|
||
Report |
Functional genomics identifies a Myb domaincontaining protein family required for assembly of CENP-A chromatin
Correspondence to Arshad Desai: abdesai{at}ucsd.edu; or Paul S. Maddox: pmaddox{at}ucsd.edu
|
|
|---|
Nucleosomes containing the centromere-specific histone H3 variant centromere protein A (CENP-A) create the chromatin foundation for kinetochore assembly. To understand the mechanisms that selectively target CENP-A to centromeres, we took a functional genomics approach in the nematode Caenorhabditis elegans, in which failure to load CENP-A results in a signature kinetochore-null (KNL) phenotype. We identified a single protein, KNL-2, that is specifically required for CENP-A incorporation into chromatin. KNL-2 and CENP-A localize to centromeres throughout the cell cycle in an interdependent manner and coordinately direct chromosome condensation, kinetochore assembly, and chromosome segregation. The isolation of KNL-2associated chromatin coenriched CENP-A, indicating their close proximity on DNA. KNL-2 defines a new conserved family of Myb DNA-binding domaincontaining proteins. The human homologue of KNL-2 is also specifically required for CENP-A loading and kinetochore assembly but is only transiently present at centromeres after mitotic exit. These results implicate a new protein class in the assembly of centromeric chromatin and suggest that holocentric and monocentric chromosomes share a common mechanism for CENP-A loading.
| Introduction |
|---|
|
|
|---|
To identify proteins that are required to localize CENP-A, we took an unbiased functional genomic approach in the nematode Caenorhabditis elegans. C. elegans has holocentric chromosomes in which kinetochores form along the entire length of each sister chromatid instead of being confined to a localized chromosomal region. Fundamental similarities in the mitotic kinetochores of holocentric and monocentric chromosomes are indicated by both high resolution ultrastructural studies and conservation of the constituent proteins, from CENP-A on the DNA to components of the spindle microtubule interface (for review see Maddox et al., 2004). In both types of chromosome architectures, CENP-A is restricted to a subset of chromatin organized on opposing faces of sister chromatids to geometrically constrain kinetochore assembly and ensure correct attachment to the spindle (Buchwitz et al., 1999; Oegema et al., 2001). These similarities suggest that the mechanism of CENP-A loading is likely to be conserved between holocentric chromosomes of C. elegans and monocentric chromosomes of vertebrates. In this study, we provide evidence for this assertion by identifying and characterizing a protein family with a Myb-like DNA-binding domain that is specifically required for CENP-A loading in both nematodes and mammalian cells. Identification of this protein class provides a starting point for understanding the mechanism of this critical step in genome inheritance.
| Results and discussion |
|---|
|
|
|---|
|
250 genes implicated in chromosome segregation by a previous comprehensive genome-wide screen. In the initial screen that targeted 98% of the
19,000 predicted C. elegans genes (Sonnichsen et al., 2005), embryos individually depleted of each of the
1,700 gene products required for embryonic viability were filmed by differential interference contrast (DIC) microscopy. Cluster analysis of the DIC video data revealed a set of
250 genes that are generally required for chromosome segregation (Sonnichsen et al., 2005). Because the KNL phenotype is not discernable by DIC, we used high resolution fluorescence time-lapse imaging to analyze living embryos coexpressing GFP-histone H2b and either GFP
-tubulin or GFP
-tubulin that were depleted of each of these 250 gene products (unpublished data). This approach, which is expected to uncover all nonredundant gene products whose inhibition results in a KNL phenotype, identified five proteins: CeCENP-A, CeCENP-C, KNL-1, KNL-2, and KNL-3. Three of these, CeCENP-C, KNL-1, and KNL-3, function downstream of CeCENP-A because they require CeCENP-A to localize to kinetochores, and their depletion does not prevent CeCENP-A targeting (Oegema et al., 2001; Desai et al., 2003; Cheeseman et al., 2004). The remaining KNL protein, KNL-2 (K06A5.4), specifically targets CeCENP-A to chromatin (see Fig. 2) and represents the only such protein identified by this comprehensive strategy.
The depletion of KNL-2 resulted in a defect in mitotic chromosome segregation that was essentially identical to that of CeCENP-Adepleted embryos (Fig. 1 A and Video 3, available at http://www.jcb.org/cgi/content/full/jcb.200701065/DC1). Premature separation of spindle poles, indicating the absence of kinetochore-microtubule attachments, was quantitatively similar for the two depletions (Fig. 1 B). In contrast to CeCENP-A depletions (Video 2; Monen et al., 2005), KNL-2 depletion also resulted in a meiotic chromosome segregation defect that is evident from the aberrant nature of the oocyte pronucleus (on the embryo anterior/left side in Video 3). The meiotic role of KNL-2 in the segregation of holocentric C. elegans chromosomes is not discussed further here and will be the subject of a separate study. KNL-2 is an
103-kD basic protein with a short coiled-coil stretch and a bipartite nuclear localization sequence. Sequence analysis revealed the presence of a divergent version of a DNA-binding domain at its C terminus, which was first defined in the protooncogene Myb (Fig. 1 C). Myb domains as well as the related SANT domains are present in a large number of proteins implicated in chromatin dynamics, including transcription factors and subunits of chromatin-remodeling enzymes that interact with histones (Aasland et al., 1996; Lipsick, 1996; Mo et al., 2005). Homologues of KNL-2 were present in nematodes closely related to C. elegans, but a clear link to Myb domain proteins in other organisms was not evident in initial bioinformatic analysis (see Fig. 4 for more on this topic).
To determine the subcellular localization of KNL-2, we generated an affinity-purified antibody and a stable C. elegans strain expressing a GFP fusion with KNL-2 (Video 4, available at http://www.jcb.org/cgi/content/full/jcb.200701065/DC1). Both tools revealed that KNL-2 localizes to the centromere/kinetochore region throughout mitosis (Fig. 1, D and E). The specificity of antibody localization was established using RNAi-mediated protein depletion (Fig. 2 A). Because our screening strategy focused on the first embryonic division, it was possible that the function of KNL-2 was limited to the specialized changes in genome architecture that immediately follow fertilization. However, KNL-2 was observed at kinetochores throughout embryogenesis (Fig. 1 F), and an RNAi-based strategy in which KNL-2 is not inhibited until after early embryogenesis (Maddox et al., 2005) indicated a continuous requirement for KNL-2 during development (Fig. S1).
|
Reciprocal depletion and localization experiments place CeCENP-A at the top of the kinetochore assembly hierarchy (Oegema et al., 2001; Desai et al., 2003; Cheeseman et al., 2004). The interdependence of KNL-2 and CeCENP-A for chromosomal targeting (Fig. 2 A) predicted that KNL-2, like CeCENP-A, should be upstream of other kinetochore components. To test this prediction, we examined the recruitment of three widely conserved proteins from distinct positions within the substructure of the mitotic kinetochore: CeCENP-C (inner), KNL-1 (medial), and BUB-1 (outer). As expected, all three proteins failed to localize to chromosomes in KNL-2depleted embryos (Fig. 3 A). In reciprocal depletions, GFPKNL-2 was present on chromosomes in embryos depleted of CeCENP-C, KNL-1, or BUB-1 (Fig. 3 B and Videos 8 and 9, available at http://www.jcb.org/cgi/content/full/jcb.200701065/DC1), placing KNL-2 with CeCENP-A at the top of the kinetochore assembly hierarchy (Fig. 3 E).
|
The aforementioned results suggest that KNL-2 physically associates with CeCENP-A nucleosomes to facilitate their loading and function. To test this idea, we isolated embryonic interphase nuclei from a strain expressing GFPKNL-2, sonicated the chromatin to 5001,500-bp fragments, and immunoprecipitated the KNL-2 fusion protein with an anti-GFP antibody (Fig. 3 D). Analysis of the immunoprecipitates revealed that CeCENP-A but not histone H3 was coenriched with KNL-2 by this procedure (Fig. 3 D). Complementing this biochemical approach, high resolution imaging revealed the partial colocalization of KNL-2 with dispersed CeCENP-A foci in interphase nuclei (Fig. S3, available at http://www.jcb.org/cgi/content/full/jcb.200701065/DC1). CeCENP-A and KNL-2 are the only centromere/kinetochore proteins identified in C. elegans to date that are present in nuclei throughout the cell cycle. Cumulatively, these results indicate that KNL-2 and CeCENP-A are in close physical proximity on chromatin (and may associate directly), where they coordinately maintain centromere structure, initiate kinetochore assembly, and direct chromosome segregation.
Our initial efforts to identify KNL-2 homologues outside of nematodes were unsuccessful because the three nematodes with sequenced genomes are closely related rhabditids. Searches of the recently sequenced genome of the parasitic filarial nematode Brugia malayi (http://www.tigr.org/tdb/e2k1/bma1/) revealed a more distant nematode KNL-2 homologue (Fig. 4 A). By aligning the Myb domain sequence from the filarial KNL-2 with the analogous region of the three rhabditid proteins, we generated a profile that allowed us to identify a KNL-2related subfamily of the Myb/SANT domaincontaining protein superfamily with members in all sequenced vertebrates (Fig. 4 B). The human homologue of KNL-2 was independently discovered in a recent study based on its physical association with Mis18 (Fujita et al., 2007). Mis18 was first found in fission yeast, and both fungal Mis18 and its human homologue are implicated in CENP-A loading (Hayashi et al., 2004; Fujita et al., 2007). No homologue of Mis18 is evident in nematodes, and no KNL-2 homologue is recognizable in fungi.
|
In summary, by using a functional genomic approach in C. elegans based on the signature CENP-A loss of the function phenotype during the first embryonic division, we identified a conserved Myb domaincontaining protein family that is critical for CENP-A loading. The depletion of KNL-2 results in all of the defects expected for a CENP-Aloading factor, and, after extensive functional genomics analysis, KNL-2 is the only protein identified to date in C. elegans that meets this essential criterion. The fact that KNL2 contains a Myb domain raises the exciting possibility that recognition of short, specific DNA sequences may play a role in CENP-A deposition. Although studies of neocentromeres have suggested that centromere identity is not strictly defined by DNA sequence (Choo, 2000; Cleveland et al., 2003), it remains possible that short sequence stretches bias centromeric chromatin assembly. Further investigation of how the Myb domain of the KNL2 protein family contributes to CENP-A loading will help elucidate the mechanism by which this widely conserved protein class directs centromeric chromatin formation.
| Materials and methods |
|---|
|
|
|---|
1,000-bp dsRNA by standard methods; all other dsRNAs were previously described (Desai et al., 2003). siRNA treatment was performed as described previously (Kline et al., 2006) using a cocktail of oligonucleotides purchased from Dharmacon. Polyclonal antibodies were generated to amino acids 2153 of KNL-2 and amino acids 661899 of HsKNL2 fused to GST and were affinity purified. Immunofluorescence was performed as described previously using directly labeled polyclonal antibodies (Oegema et al., 2001). All immunofluorescence images were acquired using a DeltaVision-modified inverted microscope (IX70; Olympus) and Softworx software (Applied Precision) and were deconvolved. Quantification of immunofluorescence was performed in MetaMorph software (Molecular Devices) on images acquired using fixed exposure conditions.
HeLa and C. elegans culture
HeLa cells were cultured in DME as previously described (Kline et al., 2006). C. elegans was grown using standard conditions (Oegema et al., 2001).
Live imaging and GFP fusions
All live images were acquired via a spinning disk confocal microscope (CSU10; McBain Instruments) mounted on an inverted microscope (TE2000e; Nikon). Strain TH32 coexpressing GFP-histone H2b and GFP
-tubulin was imaged using a 60x 1.4 NA plan Apo objective with 1.5x auxiliary magnification and a cooled CCD camera (Orca ER; Hamamatsu) binning 2 x 2. Live imaging of HeLa cells was performed using similar imaging conditions at 37°C. Strain OD31 expressing GFPKNL-2 was imaged in the same manner without the 1.5x auxiliary magnification. To construct strain OD31, oligonucleotides CGCTTCCACTAGTGGTGATACGGAAATTGTTCCTC and CGCTTCCACTAGTTTAGTAGATGGATGTGTCTTCTTCA were used to PCR KNL-2 from cDNA (provided by Y. Kohara, National Institute of Genetics, Shizuoka, Japan), and the resulting fragment was digested with SpeI and cloned into pIC26 to create pPM3. pPM3 was biolistically transformed into C. elegans to generate a stable integrated strain. The HCP-3GFP strain OD101 expressed HCP-3 with an internal GFP fused between the N-terminal tail and the histone core of HCP-3. The DNA construct for HCP-3GFP bombardment was made by digesting a GFP PCR product (forward oligonucleotide GCGCGGAGCTCCATGAGTAAAGGAGAAGAACTTTTCAC and reverse oligonucleotide CGCGCGAGCTCGCTTTGTATAGTTCATCCATGCCAT) with Sac-I and inserting at a Sac-I restriction site within the HCP-3 coding region at residue 173. The HCP-3GFP construct was then inserted at the Bam-HI site of pAZ132 and biolistically transformed into C. elegans to generate a stable, integrated strain. The YFPCENP-A clonal cell line was a gift from D. Foltz (Ludwig Institute for Cancer Research, San Diego, CA; Foltz et al., 2006).
Biochemistry
Nuclei were isolated from adult OD31 C. elegans. In brief, synchronous liquid cultures of OD31 were grown until 510 embryos were present per adult. Embryos were isolated by bleaching, and blastomeres were dissociated by treatment with chitinase (0.5-µg/ml final concentration; 30 min at RT; Sigma-Aldrich). Nuclei were isolated from blastomeres by dounce homogenization in a low ionic strength buffer (0.35 M sucrose, 15 mM Hepes-KOH, pH 7.6, 0.5 mM EGTA, 5 mM MgCl2, 10 mM KCl, 0.1 mM EDTA, and protease inhibitor cocktail) with digitonin (0.125% final concentration; Sigma-Aldrich). Nuclei were washed in lysis buffer (50 mM Hepes, pH 7.4, 5 mM EGTA, 1 mM MgCl2, 300 mM KCl, 10% glycerol, 0.1% Triton X-100, 0.05% NP-40, and protease inhibitors) and sonicated to create chromatin fragments. The sonicated mixture was clarified, and the supernatant was used for immunoprecipitations as described previously (Cheeseman et al., 2004). Western blots were performed using standard methods.
Condensation assay
Quantification of mitotic chromosome condensation was performed as described previously (Maddox et al., 2006) using strain TH32 and the imaging conditions described in the Live imaging and GFP fusions section.
Online supplemental material
Fig. S1 shows that KNL-2 function is not restricted to the first embryonic division of C. elegans. Fig. S2 shows that KNL-2 makes an equivalent contribution to CeCENP-A in condensation and partially colocalizes with CeCENP-A in interphase nuclei of C. elegans embryos. Fig. S3 shows that HsKNL2 is required for chromosome segregation in human cells. Video 1 shows chromosome segregation in a control C. elegans embryo coexpressing GFP-histone H2b and GFP
-tubulin. Videos 2 and 3 show chromosome segregation in CeCENP-A (Video 2) and KNL-2depleted (Video 3) C. elegans embryos coexpressing GFP-histone H2b and GFP
-tubulin. Video 4 shows GFPKNL-2 in a control C. elegans embryo, and Video 5 shows GFPKNL-2 in a CeCENP-Adepleted C. elegans embryo. Video 6 shows GFPCeCENP-A in a control C. elegans embryo, and Video 7 shows GFPCeCENP-A in a KNL-2depleted C. elegans embryo. Videos 8 and 9 show GFPKNL-2 in CeCENP-C (Video 8) and KNL-1depleted (Video 9) C. elegans embryos. Video 10 shows DIC and YFPCENP-A time lapse of control (top) and HsKNL2-depleted (bottom) mitotic HeLa cells. Online supplemental material is available at http://www.jcb.org/cgi/content/full/jcb.200701065/DC1.
| Acknowledgments |
|---|
P.S. Maddox is the Fayez Sarofim Fellow of the Damon Runyon Cancer Research Foundation (DRCRF; grant DRG-1808-04), K. Oegema is a Pew Scholar in the Biomedical Sciences, and A. Desai is the Connie and Bob Lurie Scholar of the DRCRF (grant DRS 38-04). This work was supported by a grant from the National Institutes of Health to A. Desai (R01-GM074215) and by salary support from the Ludwig Institute for Cancer Research to K. Oegema and A. Desai.
Submitted: 11 January 2007
Accepted: 7 February 2007
| References |
|---|
|
|
|---|
Aasland, R., A.F. Stewart, and T. Gibson. 1996. The SANT domain: a putative DNA-binding domain in the SWI-SNF and ADA complexes, the transcriptional co-repressor N-CoR and TFIIIB. Trends Biochem. Sci. 21:8788.[CrossRef][Medline]
Buchwitz, B.J., K. Ahmad, L.L. Moore, M.B. Roth, and S. Henikoff. 1999. A histone-H3-like protein in C. elegans. Nature. 401:547548.
Cheeseman, I.M., S. Niessen, S. Anderson, F. Hyndman, J.R. Yates III, K. Oegema, and A. Desai. 2004. A conserved protein network controls assembly of the outer kinetochore and its ability to sustain tension. Genes Dev. 18:22552268.
Choo, K.H. 2000. Centromerization. Trends Cell Biol. 10:182188.[CrossRef][Medline]
Cleveland, D.W., Y. Mao, and K.F. Sullivan. 2003. Centromeres and kinetochores: from epigenetics to mitotic checkpoint signaling. Cell. 112:407421.[CrossRef][Medline]
DeLuca, J.G., Y. Dong, P. Hergert, J. Strauss, J.M. Hickey, E.D. Salmon, and B.F. McEwen. 2005. Hec1 and nuf2 are core components of the kinetochore outer plate essential for organizing microtubule attachment sites. Mol. Biol. Cell. 16:519531.
Desai, A., S. Rybina, T. Muller-Reichert, A. Shevchenko, A. Shevchenko, A. Hyman, and K. Oegema. 2003. KNL-1 directs assembly of the microtubule-binding interface of the kinetochore in C. elegans. Genes Dev. 17:24212435.
Foltz, D.R., L.E. Jansen, B.E. Black, A.O. Bailey, J.R. Yates III, and D.W. Cleveland. 2006. The human CENP-A centromeric nucleosome-associated complex. Nat. Cell Biol. 8:458469.[CrossRef][Medline]
Fujita, Y., T. Hayashi, T. Kiyomitsu, Y. Toyoda, A. Kokubu, C. Obuse, and M. Yanagida. 2007. Priming of centromere for CENP-A recruitment by human hMis18alpha, hMis18beta, and M18BP1. Dev. Cell. 12:1730.[CrossRef][Medline]
Hayashi, T., Y. Fujita, O. Iwasaki, Y. Adachi, K. Takahashi, and M. Yanagida. 2004. Mis16 and Mis18 are required for CENP-A loading and histone deacetylation at centromeres. Cell. 118:715729.[CrossRef][Medline]
Henikoff, S., and Y. Dalal. 2005. Centromeric chromatin: what makes it unique? Curr. Opin. Genet. Dev. 15:177184.[CrossRef][Medline]
Jansen, L.E.T., B.E. Black, D.F. Foltz, and D.W. Cleveland. 2007. Propagation of centromeric chromatin requires exit from mitosis. J. Cell Biol. 176:795805.
Kline, S.L., I.M. Cheeseman, T. Hori, T. Fukagawa, and A. Desai. 2006. The human Mis12 complex is required for kinetochore assembly and proper chromosome segregation. J. Cell Biol. 173:917.
Lipsick, J.S. 1996. One billion years of Myb. Oncogene. 13:223235.[Medline]
Maddox, P.S., K. Oegema, A. Desai, and I.M. Cheeseman. 2004. "Holo"er than thou: chromosome segregation and kinetochore function in C. elegans. Chromosome Res. 12:641653.[CrossRef][Medline]
Maddox, A.S., B. Habermann, A. Desai, and K. Oegema. 2005. Distinct roles for two C. elegans anillins in the gonad and early embryo. Development. 132:28372848.
Maddox, P.S., N. Portier, A. Desai, and K. Oegema. 2006. Molecular analysis of mitotic chromosome condensation using a quantitative time- resolved fluorescence microscopy assay. Proc. Natl. Acad. Sci. USA. 103:1509715102.
Mellone, B.G., and R.C. Allshire. 2003. Stretching it: putting the CEN(P-A) in centromere. Curr. Opin. Genet. Dev. 13:191198.[CrossRef][Medline]
Mo, X., E. Kowenz-Leutz, Y. Laumonnier, H. Xu, and A. Leutz. 2005. Histone H3 tail positioning and acetylation by the c-Myb but not the v-Myb DNA-binding SANT domain. Genes Dev. 19:24472457.
Monen, J., P.S. Maddox, F. Hyndman, K. Oegema, and A. Desai. 2005. Differential role of CENP-A in the segregation of holocentric C. elegans chromosomes during meiosis and mitosis. Nat. Cell Biol. 7:12481255.[Medline]
Oegema, K., and A.A. Hyman. 2006. Cell division. In WormBook. The C. elegans Research Community, editors. Doi:10.1895/wormbook.1.72.1. http://www.wormbook.org.
Oegema, K., A. Desai, S. Rybina, M. Kirkham, and A.A. Hyman. 2001. Functional analysis of kinetochore assembly in Caenorhabditis elegans. J. Cell Biol. 153:12091226.
Palmer, D.K., K. O'Day, H.L. Trong, H. Charbonneau, and R.L. Margolis. 1991. Purification of the centromere-specific protein CENP-A and demonstration that it is a distinctive histone. Proc. Natl. Acad. Sci. USA. 88:37343738.
Sonnichsen, B., L.B. Koski, A. Walsh, P. Marschall, B. Neumann, M. Brehm, A.M. Alleaume, J. Artelt, P. Bettencourt, E. Cassin, et al. 2005. Full- genome RNAi profiling of early embryogenesis in Caenorhabditis elegans. Nature. 434:462469.[CrossRef][Medline]
Sullivan, B.A., M.D. Blower, and G.H. Karpen. 2001. Determining centromere identity: cyclical stories and forking paths. Nat. Rev. Genet. 2:584596.[CrossRef][Medline]
Takahashi, K., E.S. Chen, and M. Yanagida. 2000. Requirement of Mis6 centromere connector for localizing a CENP-A-like protein in fission yeast. Science. 288:22152219.
Related Articles
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|