|
||
Article |
Correspondence to A. Klar: avihu{at}cc.huji.ac.il
The formation of neuronal networks is governed by a limited number of guidance molecules, yet it is immensely complex. The complexity of guidance cues is augmented by posttranslational modification of guidance molecules and their receptors. We report here that cleavage of the floor plate guidance molecule F-spondin generates two functionally opposing fragments: a short-range repellent protein deposited in the membrane of floor plate cells and an adhesive protein that accumulates at the basement membrane. Their coordinated activity, acting respectively as a short-range repellant and a permissive short-range attractant, constricts commissural axons to the basement membrane beneath the floor plate cells. We further demonstrate that the repulsive activity of the inhibitory fragment of F-spondin requires its presentation by the lipoprotein receptor–related protein (LRP) receptors apolipoprotein E receptor 2, LRP2/megalin, and LRP4, which are expressed in the floor plate. Thus, proteolysis and membrane interaction coordinate combinatorial guidance signaling originating from a single guidance cue.
Abbreviations used in this paper: ApoER2, apolipoprotein E receptor 2; CMV, cytomegalovirus; E, embryonic day; GPI, glycosylphosphatidylinositol; LRP, lipoprotein receptor–related protein; SCO, subcommissural organ; TSR, thrombospondin type-one repeat; VLDLR, very-low-density lipoprotein receptor.
| Introduction |
|---|
|
|
|---|
The basement membrane of the floor plate is a site of deposition of various adhesion molecules (Yaginuma et al., 1991; Hunter et al., 1992), among them F-spondin (Burstyn-Cohen et al., 1999). F-spondin, a gene expressed at the ventral midline of the embryonic spinal cord (i.e., the floor plate) encodes a secreted, ECM-attached protein (Klar et al., 1992). It plays a dual role in patterning axonal trajectory in the embryonic spinal cord by promoting outgrowth of commissural axons and inhibiting outgrowth of motor axons and migration of neural crest cells (Burstyn-Cohen et al., 1999; Debby-Brafman et al., 1999; Tzarfaty-Majar et al., 2001a). The carboxyl half of F-spondin contains six thrombospondin type-one repeats (TSRs). The TSRs of F-spondin protein are typical of class-two TSRs (Tan et al., 2002). Vertebrate class-two TSR proteins are represented in the nervous system by F-spondin, mindin, subcommissural organ (SCO)–spondin and two remotely related proteins, heparin-binding growth-associated molecule and midkine (Feinstein and Klar, 2004).
The TSR domain of F-spondin is proteolytically processed. The cleaved products of F-spondin have different adhesive properties: the fifth and sixth TSRs (TSR5 and TSR6, respectively) bind to the ECM whereas the TSR1-4 fragment does not bind to the ECM (Tzarfaty-Majar et al., 2001b). In this paper we demonstrate that the two fragments of F-spondin, which are generated in vivo by a proteolytic cleavage, are spatially restricted to different extracellular compartments at the midline. An outgrowth-promoting fragment, TSR6, is deposited at the basement membrane that underlies the floor plate, whereas an outgrowth-inhibiting fragment, TSR1-4, is bound to the floor plate cell surface via binding to lipoprotein receptor–related protein (LRP) receptors apolipoprotein E receptor 2 (ApoER2), LRP2/megalin, and LRP4. The spatial localization of F-spondin fragments forces commissural axons to deflect from the repulsive TSR1-4 and extend on the permissive TSR6. Consequentially, commissural axons elongate between the basement membrane and the floor plate cells, rather than into the floor plate cells, which are the source of the chemoattractants netrin and sonic hedgehog. Hence, two novel posttranslational modifications elicit F-spondin activity: the coordinated generation of two functionally opposing polypeptides from a single protein by proteolysis and immobilization by membranal receptors.
| Results |
|---|
|
|
|---|
|
|
To test the subcellular deposition site of F-spondin fragments, the nonadhesive TSR1-4 and the adhesive TSR6 were expressed at the chick embryonic floor plate. Cell-specific expression was achieved by electroporation of DNA using the floor plate–specific enhancer III of the HoxA-1 gene (Fig. S3 A, available at http://www.jcb.org/cgi/content/full/jcb.200702184/DC1; Li and Lufkin, 2000). The TSR1-4 and 6 fragments were expressed at the floor plate at stages 12–14 along with cytoplasmic EGFP. F-spondin fragments were tagged with the myc epitope at the amino terminus. The localization of the ectopically expressed fragments was analyzed at stages 22–24. The TSR1-4 fragment labeled the floor plate cell membrane (Fig. 3, A–C, compare myc staining with the cytoplasmic EGFP staining). The staining obtained for the TSR1-4 fragment resembles the apical floor plate staining obtained with the R3 antibody (Fig. 2, A–D). The TSR1-4 fragment is likely to accumulate on the cell membranes of the expressing cells. In contrast, the TSR6 fragment labeled the basement membrane underlying the floor plate (Fig. 3, D–F), similar to the basal staining acquired with the R3 antibody (Fig. 2, A–D). Thus, the different TSR domains of F-spondin accumulate in different floor plate compartments. The nonadhesive TSR1-4 fragment binds to the surface of the floor plate cells, whereas the adhesive TSR6 fragment is deposited in the ECM that underlies the floor plate cells.
|
|
5) and point mutations in the plasmin cleavage sites (TSR1-6m; Tzarfaty-Majar et al., 2001b). The mutated proteins were flanked with EGFP and myc tags. On electroporation of the mutated proteins into the floor plate, the amino and carboxyl tags labeled the floor plate cells (Fig. 4, G–L). There was no accumulation of TSR6 at the basement membrane. The complete overlapping of the amino and carboxyl tags suggests that deleting or mutating the plasmin cleavage sites generates a plasmin-resistant F-spondin protein. The unprocessed TSR domain of F-spondin, generated by the various mutations, accumulates on the membrane of floor plate cells rather than at the ECM that underlies the floor plate. To test whether plasmin is involved in the processing of F-spondin, the serine protease inhibitor aprotinin was used. Aprotinin was injected repeatedly into the lumen of the spinal cord in ovo. The pattern of the endogenous F-spondin and exogenous double-tagged F-spondin EGFP–TSR1-6–myc was studied. After aprotinin application, the endogenous protein, as revealed by the R3 antibody, binds uniformly to the floor plate cells (Fig. 2 E). The segregation in the deposition of F-spondin between the apical floor plate and the pia that is evident in the floor plate of untreated embryos (Fig. 2, A–D) was eradicated. In addition, the pial staining was reduced (Fig. 2 E), suggesting that the release of TSR5 and 6 from TSR1-4 is inhibited. To test directly whether aprotinin inhibits F-spondin processing, EGFP–TSR1-6–myc was expressed at the floor plate, followed by aprotinin treatment. The amino and carboxyl tags labeled the floor plate cells in an overlapping manner (Fig. 4, M–O), resembling the pattern of the mutated proteins (Fig. 4, G–L). The resistance of F-spondin to cleavage after aprotinin injection provides evidence that F-spondin processing occurs extracellularly. Thus, the cleavage of F-spondin by serine protease is required for the diffusion and accumulation of the adhesive TSRs at the basement membrane.
The membrane-bound TSR1-4 fragment of F-spondin is contact repellent for commissural axons
The localization of the TSR1-4 fragment, together with the finding that it does not support neurite outgrowth in vitro, implies that it may prevent the growth of commissural axons into the floor plate cells. To test the potential inhibitory effect of the TSR1-4 fragment on commissural axons, the fragment was ectopically expressed in the lateral chick neural tube. Expression of a guidance molecule in the presumed responding neurons can hinder the ability of the neurons to respond to the exogenous, target-derived guidance molecule. Thus, an alternate reporter/guidance molecule approach was used. This method generates two different expression patterns: EGFP in the dI1 neuronal subpopulation using the Math1 enhancer (Helms and Johnson, 1998) and a guidance molecule in nondI1 cells using a cytomegalovirus (CMV) enhancer (Fig. 5 A).
dI1 interneurons give rise to commissural and ipsilaterally projecting axons (Fig. 5 B and Fig. S3, B–D). Embryos were electroporated at stages 17 and 18 and analyzed at stage 26. The expression of TSR1-4 in nondI1 cells was barely detectable (Fig. 5 C), suggesting that the ectopically expressed TSR1-4 does not bind avidly to the cell surface of the lateral spinal cord neurons. The presence of TSR1-4 along the axonal trajectory pathway of dI1 axons did not alter their projection. dI1 cells projected axons in commissural and ipsilateral patterns (Fig. 5 C). The projection pattern is similar to the axonal pattern of embryos electroporated with Math1-Cre and EGFP-Cre–dependent plasmids (Fig. 5 A).
|
A TSR1-4GPI/EGFP alternate plasmid with a Math1-Cre plasmid were expressed in the chick neural tube. In contrast to TSR1-4, the staining of ectopic TSR1-4GPI is intense, and cell bodies as well as the axons express it, as revealed by the myc- positive axons at the contralateral side of the spinal cord (Fig. 5 D). The expression of TSR1-4GPI along the trajectory pathway of dI1 axons resulted in substantial elimination of the diagonally crossing commissural axons (Fig. 5 D). The number of diagonally crossing axons toward the floor plate was evaluated. A mean of 5.45 ± 2.2 axons per section was scored in the TSR1-4–treated embryos (n = 20) whereas 1.48 ± 1.35 axons were scored in the TSR1-4GPI–treated embryos (n = 25; Fig. 5 E). The repulsion of dI1 axons for TSR1-4GPI, demonstrated in this protocol, is specific for commissural axons because motor neurons expressing either TSR1-4GPI or EGFP projected laterally in a normal manner (unpublished data). These results support the hypothesis that the endogenous TSR1-4 fragment of F-spondin should be associated with the floor plate cell surface to exert its repulsive effect. TSR1-4 and TSR1-4GPI have no effect on cell fate, as determined by cell fate markers (Fig. S4, A and B, available at http://www.jcb.org/cgi/content/full/jcb.200702184/DC1).
Immobilization of the TSR1-4 fragment of F-spondin by LRP receptors
The TSR1-4 fragment of F-spondin binds to the ApoER2 (Hoe et al., 2005). Fluorescent in situ hybridization with the chick ApoER2 probe demonstrates that ApoER2 is expressed in the lateral floor plate and in the ventral ventricular zone. A low level of expression is also evident at the midline (Fig. 6 A).
Thus, ApoER2 is expressed at the floor plate, mostly at the lateral floor plate cells. Therefore, ApoER2 may bind to F-spondin, immobilize it, and present it to the commissural axons.
|
|
|
Immobilization of the TSR1-4 fragment of F-spondin by LRP receptors results in exertion of its repulsive activity
To test whether ApoER2 may collaborate with the TSR1-4 fragment of F-spondin in inhibiting commissural axon outgrowth, TSR1-4 and ApoER2 were jointly expressed unilaterally at the chick neural tube using TSR1-4/EGFP and ApoER2/EGFP alternating plasmids with a Math1-Cre plasmid. Ectopic expression of ApoER2 at stage 18 had no effect on cell fate as determined by cell fate markers (Fig. S4 C). Coexpression of TSR1-4 and ApoER2 along the dI1 axonal pathway resulted in an axonal failure to turn diagonally toward the floor plate (Fig. 8, A and B). Axons seem to circumvent the ApoER2/TRS1-4 domains. The ratio between the accurate, diagonally crossing axons and the erroneous axon growing in the ventral lateral neural tube is 1.09 ± 1.07 (n = 76; Fig. 8 D). Electroporation of ApoER2 did not cause any dI1 axonal errors and axons projected diagonally toward the floor plate (Fig. 8 C). The ratio between normal and erroneous axonal projection in ApoER2 + TSR1-4 ectopic expression is significantly different from ectopic ApoER2 (4 ± 2.41, n = 18) and ectopic TSR1-4 (5.58 ± 4.39, n = 25; Fig. 8 D).
In ectopic TSR1-4/ApoER2 expression, EGFP axonal labeling is evident in the white matter on the ipsi- and contralateral sides of the floor plate, indicating that dI1 axons elongated in the white matter rather than in the neuroepithelium expressing ApoER2/TSR1-4. Thus, the attraction to the floor plate is retained. The extent of commissural axonal lateral deflection and the failure to cross the midline to the contralateral side in ApoER2/TSR1-4 is smaller than the erroneous phenotype obtained with TSR1-4GPI. This may result from the larger spinal cord domain that is occupied by TSR1-4GPI neuronal cell bodies and axonal processes as opposed to ApoER2-immobilized TSR1-4 that is restricted to cell bodies.
Impeding F-spondin/LRP binding facilitates the growth of commissural axons into the floor plate cells
The redundancy in numerous F-spondin binding receptors precludes the use of loss-of-function approach. As an alternative, we chose to impede the endogenous interaction of F-spondin and F-spondin family proteins with LRP receptors.
ApoER2 binds to the nonadhesive TSR of F-spondin TSR1-4. The adhesive TSR5 and 6 do not bind to ApoER2 (Hoe et al., 2005). This provides the means to specifically block the immobilization of the endogenous TSR1-4 fragment of F-spondin using a secreted (ecto) form of ApoER2. To test whether ApoER2ecto can block the binding of TSR1-4 to the membranal ApoER2, COS cells were transfected with myc-tagged TSR1-4, ApoER2, and various concentrations of ApoER2ecto. At an ApoER2/ApoER2ecto ratio of 1:10, no binding of TSR1-4 to the cell surface was detected (Fig. 7, J–L). Coexpression experiments with ApoER2ecto and other LRP demonstrated that it blocks the binding of F-spondin to LRP4, megalin, and VLDLR (unpublished data).
Thus, ApoER2ecto can serve as a dominant-negative form of ApoER2 that blocks the binding and immobilization of the endogenous TSR1-4 to the endogenous floor plate–derived LRPs ApoER2, megalin, and LRP4. ApoER2ecto was expressed ectopically at the ventral spinal cord. The ventral ectopic expression of ApoER2ecto yielded erroneous axonal projection at the midline. Axons are detached from the ventral bundle that underlies the floor plate and turn dorsally within the floor plate cells (64%, n = 115; Fig. 9, A–C and M). ApoER2ecto has no patterning effect when expressed in the lateral and ventral spinal cord and no axonal guidance effects when expressed in the lateral spinal cord (unpublished data). However, it cannot be excluded that ApoER2ecto may directly affect axon guidance specifically at the floor plate.
|
5) to the cell surface of floor plate cells may either serve as a gain of function (positioning of the outgrowth promoting modules on the surface of floor plate cells) or a loss of function (competing away the repulsive TSR1-4 with a nonrepulsive TSR mutant proteins).
The mutant forms of the TSR domain were electroporated into the ventral spinal cord. Commissural axons encountering the TSR1-6
5 (82%, n = 100; Fig. 9, D–F and M) and TSR1-6m (81%, n = 147; Fig. 9, G–I and M) turned within the floor plate dorsally into the floor plate cells. Electroporation of EGFP (6%, n = 100) or the nonadhesive fragment TSR1-4 (18%, n = 100) did not alter axonal trajectory at the floor plate (Fig. 9, J–M). The erroneous projection of the commissural axons was always confined to the ventral midline, though the mutated proteins were expressed nonspecifically throughout the entire ventral or lateral/ventral neural tube. This suggests that the adhesive TSR5 and 6 are not sufficient to alter commissural outgrowth but rather function as dominant-negative TSR1-4 that inhibits the binding of the endogenous TSR1-4 to the endogenous floor plate LRPs. In support of this, expression of a membrane-tethered form of TSR6 (TSR6GPI) at the ventral neural tube did not cause pathfinding errors at the floor plate (19%, n = 100; Fig. 9 M). These results support the hypothesis that the TSR1-4 fragment of F-spondin serves as a repellent that prevents the invasion of commissural axons into the floor plate.
| Discussion |
|---|
|
|
|---|
|
Ectopic expression of a membrane-tethered form of TSR6 did not alter the projection pattern of commissural axons before and while crossing the floor plate. The inability to affect axonal projection as the axons elongate toward the floor plate may result from spatially restricted expression of putative TSR6 receptors, expressed only as the axons transverse the floor plate. In support of this, the TSR1-6 fragment of F-spondin fused to alkaline phosphatase–labeled floor plate cells and axons under the floor plate (unpublished data). However, even at the midline, axons are not attracted to the ectopic cell surface–associated TSR6. The repositioning of TSR6 along the cell surface may not shift the ratio between repulsive and attractive cues in the floor plate cells. The repulsive activity of TSR1-4 and Slits may dominate the attractive activity of the exogenous TSR6. Furthermore, the short-range attraction of the midline basement membrane, mediated by the endogenous TSR5 and 6 of F-spondin, together with other adhesive molecules, is potentially more robust than the adhesiveness of the ectopic TSR6. Inhibition of both the repulsive activity of endogenous TSR1-4 and the deposition of TSR5 and 6 at the basement membrane, together with ectopic expression of TSR6, is required to elucidate the presumed short-range attractive role of TSR6.
Immobilization of TSR1-4 by LRPs
Guidance molecules are presented to the growth cone as either membrane-bound or ECM-attached molecules. Semaphorins 4, 5, and 6; eprinBs; and the Eph receptors that reverse signal through interaction with ephrinAs are membranal proteins. EphrinAs are GPI encored. Netrin, Slits, and semaphorin 3 bind to the ECM via interaction with proteoglycans. Global blocking of glycosaminoglycan synthesis results in many axonal guidance defects, many of them at the midline (for review see Van Vactor et al., 2006). The immobilized TSR1-4 fragment of F-spondin was shown in vitro to inhibit neurite outgrowth of spinal cord neurons (Fig. 1 A; Tzarfaty-Majar et al., 2001a). However, TSR1-4 does not bind to proteoglycans or the ECM (Tzarfaty-Majar et al., 2001b), and subsequently, when applied ectopically in vivo, does not perturb axonal wiring. The inhibitory activity of TSR1-4 is exerted by a novel mechanism, i.e., binding to a cell surface receptor expressed in cis: the ApoER2, megalin, and the LRP4 receptor. A knockdown of ApoER2, megalin, and LRP4 is required to substantiate the requirement of LRPs for TSR1-4 immobilization to the floor plate cells.
Two LRPs are expressed in commissural axons. Expression of LRP4 in the dorsal neural tube is in the ventricular zone and also spreads to cells lateral to the ventricular zone. It is formally possible that LRP4 protein is stable and expressed in postmitotic commissural neurons. However, VLDLR is expressed in the postmitotic dI1 neurons. LRP4 and VLDLR may serve as a signaling receptor for F-spondin.
Other TSR proteins at the floor plate
Several class-two TSR proteins are expressed at the floor plate. F-spondin and SCO-spondin are expressed at the floor plate of zebrafish, Xenopus laevis, chicks, and rodents (Lichtenfeld et al., 1999) whereas mindin is expressed at the floor plate of zebrafish (Higashijima et al., 1997). The structural homology between F-spondin, mindin, and SCO-spondin, and their extensive overlapping expression domains, is likely to represent redundancy in their biological activities. This notion is reinforced by the expression pattern of SCO-spondin protein at the floor plate. Immunolabeling with anti–SCO-spondin in various vertebrates reveals that SCO-spondin protein is expressed on the floor plate cells above the midline bundle of the commissural axons (Lichtenfeld et al., 1999; del Brio et al., 2000; Richter et al., 2001), similar to the site of deposition of TSR1-4.
The amino acid composition at the third antiparallel strand of SCO-spondin suggests that some TSRs of SCO-spondin are adhesive (TSR2, 3, 8, 14, 18, 19, and 24), and may play a redundant role to TSR5 and 6 of F-spondin. However, it is not known whether SCO-spondin is subjected to proteolysis that is required for release of the adhesive domains to the ECM.
The foremost factors directing the projection of commissural axons toward the floor plate are the long-range guidance molecules emanating from the midlines of the neural tube: the roof plate and the floor plate, BMP7, and netrin (Serafini et al., 1994; Augsburger et al., 1999). At choice points along the pathway (entering and exiting to the floor plate), additional short-range guidance molecules (neuronglia cell adhesion molecule–related cell adhesion molecule, Slits, and F-spondin) contribute to the accurate projection of commissural axons (Klar et al., 1992; Stoeckli and Landmesser, 1995; Brose et al., 1999). An additional layer of complexity is attained by the proteolytic processing of F-spondin. Similar posttranslational modifications may augment the versatility of other guidance molecules and thus intensify the diversity of guidance cues.
| Materials and methods |
|---|
|
|
|---|
In ovo aprotinin treatment
Aprotinin (Protosol [500,000 kallikrein inactivator units/ml]; Kamada) was injected into the lumen of the spinal cord at 10-h intervals from stages 16–23 (five injections). Embryos were analyzed at stage 25.
Immunohistochemistry
Embryos were fixed overnight at 4°C in 4% paraformaldehyde/0.1 M phosphate buffer, washed twice with PBS, incubated in 30% sucrose/PBS for 24 h, and embedded in optimal cutting temperature compound. 14-mm cryostat sections were collected on Superfrost Plus slides (Fisher Scientific) and kept at –70°C. The following antibodies were used: 3A10 (dilution 1:10), 4D7, HNF3ß (dilution 1:10), MNR2 (dilution 1:100), Pax7 (dilution 1:5), Nkx2.2 (dilution 1:10; all provided by T. Jessell, Columbia University, New York, NY), and 9E10 (dilution 1:200). The rabbit polyclonal GFP antibody (dilution 1:500) was obtained from Invitrogen.
For the R3 antibody, embryos were fixed in 4% paraformaldehyde/0.1 M phosphate buffer and processed for embedding in paraffin. 8-µm sections were cut and collected on Superfrost Plus slides. Paraffin was removed by immersion in xylene and the sections were rehydrated using a graded ethanol/H2O series. For antigen retrieval, slides were submerged completely in 10 mM sodium citrate, pH 6.0, in a glass histology box. The buffer was then brought to boiling in a pressure cooker (PickCell Laboratories), and the slides were boiled in buffer for 1 h. Slides immersed in buffer were allowed to cool for 15 min and washed twice for 5 min in PBS at room temperature.
Images were taken on a microscope (Axioscope 2; Zeiss) with a digital camera (DP70; Olympus) or confocal microscope (Eclipse C1; Nikon). Cy2 and 3 were used as fluorochromes.
Outgrowth assay
E13 rat and E6 chick dorsal spinal cord neurons were obtained and plated on F-spondin fragments as described previously (Burstyn-Cohen et al., 1999). F-spondin proteins TSR1-4_HIS, and TSR6_HIS were affinity purified on an affinity column (Talon; CLONTECH Laboratories, Inc.).
DNA
The floor plate–specific enhancer Hoxa-1 enhancer III was provided by T. Lufkin. The human ApoER2 was obtained from the I.M.A.G.E. Consortium (6143442). The chick LRP4 (ChEST392o8) was obtained from the Chick EST Project. To generate the ApoER2ecto the sequences downstream to amino acid 472 were deleted using a BglII site. To generate TSR1-4GPI, TSR5 GPI, and TSR6GPI, a synthetic DNA sequence encoding the prion GPI signal (TCTAGATCCAGCGCGGTGCTGTTCTCCTCCCCTCCTGTGATCCTCCTCATTTCCTTTCTCATCTTCCTGATGGTGGGATGA) was cloned in frame downstream from the TSR fragments of F-spondin.
A megalin minigene was constructed from two partially overlapping EST clones (ChEST548d5 and ChEST437i20) that encompass the third complement-type repeats of chick megalin gene (amino acids 2704–3102), obtained from the Chick Est sequencing project. The ESTs were annealed and "filled in" by PCR using a 5' (5'-CGAAGCTTTGGAAATGTGACAACGACAATG-3') and 3' primer (5'-TAGGATCCCACTGCATTCATTTATACCAC-3'). The PCR product was subcloned into a pSecTagB vector (Invitrogene). A membranal form of megalin was generated by fusing the secreted chick minigene of megalin to the carboxyl end of ApoER2 (transmembrane and cytoplasmatic domains).
TSR12 and 26 of the mouse SCO-spondin were obtained by PCR from genomic mouse DNA. PCR products were cloned in pSecTagB.
Fluorescence in situ hybridization
Fluorescence in situ hybridization of chick spinal cords was performed as described in the TSA plus protocol (PerkinElmer).
Online supplemental material
Fig. S1 depicts the outgrowth of rat E13 dorsal spinal cord neurons on a substrate of purified TSR1-4 and 6. Neurons extend neurites only when cultured on TSR6. Fig. S2 depicts epitope mapping of the R3 antibody. R3 recognizes TSR3 and 5. Fig. S3 describes the expression pattern of the floor plate–specific enhancer HoxA-1 and the commissural-specific enhancer Math-1. Fig. S4 depicts the effect of TSR1-4, TSR1-4GPI, and ApoER2 on the patterning of the neural tube. None of these proteins changes the patterning of neural tube when expressed ectopically in the spinal cord. Fig. S5 illustrates the binding of F-spondin's and SCO-spondin's TSR to LRP receptors. The TSR1-4 fragment of F-spondin binds to LRP2, LRP4, and VLDLR. TSR12 and 26 of SCO-spondin bind to ApoER2. Online supplemental material is available at http://www.jcb.org/cgi/content/full/jcb.200702184/DC1).
| Acknowledgments |
|---|
This work was supported by grants to A. Klar from the Israel-USA Binational Science Foundation (2001/182), the Israel Science Foundation (928/04), and the German-Israel Foundation (G-739.07.1/2002).
Submitted: 28 February 2007
Accepted: 23 August 2007
| References |
|---|
|
|
|---|
Augsburger, A., A. Schuchardt, S. Hoskins, J. Dodd, and S. Butler. 1999. BMPs as mediators of roof plate repulsion of commissural neurons. Neuron. 24:127–141.[CrossRef][Medline]
Bovolenta, P., and J. Dodd. 1990. Guidance of commissural growth cones at the floor plate in the embryonic rat spinal cord. Development. 109:435–447.[Abstract]
Brose, K., K.S. Bland, K.H. Wang, D. Arnott, W. Henzel, C.S. Goodman, M. Tessier-Lavigne, and T. Kidd. 1999. Slit proteins bind Robo receptors and have an evolutionarily conserved role in repulsive axon guidance. Cell. 96:795–806.[CrossRef][Medline]
Burstyn-Cohen, T., V. Tzarfaty, A. Frumkin, Y. Feinstein, E. Stoeckli, and A. Klar. 1999. F-spondin is required for accurate pathfinding of commissural axons at the floor plate. Neuron. 23:233–246.[CrossRef][Medline]
Charron, F., E. Stein, J. Jeong, A.P. McMahon, and M. Tessier-Lavigne. 2003. The morphogen sonic hedgehog is an axonal chemoattractant that collaborates with netrin-1 in midline axon guidance. Cell. 113:11–23.[CrossRef][Medline]
Debby-Brafman, A., T. Burstyn-Cohen, A. Klar, and C. Kalcheim. 1999. F-spondin, expressed in somitic regions avoided by neural crest cells, mediates inhibition of distinct somite domain to neural crest migration. Neuron. 22:475–488.[CrossRef][Medline]
del Brio, M.A., P. Riera, R.I. Munoz, H. Montecinos, and E.M. Rodriguez. 2000. The metencephalic floor plate of chick embryos expresses two secretory glycoproteins homologous with the two glycoproteins secreted by the subcommissural organ. Histochem. Cell Biol. 113:415–426.[Medline]
Feinstein, Y., and A. Klar. 2004. The neuronal class 2 TSR proteins F-spondin and Mindin: a small family with divergent biological activities. Int. J. Biochem. Cell Biol. 36:975–980.[CrossRef][Medline]
Guinazu, M.F., H.G. Richter, and E.M. Rodriguez. 2002. Bovine floor plate explants secrete SCO-spondin. Cell Tissue Res. 308:177–191.[CrossRef][Medline]
Helms, A.W., and J.E. Johnson. 1998. Progenitors of dorsal commissural interneurons are defined by MATH1 expression. Development. 125:919–928.[Abstract]
Higashijima, S., A. Nose, G. Eguchi, Y. Hotta, and H. Okamoto. 1997. Mindin/F-spondin family: novel ECM proteins expressed in the zebrafish embryonic axis. Dev. Biol. 192:211–227.[CrossRef][Medline]
Hoe, H.S., D. Wessner, U. Beffert, A.G. Becker, Y. Matsuoka, and G.W. Rebeck. 2005. F-spondin interaction with the apolipoprotein E receptor ApoEr2 affects processing of amyloid precursor protein. Mol. Cell. Biol. 25:9259–9268.
Hunter, D.D., R. Llinas, M. Ard, J.P. Merlie, and J.R. Sanes. 1992. Expression of s-laminin and laminin in the developing rat central nervous system. J. Comp. Neurol. 323:238–251.[CrossRef][Medline]
Kennedy, T.E., T. Serafini, J.R. de la Torre, and M. Tessier-Lavigne. 1994. Netrins are diffusible chemotropic factors for commissural axons in the embryonic spinal cord. Cell. 78:425–435.[CrossRef][Medline]
Kennedy, T.E., H. Wang, W. Marshall, and M. Tessier-Lavigne. 2006. Axon guidance by diffusible chemoattractants: a gradient of netrin protein in the developing spinal cord. J. Neurosci. 26:8866–8874.
Klar, A., M. Baldassare, and T.M. Jessell. 1992. F-spondin: a gene expressed at high levels in the floor plate encodes a secreted protein that promotes neural cell adhesion and neurite extension. Cell. 69:95–110.[CrossRef][Medline]
Li, X., and T. Lufkin. 2000. Cre recombinase expression in the floorplate, notochord and gut epithelium in transgenic embryos driven by the Hoxa-1 enhancer III. Genesis. 26:121–122.[CrossRef][Medline]
Lichtenfeld, J., J. Viehweg, J. Schutzenmeister, and W.W. Naumann. 1999. Reissner's substance expressed as a transient pattern in vertebrate floor plate. Anat. Embryol. (Berl.). 200:161–174.[CrossRef][Medline]
Long, H., C. Sabatier, L. Ma, A. Plump, W. Yuan, D.M. Ornitz, A. Tamada, F. Murakami, C.S. Goodman, and M. Tessier-Lavigne. 2004. Conserved roles for Slit and Robo proteins in midline commissural axon guidance. Neuron. 42:213–223.[CrossRef][Medline]
Richter, H.G., R.I. Munoz, C.S. Millan, M.F. Guinazu, C.R. Yulis, and E.M. Rodriguez. 2001. The floor plate cells from bovines express the mRNA encoding for SCO-spondin and its translation products. Brain Res. Mol. Brain Res. 93:137–147.[Medline]
Sabatier, C., A.S. Plump, M. Le, K. Brose, A. Tamada, F. Murakami, E.Y. Lee, and M. Tessier-Lavigne. 2004. The divergent Robo family protein rig-1/Robo3 is a negative regulator of slit responsiveness required for midline crossing by commissural axons. Cell. 117:157–169.[CrossRef][Medline]
Serafini, T., T.E. Kennedy, M. Galko, C. Mirzayan, T.M. Jessell, and M. Tessier-Lavigne. 1994. The netrins define a family of axon outgrowth-promoting proteins homologous to C. elegans UNC-6. Cell. 78:409–424.[CrossRef][Medline]
Stoeckli, E.T., and L.T. Landmesser. 1995. Axonin-1, Nr-CAM, and Ng-CAM play different roles in the in vivo guidance of chick commissural neurons. Neuron. 14:1165–1179.[CrossRef][Medline]
Tan, K., M. Duquette, J.H. Liu, Y. Dong, R. Zhang, A. Joachimiak, J. Lawler, and J.H. Wang. 2002. Crystal structure of the TSP-1 type 1 repeats: a novel layered fold and its biological implication. J. Cell Biol. 159:373–382.
Tzarfaty-Majar, V., T. Burstyn-Cohen, and A. Klar. 2001a. F-spondin is a contact-repellent molecule for embryonic motor neurons. Proc. Natl. Acad. Sci. USA. 98:4722–4727.
Tzarfaty-Majar, V., R. López-Alemany, Y. Feinstein, L. Gombau, O. Goldshmidt, E. Soriano, P. Muñoz-Cánoves, and A. Klar. 2001b. Plasmin-mediated release of the guidance molecule F-spondin from the extracellular matrix. J. Biol. Chem. 276:28233–28241.
Van Vactor, D., D.P. Wall, and K.G. Johnson. 2006. Heparan sulfate proteoglycans and the emergence of neuronal connectivity. Curr. Opin. Neurobiol. 16:40–51.[CrossRef][Medline]
Yaginuma, H., S. Homma, R. Kunzi, and R.W. Oppenheim. 1991. Pathfinding by growth cones of commissural interneurons in the chick embryo spinal cord: a light and electron microscopic study. J. Comp. Neurol. 304:78–102.[CrossRef][Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||