlexaFluor568 goat antimouse IgG [H+L], and AlexaFluor594 goat antirat IgG [H+L]) used in these two figures were purchased from Invitrogen.
A confocal laser-scanning microscope (LSM510 Meta; Carl Zeiss MicroImaging, Inc.) with a 63x plan-Apochromat NA 1.4 oil objective (phosphohistone 3; Carl Zeiss MicroImaging, Inc.) was used for all images shown in Figs. 1 C, 2 (C and D), 3 (CE), 4 (A and B), and in Figs. S1 (G and H) and S2 A. For the acquisition of images, LSM Image Examiner software (version 3.1.0.117; Carl Zeiss MicroImaging, Inc.) was used. All fluorochromes (AlexaFluor488-dextran [mol wt of 10,000 kD; anionic fixable], AlexaFluor594-transferrin, AlexaFluor488-streptavidin complexed to EGF and biotinylated streptavidin, AlexaFluor488 goat antirabbit IgG [H+L], AlexaFluor568 goat antimouse IgG [H+L], AlexaFluor594 goat antirat IgG [H+L], AlexaFluor568 donkey antigoat IgG [H+L], AlexaFluor568 donkey antigoat IgG [H+L], and AlexaFluor568 donkey antigoat IgG [H+L]) used in these figures were purchased from Invitrogen.
All immunofluorescence was performed at room temperature. In addition to the Zeiss software, images have been converted to Photoshop (version 9.0; Adobe). Brightness, contrast, or tonal value was improved, and figures were arranged with Macromedia Freehand MX 11.0 software (Adobe) and exported as jpeg files.
Primer sequences
The following primers were used: 152 (TGCGGTTTATTAGTAGTTGTGGTC), 153 (GTGCTACTGCATCGATCCTCTGTA), 154 (TACAGAGGATCGATGGCAGTAGCAC), 181 (GAAACGGTTGTGTAGTTCAGT), 180 (GTGCAATTCTGGAGCAGCTTC), 193 (AGCCTCTTGCTCTCCCTCAGT), 188 (GGGCACTGGGCAGCCCTGCCA), 194 (GCGACTGTAGGGGTGTGTTGG), 184 (GGCTTCTCCAGTGCTGTGTCT), 185 (AGACCTGCACCTGGCTCCTCT), 215 (GGTGACTACAACTCCCAGGCG), 202 (CAAGGGCATGCATAGATG), 218 (GAGTGGTTTCCTCGGGAGGAT), 208 (AATGGCCTCAACTCTCAGCTT), 170 (AGCTGGTTGCCGAACAGGATG), 219 (TGCACATGCATCCTGCCTGCT), and 220 (CTCATGGCAGGCAGGTGACTA).
Online supplemental material
The supplemental material contains a description and characterization of the conditional p14 allele, marker analysis of the p14-deficient epidermis, and a characterization of fluid phase endocytosis and recycling of transferrin in p14- and MEK1-deficient MEFs. Fig. S1 shows the targeting strategy, PCR genotyping, and Southern and Western blotting as well as differentiation and apoptosis markers in the epidermis. Fig. S2 shows that p14 is not required for transferrin receptor recycling and fluid phase endocytosis but is required for late endosomal positioning and EGFR degradation. Online supplemental material is available at http://www.jcb.org/cgi/content/full/jcb.200607025/DC1.
| Acknowledgments |
|---|
Work in the Huber laboratory is supported by the special research program Cell Proliferation and Cell Death in Tumors (grant SFB021 from the Austrian Science Fund).
Submitted: 6 July 2006
Accepted: 20 November 2006
| References |
|---|
|
|
|---|
Acharya, U., A. Mallabiabarrena, J.K. Acharya, and V. Malhotra. 1998. Signaling via mitogen-activated protein kinase kinase (MEK1) is required for Golgi fragmentation during mitosis. Cell. 92:183192.[CrossRef][Medline]
Galabova-Kovacs, G., A. Kolbus, D. Matzen, K. Meissl, D. Piazzolla, C. Rubiolo, K. Steinitz, and M. Baccarini. 2006. ERK and beyond: insights from B-Raf and Raf-1 conditional knockouts. Cell Cycle. 5:15141518.[Medline]
Giroux, S., M. Tremblay, D. Bernard, J.F. Cardin-Girard, S. Aubry, L. Larouche, S. Rousseau, J. Huot, J. Landry, L. Jeannotte, and J. Charron. 1999. Embryonic death of Mek1-deficient mice reveals a role for this kinase in angiogenesis in the labyrinthine region of the placenta. Curr. Biol. 9:369372.[CrossRef][Medline]
Hardman, M.J., P. Sisi, D.N. Banbury, and C. Byrne. 1998. Patterned acquisition of skin barrier function during development. Development. 125:15411552.[Abstract]
Jiang, C.K., T. Magnaldo, M. Ohtsuki, I.M. Freedberg, F. Bernerd, and M. Blumenberg. 1993. Epidermal growth factor and transforming growth factor alpha specifically induce the activation- and hyperproliferation-associated keratins 6 and 16. Proc. Natl. Acad. Sci. USA. 90:67866790.
Klein, C., H. Bueler, and R.C. Mulligan. 2000. Comparative analysis of genetically modified dendritic cells and tumor cells as therapeutic cancer vaccines. J. Exp. Med. 191:16991708.
Kolch, W. 2000. Meaningful relationships: the regulation of the Ras/Raf/MEK/ERK pathway by protein interactions. Biochem. J. 351:289305.
Kornfeld, K., D.B. Hom, and H.R. Horvitz. 1995. The ksr-1 gene encodes a novel protein kinase involved in Ras-mediated signaling in C. elegans. Cell. 83:903913.[CrossRef][Medline]
Kurzbauer, R., D. Teis, M.E. de Araujo, S. Maurer-Stroh, F. Eisenhaber, G.P. Bourenkov, H.D. Bartunik, M. Hekman, U.R. Rapp, L.A. Huber, and T. Clausen. 2004. Crystal structure of the p14/MP1 scaffolding complex: how a twin couple attaches mitogen-activated protein kinase signaling to late endosomes. Proc. Natl. Acad. Sci. USA. 101:1098410989.
Morrison, D.K., and R.J. Davis. 2003. Regulation of MAP kinase signaling modules by scaffold proteins in mammals. Annu. Rev. Cell Dev. Biol. 19:91118.[CrossRef][Medline]
Muller, J., S. Ory, T. Copeland, H. Piwnica-Worms, and D.K. Morrison. 2001. C-TAK1 regulates Ras signaling by phosphorylating the MAPK scaffold, KSR1. Mol. Cell. 8:983993.[CrossRef][Medline]
Nguyen, A., W.R. Burack, J.L. Stock, R. Kortum, O.V. Chaika, M. Afkarian, W.J. Muller, K.M. Murphy, D.K. Morrison, R.E. Lewis, et al. 2002. Kinase suppressor of Ras (KSR) is a scaffold which facilitates mitogen-activated protein kinase activation in vivo. Mol. Cell. Biol. 22:30353045.
Pelkmans, L., E. Fava, H. Grabner, M. Hannus, B. Habermann, E. Krausz, and M. Zerial. 2005. Genome-wide analysis of human kinases in clathrin- and caveolae/raft-mediated endocytosis. Nature. 436:7886.[CrossRef][Medline]
Pullikuth, A., E. McKinnon, H.J. Schaeffer, and A.D. Catling. 2005. The MEK1 scaffolding protein MP1 regulates cell spreading by integrating PAK1 and Rho signals. Mol. Cell. Biol. 25:51195133.
Schaeffer, H.J., A.D. Catling, S.T. Eblen, L.S. Collier, A. Krauss, and M.J. Weber. 1998. MP1: a MEK binding partner that enhances enzymatic activation of the MAP kinase cascade. Science. 281:16681671.
Sibilia, M., and E.F. Wagner. 1995. Strain-dependent epithelial defects in mice lacking the EGF receptor. Science. 269:234238.
Tallquist, M.D., and P. Soriano. 2000. Epiblast-restricted Cre expression in MORE mice: a tool to distinguish embryonic vs. extra-embryonic gene function. Genesis. 26:113115.[CrossRef][Medline]
Tarutani, M., S. Itami, M. Okabe, M. Ikawa, T. Tezuka, K. Yoshikawa, T. Kinoshita, and J. Takeda. 1997. Tissue-specific knockout of the mouse Pig-a gene reveals important roles for GPI-anchored proteins in skin development. Proc. Natl. Acad. Sci. USA. 94:74007405.
Teis, D., and L.A. Huber. 2003. The odd couple: signal transduction and endocytosis. Cell. Mol. Life Sci. 60:20202033.[CrossRef][Medline]
Teis, D., W. Wunderlich, and L.A. Huber. 2002. Localization of the MP1-MAPK scaffold complex to endosomes is mediated by p14 and required for signal transduction. Dev. Cell. 3:803814.[CrossRef][Medline]
Therrien, M., H.C. Chang, N.M. Solomon, F.D. Karim, D.A. Wassarman, and G.M. Rubin. 1995. KSR, a novel protein kinase required for RAS signal transduction. Cell. 83:879888.[CrossRef][Medline]
Vasioukhin, V., C. Bauer, L. Degenstein, B. Wise, and E. Fuchs. 2001. Hyperproliferation and defects in epithelial polarity upon conditional ablation of alpha-catenin in skin. Cell. 104:605617.[CrossRef][Medline]
Wunderlich, W., I. Fialka, D. Teis, A. Alpi, A. Pfeifer, R.G. Parton, F. Lottspeich, and L.A. Huber. 2001. A novel 14-kilodalton protein interacts with the mitogen-activated protein kinase scaffold mp1 on a late endosomal/lysosomal compartment. J. Cell Biol. 152:765776.
Related Article
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|