|
||
Article |
Very-KIND, a KIND domain–containing RasGEF, controls dendrite growth by linking Ras small GTPases and MAP2
Correspondence to Teiichi Furuichi: tfuruichi{at}brain.riken.jp
The regulation of cytoskeletal components in the dendritic shaft core is critical for dendrite elongation and branching. Here, we report that a brain-specific Ras guanine nucleotide exchange factor (RasGEF) carrying two kinase non-catalytic C-lobe domains (KINDs), very-KIND (v-KIND), regulates microtubule-associated protein 2 (MAP2). v-KIND is expressed in developing mouse brain, predominantly in the cerebellar granule cells. v-KIND not only activates Ras small GTPases via the C-terminal RasGEF domain, but also specifically binds to MAP2 via the second KIND domain (KIND2), leading to threonine phosphorylation of MAP2. v-KIND overexpression suppresses dendritic extension and branching of hippocampal neurons and cerebellar granule cells, whereas knockdown of endogenous v-KIND expression promotes dendrite growth. These findings suggest that v-KIND mediates a signaling pathway that links Ras and MAP2 to control dendrite growth.
Abbreviations used in this paper: DIV, days in vitro; GEF, guanine nucleotide exchange factor; HMW MAP2, high molecular weight MAP2; KINDs, kinase non-catalytic C-terminal domains; MAP2, microtubule associated protein 2; MT, microtubule; v-KIND, very-KIND.
| Introduction |
|---|
|
|
|---|
Various signaling pathways underlying dendrite development eventually affect the dynamics of actin filaments or microtubules (MTs) or both during dendrite growth. The high molecular weight MAP2 (referred to hereafter as MAP2) family proteins are an abundant group of MT-associated proteins that are predominantly expressed in neurons (Friedrich and Aszodi, 1991) and are selectively enriched in the soma and dendrites (Bernhardt and Matus, 1984). In dendrites, MAP2 is a major component of the cross-bridges between MTs, or between MTs and other cytoskeletal components (Shiomura and Hirokawa, 1987; Hirokawa et al., 1988). In MAP2-deficient mice, the dendrites have a reduced MT density, and are shorter in hippocampal neurons (Harada et al., 2002). Moreover, MAP2 can be highly phosphorylated and is thought to act as a phosphorylation- dependent modulator of MTs during dendrite development (Sanchez et al., 2000). The details of the molecular mechanisms underlying these cytoskeletal regulations, however, are not fully understood.
Very-KIND protein (v-KIND) was first characterized as a nervous system–specific protein carrying two kinase noncatalytic C-lobe domains (KINDs), a RasGEF N-terminal domain (RasN), and a putative RasGEF domain (Mees et al., 2005). The functional role of this new class of RasGEF v-KIND is largely unknown. In this study, we identified v-KIND as a transcript with up-regulated, brain-specific, and cerebellum- dominant expression profiles by transcriptomic analysis of postnatal mouse cerebellum (Cerebellar Development Transcriptome Database [CDT-DB] project, http://www.cdtdb.brain.riken.jp). v-KIND was expressed during mouse brain development and interacted with Ras and MAP2. Overexpression of v-KIND suppressed dendrite growth, leading to simple branching patterns. In contrast, knockdown of v-KIND expression by RNA interference (RNAi) led to more complicated dendrite branching patterns. The results of the present study suggest that v-KIND is important for the control of dendrite growth. v-KIND is the first RasGEF known to bind to MAP2, thereby providing a new mechanism to link the Ras GTPase signaling pathway and MAP2-MT cytoskeletal organization during dendrite morphogenesis.
| Results |
|---|
|
|
|---|
|
Cellular localization of v-KIND mRNA in P7 and P21 mouse brain was analyzed by in situ hybridization (Fig. 1, D and E, H, and J). At P7, v-KIND mRNA expression levels were generally low throughout the brain, but high in hippocampus, thalamus, and the cerebellar white matter (Fig. 1 D). At P21, v-KIND mRNA was detected in nearly all fields at varying intensities (Fig. 1 E): it was predominantly localized in the cerebellum, and was observed at intermediate levels in the hippocampus and thalamus (Fig. 1 E). In the cerebellum, v-KIND mRNA was concentrated in the internal granular layer (IGL) and expression was higher in the anterior lobe than in the posterior lobe (Fig. 1 H). v-KIND mRNA was predominantly observed in granule cells, and was expressed in cells within the white matter (Fig. 1 J). These developmentally regulated and region-specific expression patterns suggest that v-KIND is responsible for specific developmental events in postnatal mouse brain.
Distribution of v-KIND protein in P21 mouse brain
We investigated v-KIND protein expression in developing mouse brains using an antibody that specifically recognizes v-KIND protein. The specificity of the antibody is shown in Fig. S1 (available at http://www.jcb.org/cgi/content/full/jcb.200702036/DC1). The v-KIND protein level was greatly increased by P21 (Fig. 1 F), which almost paralleled the mRNA expression pattern (Fig. 1 C). Subcellular fractionation analysis of P7 and P21 mouse cerebella shows that v-KIND protein is a soluble protein but appears to associate with precipitable components, such as cell membranes or cytoskeletal elements (Fig. S1 B).
The cellular distribution of v-KIND protein in mouse brain was analyzed using immunohistochemistry (Fig. 1, G, I, and K–N). Widespread immunolabeling patterns of v-KIND were observed in the P21 mouse brain (Fig. 1 G). Intense immunolabeling signals were detected in the IGL of the cerebellum (Fig. 1 I) and moderate immunolabeling signals were observed in the hippocampus (Fig. 1 M), which was consistent with the Western blotting data, showing that v-KIND is more abundant in cerebella than hippocampus (Fig. S1 C). In the cerebellum, there was more v-KIND protein in the anterior lobe than in the posterior lobe (Fig. 1 I), which was similar to the mRNA distribution pattern (Fig. 1 H). In the IGL, v-KIND protein was predominantly observed around the periphery of the granule cells and in the glomerular rosette areas, indicating that v-KIND protein expressed in granule cells is largely localized in the somatodendritic region (Fig. 1 L). In the hippocampus, v-KIND protein was distributed in the CA1-CA2-CA3 region (Fig. 1 M) and was localized in the soma and dendrites of CA1 pyramidal neurons (Fig. 1 N).
v-KIND has GEF activity for Ras and binds to activated Ras
To investigate the function of the RasGEF domain of v-KIND, we analyzed the interaction between v-KIND and Ras. v-KIND coimmunoprecipitated with Ras from cerebellar lysates (Fig. 2 A).
This interaction was verified by an exogenous expression system in COS7 cells (Fig. 2 B). The expressed FLAG-tagged v-KIND was coimmunoprecipitated with endogenous Ras by the anti-Ras antibody, whereas the mutant lacking the RasGEF domain (
GEF), failed to be precipitated. These results suggest that v-KIND is associated with Ras through the RasGEF domain.
|
The RasGEF domain has binding affinity for both Ras-GDP and Ras-GTP (Cherfils and Chardin, 1999). We investigated the binding of v-KIND to Ras in hippocampal lysates in the presence of either GDP-ß-S or GTP-
-S (Fig. 2 D). In general, GDP-ß-S inhibits the production of Ras-GTP, whereas GTP-
-S activates it (Taylor et al., 2001). The quantity of Ras-GTP was measured by Raf-1 RBD pull-down assay. As expected, the immunoreactivity for Ras-GTP pulled-down by the Raf-1 RBD was higher in the presence of GTP-
-S than in the presence of GDP-ß-S (Fig. 2 D, bottom). In addition, the presence of GTP-
-S increased the amount of v-KIND coimmunoprecipitated with anti-Ras antibody in comparison with that of GDP-ß-S (Fig. 2 D, top), indicating that v-KIND binds to both Ras-GDP and Ras-GTP, but binds more preferentially to Ras-GTP.
We compared the binding specificity of v-KIND and
GEF to H-Ras by the Raf-1 RBD pull-down assay. v-KIND together with H-Ras was pulled down by Raf-1 RBD from lysates of COS7 cells coexpressing H-Ras and v-KIND, whereas
GEF was not pulled down by Raf-1 RBD from lysates of cells coexpressing H-Ras and
GEF (Fig. 2 E). These results suggest that the RasGEF domain of v-KIND has RasGEF activity and a major region responsible for the interaction with the activated Ras.
We verified the in vivo association of endogenous v-KIND and activated Ras in mouse hippocampal lysates (Fig. 2 F). In contrast to GST alone (as a negative control), GST-Raf-1 RBD pulled down v-KIND as well as Ras. Similarly, in contrast to control mouse IgG, the anti-Ras antibody coimmunoprecipitated v-KIND and Ras. Collectively, these results suggest that v-KIND acts as a RasGEF in mouse brain.
Localization of v-KIND in dendrites and soma of primary cultured neurons
Subcellular localization of v-KIND was analyzed by immunocytochemistry in primary cultured neurons. In cerebellar granule cells at 14 days in vitro (DIV), v-KIND was distributed prominently in the soma and punctately in dendrites as marked by anti-MAP2 antibodies (Fig. S1 D). Because the dendrites of hippocampal neurons are easier to visualize than the dendrites of cerebellar granule cells, we compared the expression patterns of v-KIND with those of MAP2 at various differentiation stages in hippocampal primary cultures (DIV3, 6, 10, 15, and 21). Immunoblotting analysis revealed that the expression level of v-KIND gradually increased and peaked at DIV15, which was similar to that of MAP2 (Fig. 3 A). Immunocytochemical analysis showed v-KIND immunoreactivity almost overlapped with MAP2 immunoreactivity in soma and dendrites and was not localized to axons throughout differentiation (Fig. 3 B).
Immunostaining patterns around the dendrite shafts differed between v-KIND and MAP2: v-KIND immunoreactivity appeared as many small puncta around the dendrites, although MAP2 immunoreactivity appeared very heavily and smoothly on the dendrites (Fig. 3 C). In DIV10 cultures, v-KIND immunoreactivity was also observed in the more distal tips of the dendrites, which were MAP2-negative, but F-actin positive (Fig. 3 D).
|
39% of cells with v-KIND overexpression vs
70% with EGFP alone; Fig. 4 B; P < 0.001) and significantly decreased total dendrite length per cell (378 ± 153 µm with v-KIND vs 999 ± 463 µm with EGFP alone; Fig. 4 C; P < 0.001). At DIV15, v-KIND–overexpressing cells had a few long, but less-branched dendrites and many short dendrites, whereas cells expressing EGFP alone had longer, branched dendrites (Fig. 4 A). Total dendrite length of individual v-KIND-overexpressing cell (599 ± 258 µm) was approximately two times shorter than that of cells expressing EGFP alone (1,156 ± 433 µm; Fig. 4 C). At DIV21, cells expressing EGFP alone had almost mature arborization patterns with complex and long branched dendrites, whereas cells overexpressing v-KIND had very simple dendritic arborization patterns with a few long and less-branched dendrites (Fig. 4 A). Total dendrite length of v-KIND-overexpressing cells (566 ± 216 µm) was less than that of cells expressing EGFP alone (1753 ± 421 µm; Fig. 4 C; P < 0.001). In addition, the number of dendritic branch tips per cell (branches with a distance from soma to tips longer than 20 µm were counted) was reduced by v-KIND overexpression (11 ± 5) compared with expression of EGFP alone (17 ± 5; Fig. 4 D; P < 0.001). These results demonstrate that overexpression of v-KIND induces significant dendrite growth defects, including reduced elongation and branching.
|
|
v-KIND interacts with MAP2
To clarify the molecular mechanism underlying v-KIND-mediated control of dendrite growth, we analyzed v-KIND associated proteins by coimmunoprecipitation from brain lysates with anti- v-KIND antibody followed by MASS spectrometry analysis (Fig. 6 A). Silver staining after separating on sodium dodecyl sulfate-PAGE (SDS-PAGE) revealed a high molecular weight band of
280 kD specifically precipitated by anti-v-KIND antibody, but not by rabbit IgG. This band was identified as MAP2 by MASS spectrometry analysis (Fig. 6 A).
|
KIND1), the second KIND domain (
KIND2), RasN (
RasN), or RasGEF (
GEF). Anti-v-KIND antibody coimmunoprecipitated MAP2 coexpressed with v-KIND,
KIND1,
RasN, and
GEF, but not
KIND2 (Fig. 6 B). These results suggest that v-KIND interacts with MAP2 via the KIND2 domain. To further confirm the MAP2 binding region of v-KIND, we performed pull down assays from mouse brain lysates using GST fusion KIND1 and KIND2 proteins. Immunoblotting and silver staining analyses showed that GST-KIND2, but not GST-KIND1, pulled down endogenous brain MAP2 (Fig. 6 C, top). These results demonstrated that the KIND2 domain is responsible for interaction with MAP2. We analyzed changes in the interaction between v-KIND and MAP2 during mouse brain development by coimmunoprecipitation using anti-v-KIND and anti-MAP2 antibodies (Fig. 6 D; and Fig. S3, A and B, available at http://www.jcb.org/cgi/content/full/jcb.200702036/DC1). The quantity of v-KIND that coimmunoprecipitated with MAP2 peaked at P14, and the quantity of MAP2 that coimmunoprecipitated with v-KIND sharply increased at P14 and decreased at P21. Thus, the peak stage for the association between v-KIND and MAP2 appears to parallel the mid-late developmental stage of dendrite development. In fact, colocalization of v-KIND with MAP2 in P21 mouse cerebellum was also detected in the IGL and in neurons of the deep cerebellar nuclei (Fig. S3, C–K).
v-KIND enhances Thr phosphorylation of MAP2
MAP2 is one of the most phosphorylated proteins in neurons and its phosphorylation state correlates with dendrite development (Sanchez et al., 2000). We evaluated whether serine (Ser) and Thr phosphorylation levels of MAP2 expressed in COS7 cells were affected by coexpression of v-KIND. Phosphorylated MAP2 was detected by immunoprecipitation with anti-MAP2 antibody followed by immunoblotting with anti-phospho-Ser and anti–phospho-Thr (p-Thr) antibody (Fig. 6 E). Ser phosphorylation in MAP2 did not change significantly (unpublished data). In contrast, v-KIND coexpression increased p-Thr immunoreactivity of MAP2 (Fig. 6 E, top), which was confirmed by statistical analysis of quantified immunoreactive band intensity (Fig. 6 F, P < 0.05). These results suggested that coexpressed v-KIND enhances Thr phosphorylation of MAP2.
Many protein kinases phosphorylate MAP2 during brain development (Sanchez et al., 2000). ERK and JNK-1, downstream kinases of Ras signaling pathways, are involved in Thr phosphorylation of MAP2 (Holzer et al., 2001; Bjorkblom et al., 2005). We investigated the effects of the ERK1/2 inhibitor U0126 (Favata et al., 1998) or the JNK-1 inhibitor SP600125 (Bennett et al., 2001) on v-KIND induced p-Thr immunoreactivity of MAP2 (Fig. 6 G). U0126 or SP600125 treatment reduced Thr phosphorylation levels of MAP2 augmented by v-KIND coexpression, suggesting that JNK-1 and ERK, downstream targets of Ras signaling, are involved in the v-KIND–mediated MAP2 phosphorylation.
v-KIND is anchored to MAP2 through the KIND2 domain
To study the protein structure and functional relationships of v-KIND in dendrite growth, we expressed various FLAG-tagged v-KIND constructs (v-KIND,
KIND1,
KIND2,
RasN,
GEF, KIND1 domain, and KIND2 domain) in hippocampal cells and immunocytochemically analyzed by anti-FLAG antibody (Fig. 7).
Overexpressed v-KIND was mainly distributed in the soma and dendrite shafts where MAP2 was concentrated (Fig. 7, A and C). Similar to v-KIND,
KIND1,
RasN, and
GEF were also concentrated in the soma and dendritic shafts (Fig. 7 C). In contrast,
KIND2 was ubiquitously localized in the soma, dendrites shafts, spines, and axons (Fig. 7, B and C). Overexpressed KIND1 domain was widespread in dendrites and dendritic protrusions, including spines (Fig. 7, D and F), whereas overexpressed KIND2 domain had a similar localization as v-KIND, and was mainly localized in dendritic shafts, but not in spines (Fig. 7, E and G). Because KIND2 strongly binds with MAP2 (Fig. 6 B), these results indicate that v-KIND is anchored to MTs via the KIND2 domain.
|
|
|
| Discussion |
|---|
|
|
|---|
v-KIND links signaling of activated Ras to MAP2
v-KIND was first reported as a novel brain-specific RasGEF (Mees et al., 2005). In the present study, v-KIND bound to and activated Ras in mouse brain lysates through the C-terminal RasGEF domain, indicating that v-KIND certainly acts as a brain RasGEF. Within the GEF family, v-KIND is unique to have two KIND domains at the N-terminal region. The KIND domain is a recently identified protein domain whose functional properties remain yet unclear (Ciccarelli et al., 2003). Our results demonstrated that the KIND2 domain is functionally distinct from the KIND1 domain and specifically interacts with MAP2 in in vitro expression systems and in vivo brain lysates. In addition, overexpressed KIND2 was concentrated in dendritic shafts of neurons and largely colocalized with MAP2. These results suggest that v-KIND is anchored to the dendrites through the interaction between the KIND2 domain and MAP2.
MAP2 contains a number of Ser and Thr residues that are highly conserved in mouse, rat, and human, and many of these residues are highly phosphorylated in vivo (Sanchez et al., 2000). Both ERK and JNK-1 are downstream molecules of the Ras signaling pathways and are involved in Thr phosphorylation of MAP2 (Holzer et al., 2001; Bjorkblom et al., 2005). Our results showed that v-KIND induced MAP2 Thr phosphorylation, which was blocked by inhibitors of ERK or JNK-1. These results suggest that v-KIND links the Ras signaling cascades, including downstream signaling via ERK or JNK1, to MAP2 phosphorylation.
v-KIND controls dendrite growth
The v-KIND overexpression and RNAi knockdown experiments suggested important roles of v-KIND in controlling dendrite growth, although the underlying molecular mechanism remains elusive. One possibility might be the physical and functional association between v-KIND and MAP2, that is, v-KIND-MAP2 interaction and v-KIND-induced MAP2 Thr phosphorylation. During dendrite development, normal MT structures are required for both dendritic elongation at early stages and dendritic maturation at later stages. MAP2 phosphorylation levels are developmentally controlled along with dendrite growth (Riederer et al., 1995; Quinlan and Halpain, 1996). Increased phosphorylation of MAP2 causes MAP2 to detach from MTs, resulting in decreased MT stability and attenuated actin-bundling activity (Jameson and Caplow, 1981; Murthy and Flavin, 1983; Selden and Pollard, 1983; Hoshi et al., 1992; Sanchez et al., 2000). Our results showed that v-KIND overexpression promotes MAP2 Thr phosphorylation and causes impaired dendrite growth, whereas v-KIND RNAi knockdown reduces MAP2 Thr phosphorylation and induces increased dendrite growth. Moreover, we showed that the MAP2-binding domain KIND2 alone acts as a dominant negative and its overexpression eventually increases dendrite length and complexity. These data suggest a possibility that v-KIND functions through controlling of MAP2 phosphorylation levels during dendrite development.
The present study showed that v-KIND might associate with other cytoskeletal element(s) via the KIND1 domain except for the interaction with MAP2 via the KIND2 domain. In this regard, it is notable that overexpression of the construct containing both KIND domains (KIND1+2) induced more branching and longer dendritic patterns than that of the KIND2 domain alone. Moreover, although v-KIND prominently colocalized with MAP2 in dendritic shafts, it was also observed in dendritic terminals where it partially colocalized with F-actin in developing hippocampal neurons. Altogether, these results suggest that apart from MAP2, other binding partner(s) may also cooperate with v-KIND in controlling complex dendrite development.
Functional role of v-KIND in cerebellar development
Dendrite growth and complexity appear to be regulated by a combination of positively and negatively acting factors in dendrite growth (Scott and Luo, 2001). Hippocampal neurons and cerebellar granule cells have different complexities in dendritic patterns, and hippocampal neurons have much longer and more complicated dendrite patterns than cerebellar granule cells. Cerebellar granule cells possess very short, claw-like dendrites around the mossy fiber terminals within the glomerular rosettes. These dendrites not only make excitatory synapses with large mossy terminals, but also form inhibitory synapses with Golgi cell axon terminals within the synaptic glomeruli (Ito, 1997). Moreover, in addition to synaptic contacts, these dendrites form numerous dendrodendritic attachment plaques or puncta adherentia in glomeruli. Whether the differences in the dendrite complexity between hippocampal neurons and cerebellar granule cells are, at least in part, caused by differential levels of protein expression is not known.
We initially isolated v-KIND as a gene predominantly expressed in cerebellar granule cells of the IGL during mid-late developmental stages of postnatal mouse brain. v-KIND immunoreactivity was enriched in the somatodendritic regions of granule cells and especially the glomeruli. Moreover, we demonstrated that v-KIND overexpression suppresses the dendrite growth of cerebellar granule cells, whereas v-KIND knockdown promotes it. Thus, we suggest that v-KIND acts as a signaling molecule in controlling or limiting dendrite growth to form short but unique structures that extend within very narrow spaces and are surrounded by densely packed granule cell soma in the IGL during the mid-late developmental period. Slight differences observed in the extent of the effects of v-KIND overexpression and knockdown between cerebellar granule cells and hippocampal neurons might be due to differences in the expression levels of v-KIND, which negatively controls dendrite growth, as well as any positively acting factors in dendrite growth in these two cell-types.
| Materials and methods |
|---|
|
|
|---|
In situ hybridization
In situ hybridization (ISH) brain histochemistry was basically performed as described previously (Huang et al., 2006). The cDNA sequence corresponding to nucleotide positions 1962 to 2561 (a.a 654–857) of the v-KIND cDNA was used as a template to prepare the digoxigenin-labeled antisense riboprobes using a digoxigenin-dUTP labeling kit (Roche Diagnostics). Paraffin sections of mouse brain (10 µm thick) were fixed in 4% paraformaldehyde for 5 min, washed twice in phosphate buffered saline (PBS), and treated with freshly prepared 10 µg/ml proteinase K (Invitrogen) at room temperature. After acetylation, the sections were subjected to digoxigenin-based hybridization procedures. In brief, the sections were incubated in hybridization buffer containing 0.2 µg/ml digoxigenin-labeled riboprobes at 60°C overnight in a humid chamber. The hybridized sections were washed by successive immersion in 1 x SSC (150 mM NaCl and 15 mM sodium citrate, pH 7.0; 60°C, 10 min, twice), 2 x SSC (37°C, 10 min), 2 x SSC containing 20 µg/ml RNase A (37°C, 30 min), 2 x SSC (37°C, 10 min), and 0.2 x SSC (60°C, 30 min, twice). The hybridization signals were detected using a digoxigenin detection kit (Roche Diagnostics). ISH images (Fig. 1) were captured with a microscope (Olympus BX51) equipped with a 2x/NA 0.08 (PlanApo) or 20x/NA 0.7 (UPlanApo) objective and a charged-coupled device camera (ProgRes C14; JENOPTIK) and processed with Photoshop (Adobe).
Cell culture
COS-7 cells were grown in culture dishes in DME/10% fetal bovine serum at 37°C and 10% CO2 in a humidified incubator. Hippocampal dissociated primary cultures were prepared from embryonic day 17 Wistar rats (Nippon SLC) as described previously (Shiraishi et al., 2003). In brief, excised hippocampi were treated with 45 U papain (Worthington), 0.01% DNase I (Boehringer-Mannheim), 0.02% DL-cystein, 0.02% bovine serum albumin, and 0.5% glucose in PBS for 20 min at 37°C. After adding 20% bovine serum, cells were dissociated by repeatedly passing them through a 1 ml plastic pipette tip. Dispersed cells were plated at a density of 1.104 cells/cm2 onto poly-L-lysine-coated (Sigma-Aldrich) glass coverslips (Matsunami) in neurobasal medium (GIBCO BRL, Life Technologies) containing 2% B27 supplement (Invitrogen), 500 µM L-glutamine, 0.1 mg/ml streptomycin (Meiji), and 100 U/ml penicillin (Banyu, Tokyo, Japan). Cultures were maintained in a humidified atmosphere of 5% CO2 in air at 37°C.
Antibodies
Antibodies against mouse v-KIND were generated by immunizing rabbits with a synthetic peptide, CEKHSRKIQDKLRRMKATFQ (aa1724–1742), after conjugation with keyhole limpet hemocyanin. Affinity purification of the antibody was performed using a HiTrap NHS-High Performance column (Amersham Biosciences). The antibody was used at a dilution of 1:2000 for immunoblotting and 1:1,000 for immunohistochemistry and immunocytochemistry. Antibodies against MAP2a/b (M1406) and MAP2 (M4403) were obtained from Sigma-Aldrich; the antibody against GFP (SC-9996) was from Santa Cruz Biotechnology, Inc.; the anti-p-Thr antibody (#9381) was from Cell Signaling Technology; and the antibody against FLAG (F3165) was from Sigma-Aldrich. All antibodies were used at a dilution of 1:1,000 in immunoblotting and 1:200 in immunohistochemistry and immunocytochemistry.
Plasmid construction
Mouse v-KIND was isolated by PCR from mouse cerebellum and cloned into a pCAG vector with a FLAG-tag (a gift from Dr. Junichi Miyazaki, Div. Stem Cell Regulation Research, Osaka University Graduate School of Medicine, Osaka, Japan). v-KIND mutants were prepared by PCR-based methods and inserted into pCAG vectors with a FLAG-tag. H-Ras cDNA was isolated by PCR from mouse cerebellum and cloned into a pCAG vector with a HA-tag. HMW MAP2 cDNA was a gift from Dr. N. Cowan (NYU Medical Center, New York, NY) and was constructed by PCR-based methods and cloned into pCAG vector with a HA-tag. KIND1 and KIND2 domain fragments were prepared by PCR-based methods, and were inserted into pGEX-4T-2.
Transfection and data analysis
COS-7 cells were transfected by Lipofectamine 2000 reagent (Invitrogen) 24 h after plating at a density of 2.0 x 105 cells/cm2. After an additional 6 h of incubation, cells were washed and cultured in DME/10% fetal bovine serum for 2 d. Hippocampal neurons were transfected by the Ca2+-phosphate-mediated method with some modification (Haubensak et al., 1998; Kohrmann et al., 1999). For 105 cells plating on each coverslip, 2 µg of plasmid was dissolved in 10 µl 250 mM CaCl2, mixed with 10 ml 2xBBS (280 mM NaCl, 1.5 mM Na2HPO4, 50 mM BES, pH 7.1), and added to 400 µl of the fresh culture medium. After incubation for 1 to 2 h at 37°C with 2.5% CO2, cells were washed with HBSS and cultured in conditioned medium. The calcium phosphate method using a CellPhect Transfection kit (Amersham Biosciences) was used to transfect cerebellar neurons on DIV1 in serum-free defined medium on poly- L-lysine-coated glass coverslips. To quantify the percentage of cells with elongated dendrites at DIV11, 20 fields were randomly selected from three independent experiments with v-KIND or KIND2 overexpression based on healthy morphology, then analyzed by counting the number of cells with dendrites that were longer than 20 µm. To quantify dendritic length and arbor numbers in neurons overexpressing v-KIND protein or KIND2 domain, dendritic length and the number of arbors of neurons randomly selected from three independent experiments (15 fields total) were measured. Results are presented as the mean ± SD and were analyzed with t test using the Excel 2003 software program. P values less than 0.05 were considered significant.
RNAi
Three types of v-KIND stealth RNAi were obtained from Invitrogen. Their sense sequences were as follows: CAUCCAGGAGGAAUUUGCCUUUGAU (control sequence CAUGGAGGAUAAGUUUCCUUCCGAU), GAGCAGCUGCUAAAGAACCUCUUCA (control sequence GAGGUCGAAUCAAGACUCCUACUCA), and GAGACGGGAGGUUUCACCAUGACUA (control sequence GAGGGAGGAUUUCACUACAGACCUA). These RNAi were transfected into COS cells using the Lipofectamine 2000 reagent according to the manufacture's directions (Invitrogen), and into hippocampal neurons together by pCAG-EGFP by Ca2+ phosphate precipitation at a concentration of 50 nM as described above. For immunoblotting experiments, RNAi was transfected into cerebellar granule cells soon after dissociation using the Mouse Neuron Nucleofector kit and the Nucleofector device as previously described (Amaxa) (Huang et al., 2002; Liu et al., 2003).
Immunohistochemistry and immunocytochemistry
ICR mice were anesthetized with diethyl ether and transcardially perfused with 4% paraformaldehyde in PBS. The excised brains were immersed for 2 h in the same fixative and cryosectioned (20 µm thick). For immunohistochemistry (IHC), fixed brain sections were preincubated with 5% normal goat serum in PBS containing 0.03% Triton X-100 for 1 h and then incubated with primary antibody overnight at 4°C. After washing with PBS, immunodetection was performed using horseradish peroxidase-conjugated secondary antibody (1:500) and diaminobenzidine. IHC images (Fig. 1) were captured with a microscope (Olympus BX51) equipped with a 2x/NA 0.08 (PlanApo) or 20x/NA 0.7 (UPlanApo) objective and a charged-coupled device camera (ProgRes C14; JENOPTIK). The acquired images were processed with Photoshop (Adobe). For immunocytochemistry, cultured cells were fixed with 4% paraformaldehyde with 4% sucrose, permeabilized in 0.2% Triton X-100 in PBS for 5 min at room temperature, preincubated with 5% normal donkey serum in PBS for 1 h, and then incubated with each affinity-purified antibody for 16 h at 4°C. Multiple staining was performed using combinations of rabbit anti-v-KIND antibody (1:1,000), mouse anti-MAP2 antibody (1:200; Sigma-Aldrich), mouse anti-Flag antibody (1:200; Sigma-Aldrich), and Alexa 647-phallotoxin (1:50; AlexaFluor 647 phalloidin; Invitrogen). For fluorescent immunostaining, cells were then incubated with AlexaFluor 488-, 555-, or 647-conjugated secondary antibody (Invitrogen) in 5% donkey serum/PBS for 1 h at room temperature. Immunofluorescent images were captured with a confocal microscope (LSM 510 META; Carl Zeiss MicroImaging, Inc.) equipped with a 20x/NA 0.50 (Plan-NEO FLUAR), 40x/NA 0.75 (Plan-NEO FLUAR), or 100x/NA 1.4 oil iris (Plan-APO CHROMAT) objective lens (20x, Fig. 8; 40x, Figs. 4, 5, and 7; 100x, Figs. 3 and 9) and LSM 510 META software (Carl Zeiss MicroImaging, Inc). The acquired images were processed with Photoshop (Adobe).
Protein extraction, immunoprecipitation, and immunoblotting
Protein extraction and Western blotting analysis were performed as described previously (Huang et al., 2006). In brief, COS cells or mouse cerebella were lysed and homogenized in 1% Triton X-100 buffer (50 mM Hepes, 150 mM NaCl, 10% glycerol, 1% Triton X-100, 1.5 mM MgCl2, 1 mM EGTA, 100 mM NaF, 1 mM Na3VO4, 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 1 mM phenylmethylsulfonylfluoride). The subcellular fractionation of the P7 and P21 mouse cerebella was performed as described previously (Huang et al., 2006). In brief, the P7 and P21 mouse cerebella were first homogenized in homogenization buffer (0.32 M sucrose, 5 mM Tris·HCl, 1 mM EGTA, 1 mM dithiothreitol, 1mM pepstatin A, 1mM leupeptin, and 1mM Na3VO4). The protein lysates were centrifuged at 1,000 g for 10 min, the pellet was lysed in 1% Triton X-100 buffer (PPt1), and the supernatant was centrifuged at 105,000 g for 1 h. The pellet was lysed in 1% Triton X-100 buffer (PPt2+3), and the supernatant was used as Sup3. For immunoprecipitation, after centrifuging at 1,000 g for 10 min, protein solutions (containing
1 mg protein) were mixed with the primary antibody and incubated for 1 h on ice. The mixtures were rotated with Protein A sepharose or Protein G sepharose (Amersham Biosciences) for 1 h at 4°C. The sepharose was washed four times with 1% Triton X-100 buffer. After boiling in sample buffer (0.4 M Tris-HCl, pH 6.8, 8% SDS, 40% glycerol, and 0.04% bromophenol blue) for 5 min, equal portions of protein solution were separated by SDS-PAGE and probed with diluted primary and horseradish peroxidase-conjugated secondary antibodies (1:2,000). Silver staining was performed using the silver staining kit according to the manufacturer's instructions (Daiichi Pure Chemicals Co.). The GST fusion protein pull-down assay was performed as follows. Escherichia coli expressing GST fusion proteins were lysed with lysis buffer (50 mM Tris-HCl, pH 7.4, 25% sucrose, 1% Triton X-100, 5 mM MgCl2), and the cell extracts containing
10 µg GST-fusion proteins were coupled to glutathione- sepharose (Amersham Biosciences) by rotating for 1 h at 4°C. After washing three times with 1% Triton-X/PBS, the sepharose was coupled to cerebellar protein lysates, which had been precleared with glutathione-sepharose for 1 h at 4°C. After rotating for 1 h at 4°C, the GST-fusion protein complex was washed 5 times with cell lysis buffer and subjected to SDS-PAGE and immunoblotting. In GTP-
-S and GDP-ß-S treatment, protein lysates were treated with 0.1 mM GTP-
-S (Sigma Chemical Co.) or 1.0 mM GDP-ß-S (Sigma-Aldrich) in the presence of 10 mM EDTA, pH 8.0 at 30°C for 15 min (to activate or inactivate Ras). Then the GST pull-down assay was performed as described above. Quantitative analysis of immunoblotting band intensity was performed by Quantity-One software (Bio-Rad Laboratories). Relative intensity to the control was shown (% control). Values are mean ± SD. *, P < 0.05 as compared with the control.
Mass spectrometry
For identification of v-KIND interacting proteins, in-gel digestion was performed following Coomassie staining, bands corresponding to MAP2 were excised, and the gel pieces were destained with 50% CH3CN in 50 mM NH4HCO3 solution. After removing the supernatant, cysteine residues were reduced with dithiothreitol, carbamido methylated with iodoacetamide, and the proteins were digested with trypsin at 37°C overnight. The tryptic peptides were recovered by sequentially adding 50% CH3CN/1% trifluoroacetic acid, 20% HCOOH/25% CH3CN/15% i-PrOH, and 80% CH3CN solutions. The supernatants were collected and pooled into one tube, and the volume was reduced in vacuo. The dried tryptic peptides were suspended in 2% CH3CN/0.1% trifluoroacetic acid and applied to the following liquid chromatography-tandem mass spectroscopy system. Chromatographic separation was accomplished with the MAGIC 2002 HPLC system (Michrom BioResources, Inc.). Peptide samples were loaded onto a Cadenza C18 custom-packed column (0.2 x 50 mm, Michrom BioResources, Inc.), and eluted using a linear gradient of 5% to 60% CH3CN in 0.1% HCOOH for 30 min with a flow of 1 ml/min. Samples were ionized with the Nanoflow-liquid chromatography electrospray ionization, and tandem mass spectrometry data were obtained with an LCQ-Deca XP ion trap mass spectrometer (Thermo Electron Corp.). The Mascot database searching software (Matrix Science Inc.) was used for the identification of acetylated proteins.
Online supplemental material
Fig. S1: subcellular distribution of v-KIND in mouse cerebellum. Fig. S2: three oligonucleotide Stealth v-KIND RNAi efficiently knocked down exogenously expressed v-KIND in COS7 cells. Fig. S3: association of v-KIND with MAP2. (A-B), Coimmunoprecipitation of v-KIND and MAP2 from brain lysate. Fig. S4: FLAG-tagged v-KIND protein and the mutant overexpressed in hippocampal neurons. Fig. S5. v-KIND links Ras signaling to MTs. v-KIND is anchored to the dendritic shaft through the KIND2 domain by its MAP2 binding affinity. Online supplemental material is available at http://www.jcb.org/cgi/content/full/jcb.200702036/DC1.
| Acknowledgments |
|---|
Submitted: 6 February 2007
Accepted: 10 October 2007
| References |
|---|
|
|
|---|
Alonso, M., J.H. Medina, and L. Pozzo-Miller. 2004. ERK1/2 activation is necessary for BDNF to increase dendritic spine density in hippocampal CA1 pyramidal neurons. Learn. Mem. 11:172–178.
Bennett, B.L., D.T. Sasaki, B.W. Murray, E.C. O'Leary, S.T. Sakata, W. Xu, J.C. Leisten, A. Motiwala, S. Pierce, Y. Satoh, et al. 2001. SP600125, an anthrapyrazolone inhibitor of Jun N-terminal kinase. Proc. Natl. Acad. Sci. USA. 98:13681–13686.
Bernhardt, R., and A. Matus. 1984. Light and electron microscopic studies of the distribution of microtubule-associated protein 2 in rat brain: a difference between dendritic and axonal cytoskeletons. J. Comp. Neurol. 226:203–221.[CrossRef][Medline]
Bjorkblom, B., N. Ostman, V. Hongisto, V. Komarovski, J.J. Filen, T.A. Nyman, T. Kallunki, M.J. Courtney, and E.T. Coffey. 2005. Constitutively active cytoplasmic c-Jun N-terminal kinase 1 is a dominant regulator of dendritic architecture: role of microtubule-associated protein 2 as an effector. J. Neurosci. 25:6350–6361.
Cherfils, J., and P. Chardin. 1999. GEFs: structural basis for their activation of small GTP-binding proteins. Trends Biochem. Sci. 24:306–311.[CrossRef][Medline]
Ciccarelli, F.D., P. Bork, and E. Kerkhoff. 2003. The KIND module: a putative signalling domain evolved from the C lobe of the protein kinase fold. Trends Biochem. Sci. 28:349–352.[CrossRef][Medline]
Cline, H.T. 2001. Dendritic arbor development and synaptogenesis. Curr. Opin. Neurobiol. 11:118–126.[CrossRef][Medline]
Dotti, C.G., C.A. Sullivan, and G.A. Banker. 1988. The establishment of polarity by hippocampal neurons in culture. J. Neurosci. 8:1454–1468.[Abstract]
Favata, M.F., K.Y. Horiuchi, E.J. Manos, A.J. Daulerio, D.A. Stradley, W.S. Feeser, D.E. Van Dyk, W.J. Pitts, R.A. Earl, F. Hobbs, et al. 1998. Identification of a novel inhibitor of mitogen-activated protein kinase kinase. J. Biol. Chem. 273:18623–18632.
Friedrich, P., and A. Aszodi. 1991. MAP2: a sensitive cross-linker and adjustable spacer in dendritic architecture. FEBS Lett. 295:5–9.[CrossRef][Medline]
Gao, F.B., and B.A. Bogert. 2003. Genetic control of dendritic morphogenesis in Drosophila. Trends Neurosci. 26:262–268.[CrossRef][Medline]
Goi, T., G. Rusanescu, T. Urano, and L.A. Feig. 1999. Ral-specific guanine nucleotide exchange factor activity opposes other Ras effectors in PC12 cells by inhibiting neurite outgrowth. Mol. Cell. Biol. 19:1731–1741.
Goldin, M., and M. Segal. 2003. Protein kinase C and ERK involvement in dendritic spine plasticity in cultured rodent hippocampal neurons. Eur. J. Neurosci. 17:2529–2539.[CrossRef][Medline]
Harada, A., J. Teng, Y. Takei, K. Oguchi, and N. Hirokawa. 2002. MAP2 is required for dendrite elongation, PKA anchoring in dendrites, and proper PKA signal transduction. J. Cell Biol. 158:541–549.
Haubensak, W., F. Narz, R. Heumann, and V. Lessmann. 1998. BDNF-GFP containing secretory granules are localized in the vicinity of synaptic junctions of cultured cortical neurons. J. Cell Sci. 111:1483–1493.[Abstract]
Hirokawa, N., S. Hisanaga, and Y. Shiomura. 1988. MAP2 is a component of crossbridges between microtubules and neurofilaments in the neuronal cytoskeleton: quick-freeze, deep-etch immunoelectron microscopy and reconstitution studies. J. Neurosci. 8:2769–2779.[Abstract]
Holzer, M., U. Gartner, F.J. Klinz, F. Narz, R. Heumann, and T. Arendt. 2001. Activation of mitogen-activated protein kinase cascade and phosphorylation of cytoskeletal proteins after neurone-specific activation of p21ras. I. Mitogen-activated protein kinase cascade. Neuroscience. 105:1031–1040.[CrossRef][Medline]
Hoshi, M., K. Ohta, Y. Gotoh, A. Mori, H. Murofushi, H. Sakai, and E. Nishida. 1992. Mitogen-activated-protein-kinase-catalyzed phosphorylation of microtubule-associated proteins, microtubule-associated protein 2 and microtubule-associated protein 4, induces an alteration in their function. Eur. J. Biochem. 203:43–52.[Medline]
Huang, J., H. Hamasaki, T. Nakamoto, H. Honda, H. Hirai, M. Saito, T. Takato, and R. Sakai. 2002. Differential regulation of cell migration, actin stress fiber organization, and cell transformation by functional domains of Crk-associated substrate. J. Biol. Chem. 277:27265–27272.
Huang, J., R. Sakai, and T. Furuichi. 2006. The docking protein Cas links tyrosine phosphorylation signaling to elongation of cerebellar granule cell axons. Mol. Biol. Cell. 17:3187–3196.
Ito, M. 1997. Cerebellar microcomplexes. Int. Rev. Neurobiol. 41:475–487.[Medline]
Jameson, L., and M. Caplow. 1981. Modification of microtubule steady-state dynamics by phosphorylation of the microtubule-associated proteins. Proc. Natl. Acad. Sci. USA. 78:3413–3417.
Jan, Y.N., and L.Y. Jan. 2003. The control of dendrite development. Neuron. 40:229–242.[CrossRef][Medline]
Jaworski, J., S. Spangler, D.P. Seeburg, C.C. Hoogenraad, and M. Sheng. 2005. Control of dendritic arborization by the phosphoinositide-3'-kinase-Akt-mammalian target of rapamycin pathway. J. Neurosci. 25:11300–11312.
Koh, Y.H., C. Ruiz-Canada, M. Gorczyca, and V. Budnik. 2002. The Ras1-mitogen- activated protein kinase signal transduction pathway regulates synaptic plasticity through fasciclin II-mediated cell adhesion. J. Neurosci. 22:2496–2504.
Kohrmann, M., W. Haubensak, I. Hemraj, C. Kaether, V.J. Lessmann, and M.A. Kiebler. 1999. Fast, convenient, and effective method to transiently transfect primary hippocampal neurons. J. Neurosci. Res. 58:831–835.[CrossRef][Medline]
Kumar, V., M.X. Zhang, M.W. Swank, J. Kunz, and G.Y. Wu. 2005. Regulation of dendritic morphogenesis by Ras-PI3K-Akt-mTOR and Ras-MAPK signaling pathways. J. Neurosci. 25:11288–11299.
Liu, J.J., J. Ding, A.S. Kowal, T. Nardine, E. Allen, J.D. Delcroix, C. Wu, W. Mobley, E. Fuchs, and Y. Yang. 2003. BPAG1n4 is essential for retrograde axonal transport in sensory neurons. J. Cell Biol. 163:223–229.
Luo, L. 2002. Actin cytoskeleton regulation in neuronal morphogenesis and structural plasticity. Annu. Rev. Cell Dev. Biol. 18:601–635.[CrossRef][Medline]
Mees, A., R. Rock, F.D. Ciccarelli, C.B. Leberfinger, J.M. Borawski, P. Bork, S. Wiese, M. Gessler, and E. Kerkhoff. 2005. Very-KIND is a novel nervous system specific guanine nucleotide exchange factor for Ras GTPases. Gene Expr Patterns. 6:79–85.[Medline]
Miller, F.D., and D.R. Kaplan. 2003. Signaling mechanisms underlying dendrite formation. Curr. Opin. Neurobiol. 13:391–398.[CrossRef][Medline]
Murthy, A.S., and M. Flavin. 1983. Microtubule assembly using the microtubule-associated protein MAP-2 prepared in defined states of phosphorylation with protein kinase and phosphatase. Eur. J. Biochem. 137:37–46.[Medline]
Quinlan, E.M., and S. Halpain. 1996. Emergence of activity-dependent, bidirectional control of microtubule-associated protein MAP2 phosphorylation during postnatal development. J. Neurosci. 16:7627–7637.
Redmond, L., and A. Ghosh. 2001. The role of Notch and Rho GTPase signaling in the control of dendritic development. Curr. Opin. Neurobiol. 11:111–117.[CrossRef][Medline]
Redmond, L., A.H. Kashani, and A. Ghosh. 2002. Calcium regulation of dendritic growth via CaM kinase IV and CREB-mediated transcription. Neuron. 34:999–1010.[CrossRef][Medline]
Riederer, B.M., E. Draberova, V. Viklicky, and P. Draber. 1995. Changes of MAP2 phosphorylation during brain development. J. Histochem. Cytochem. 43:1269–1284.[Abstract]
Sanchez, C., J. Diaz-Nido, and J. Avila. 2000. Phosphorylation of microtubule-associated protein 2 (MAP2) and its relevance for the regulation of the neuronal cytoskeleton function. Prog. Neurobiol. 61:133–168.[CrossRef][Medline]
Scott, E.K., and L. Luo. 2001. How do dendrites take their shape? Nat. Neurosci. 4:359–365.[CrossRef][Medline]
Selden, S.C., and T.D. Pollard. 1983. Phosphorylation of microtubule-associated proteins regulates their interaction with actin filaments. J. Biol. Chem. 258:7064–7071.
Shiomura, Y., and N. Hirokawa. 1987. Colocalization of microtubule-associated protein 1A and microtubule-associated protein 2 on neuronal microtubules in situ revealed with double-label immunoelectron microscopy. J. Cell Biol. 104:1575–1578.
Shiraishi, Y., A. Mizutani, K. Mikoshiba, and T. Furuichi. 2003. Coincidence in dendritic clustering and synaptic targeting of homer proteins and NMDA receptor complex proteins NR2B and PSD95 during development of cultured hippocampal neurons. Mol. Cell. Neurosci. 22:188–201.[CrossRef][Medline]
Taylor, S.J., R.J. Resnick, and D. Shalloway. 2001. Nonradioactive determination of Ras-GTP levels using activated ras interaction assay. Methods Enzymol. 333:333–342.[CrossRef][Medline]
Van Aelst, L., and H.T. Cline. 2004. Rho GTPases and activity-dependent dendrite development. Curr. Opin. Neurobiol. 14:297–304.[CrossRef][Medline]
Whitford, K.L., P. Dijkhuizen, F. Polleux, and A. Ghosh. 2002. Molecular control of cortical dendrite development. Annu. Rev. Neurosci. 25:127–149.[CrossRef][Medline]
Wu, G.Y., K. Deisseroth, and R.W. Tsien. 2001. Spaced stimuli stabilize MAPK pathway activation and its effects on dendritic morphology. Nat. Neurosci. 4:151–158.[CrossRef][Medline]
Yang, H., and R.R. Mattingly. 2006. The Ras-GRF1 exchange factor coordinates activation of H-Ras and Rac1 to control neuronal morphology. Mol. Biol. Cell. 17:2177–2189.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|