|
||
Article |
A molecular switch that controls cell spreading and retraction
Correspondence to Xiaoping Du: xdu{at}uic.edu
Integrin-dependent cell spreading and retraction are required for cell adhesion, migration, and proliferation, and thus are important in thrombosis, wound repair, immunity, and cancer development. It remains unknown how integrin outside-in signaling induces and controls these two opposite processes. This study reveals that calpain cleavage of integrin ß3 at Tyr759 switches the functional outcome of integrin signaling from cell spreading to retraction. Expression of a calpain cleavage–resistant ß3 mutant in Chinese hamster ovary cells causes defective clot retraction and RhoA-mediated retraction signaling but enhances cell spreading. Conversely, a calpain-cleaved form of ß3 fails to mediate cell spreading, but inhibition of the RhoA signaling pathway corrects this defect. Importantly, the calpain-cleaved ß3 fails to bind c-Src, which is required for integrin-induced cell spreading, and this requirement of ß3-associated c-Src results from its inhibition of RhoA-dependent contractile signals. Thus, calpain cleavage of ß3 at Tyr759 relieves c-Src–mediated RhoA inhibition, activating the RhoA pathway that confines cell spreading and causes cell retraction.
| Introduction |
|---|
|
|
|---|
Integrin signaling is bidirectional in that ligand binding function of integrins requires conformational change in the extracellular ligand binding domain induced by intracellular signals (inside-out signaling), and ligand binding transduces outside-in signals that mediate cellular responses (Hynes, 2002; Vinogradova et al., 2002; Ginsberg et al., 2005; Wegener et al., 2007). An early functional outcome of integrin outside-in signaling is cell spreading, which is characterized by the formation of filopodia and lamellipodia and represents the outward movement of cell membrane, polymerizing actin, and cytoskeletal complexes at the leading edge (Hall, 2005). Integrin signaling later induces cell retraction, which is the inward movement of the cell membrane and cytoskeletal complexes, often at the rear end of cells. Coordinated spreading and retraction allows cell migration and in blood platelets facilitates stable platelet adhesion, thrombus formation, and consolidation. It has been shown that small GTP binding proteins Rac and cdc42 are involved in signaling mechanisms of cell spreading and that RhoA-mediated signaling is important in cell retraction (Hall, 2005). However, it remains unclear how integrin signaling initiates and temporally regulates these two seemingly opposing cellular responses; this is a fundamental question in cell biology. In this study, we have discovered that calpain cleavage of ß3 at Tyr759 serves as a molecular switch that changes the outcome of the integrin outside-in signals from mediating cell spreading to promoting cell retraction. Furthermore, the switch from cell spreading to retraction is mediated by calpain cleavage of the c-Src binding site at the integrin C terminus, which relieves the c-Src–dependent inhibition of RhoA, and thus facilitates integrin-mediated, RhoA-dependent contractile signaling.
| Results |
|---|
|
|
|---|
IIb subunit. To determine whether the R760E mutant confers resistance to calpain-mediated proteolysis, lysates from cells expressing WT integrin
IIbß3 and the R760E mutant were incubated with or without purified µ-calpain and immunoblotted with Ab762, an antibody recognizing the intact ß3 C-terminal TYRGT762 sequence, or Ab759, an antibody that recognizes the ß3 TNITY759 sequence only when ß3 is cleaved by calpain at Y759 (Du et al., 1995; Xi et al., 2003). The specificities of these antibodies have been previously characterized in Du et al. (1995) and Xi et al. (2003). In particular, we have shown that the calpain cleavage–specific antibody Ab759 only reacts with the ß3 that is truncated at the C-terminal side of Y759 and fails to recognize ß3 that is not cleaved (WT) or truncated at different sites, and that Ab762 reacts only with WT ß3 that is not cleaved and fails to react with ß3 cleaved at Y759 or other sites (Xi et al., 2003). MAb 15, recognizing the ß3 extracellular domain (which is not disturbed by calpain; Du et al., 1995), serves as loading control (Fig. 1 B). WT ß3 shows a large increase in reactivity with Ab759 after treatment with µ-calpain. This increase is mirrored by the loss of reactivity with Ab762, indicating loss of intact C terminus. In contrast, calpain- treated R760E mutant ß3 showed no decrease in Ab762 reaction and dramatically diminished reactivity with Ab759. The relatively low reactivity of Ab762 with the R760E mutant compared with WT ß3 is caused by R760 to E mutation but is not caused by reduced R760E expression, as indicated by the reaction with mAb 15. These results demonstrate that R760E mutation is calpain cleavage resistant (Fig. 1 B). Levels of stable surface expression of the R760E mutant and WT
IIbß3 were also analyzed by flow cytometry to ensure comparable expression after repeated cell sorting with an anti-
IIbß3 monoclonal antibody, D57 (Fig. 1 C). We showed previously that the ß3 cytoplasmic domain is cleaved by endogenous calpain in platelets and integrin-expressing CHO cells adherent to fibrinogen (Xi et al., 2003). To test whether R760E is resistant to endogenous calpain during cell adhesion, CHO cells containing either WT cells or R760E mutant ß3 were allowed to adhere and spread on immobilized fibrinogen and were subsequently immunolabeled with affinity-purified cleavage-specific antibody Ab759 to detect integrin cleavage and with mAb 15 to mark ß3. WT ß3 was cleaved by calpain (Fig. 1 D). In contrast, the R760E mutant showed marked reduction in calpain cleavage (Fig. 1 D). Thus, the R760E mutation renders ß3 resistant to cleavage by calpain in cells adherent to fibrinogen.
|
|
IIbß3 were allowed to adhere to fibrinogen, and spreading kinetics of these cells were observed (Fig. 3, A and B).
R760E mutation significantly enhanced and accelerated cell spreading compared with WT
IIbß3 (P < 0.0001), indicating that calpain cleavage of ß3 negatively regulates cell spreading. This result is consistent with the data that cells expressing a deletion mutant of ß3 mimicking calpain cleavage at Y759 (
759 cells) are defective in integrin-dependent cell spreading (Fig. 3 E). Thus, calpain cleavage of ß3 negatively regulates the integrin outside-in signals that promote cell spreading while it stimulates the integrin outside-in signaling that activates cellular retractile machinery.
|
759) were defective in spreading on fibrinogen, and this defect was completely corrected by the ROCK inhibitors (Fig. 3 E). Spreading of CHO cells expressing WT
IIbß3 was not significantly enhanced (P > 0.05) by low concentrations of ROCK inhibitors (Fig. 3, E and F). However, higher concentrations of either H-1152 or Y-27632 accelerate cell spreading in WT cells (Fig. 3, G and H). Interestingly, enhancement of spreading by cells expressing cleavage-resistant integrin mutant R760E was not observed even with higher-dose ROCK inhibition (Fig. 3, G and H), suggesting that the inhibitory effect of Rho-kinase signaling on cell spreading is already diminished when ß3 is resistant to calpain cleavage. These results suggest that cleavage of ß3 at Y759 caused activation of the RhoA-ROCK signaling pathway and cell retraction, thus preventing cell spreading.
Calpain cleavage of ß3 at Y759 induces RhoA activation
RhoA is activated by GTP binding and inactivated when bound GTP is hydrolyzed to GDP (Jaffe and Hall, 2003). The Rho binding domain (RBD) of the RhoA effector protein rhotekin specifically binds GTP-bound RhoA and can therefore be used to indicate RhoA activation (Ren and Schwartz, 2000). To determine whether calpain cleavage of ß3 stimulates RhoA activation, cells were allowed to spread on fibrinogen-coated surfaces, and then were fixed, permeabilized, and incubated with fluorescent GST-RBD fusion protein (GST-RBD-555). GST-RBD-555 strongly reacted with the WT integrin-expressing cells spreading on fibrinogen (Fig. 4).
GST-RBD-555 binding was specific because it was competitively inhibited by unlabeled GST-RBD (Fig. 4 A) and by preincubation of cells with cell-permeable C3 transferase (Fig. 5) but was unaffected in the presence of 20 mM glutathione (Fig. 4 A).
The specificity of GST-RBD-555 is further supported by its colocalization with the stain of a monoclonal antibody that recognizes RhoA (Fig. 4 B). Thus, by using this novel in situ RhoA activation assay, we show that RhoA is activated after WT integrin-mediated cell adhesion and spreading on fibrinogen. In contrast to WT ß3, cells expressing the calpain-resistant ß3 mutant R760E display reduced reactivity with GST-RBD-555, indicating that the resistance to calpain cleavage by R760E mutation and increased cell spreading in R760E cells are associated with inhibition of integrin-induced RhoA activation. Conversely,
759 cells, which are defective in spreading on fibrinogen, showed robust reactivity with GST-RBD-555, indicating that the calpain-cleaved form of ß3 induces RhoA activation without requiring cell spreading. Collectively, these data demonstrate that cleavage of ß3 at Y759 switches on the RhoA-ROCK signaling pathway, leading to cell retraction and inhibition of cell spreading.
|
|
759 (Fig. 6). These data are consistent with previous studies (Arias-Salgado et al., 2005a,b), indicating that cleavage of the ß3 C-terminal RGT sequence disrupts c-Src binding to ß3.
|
759 cells. More importantly, the inhibitory effect of PP2 was reversed by ROCK inhibitors H-1152 and Y-27632, indicating that the RhoA-ROCK–mediated retractile signaling is required for the inhibitory effect of this SFK inhibitor on cell spreading (Fig. 7, A and D), which is similar to the requirement for ROCK in ß3 cleavage–mediated inhibition of cell spreading. To exclude the possible nonspecific effect of pharmacological inhibitors, WT ß3-expressing cells were transfected with cDNA, encoding a dominant-negative mutant of c-Src (K295R/Y527F; Mukhopadhyay et al., 1995), and cotransfected with 1/6 quantity of GFP cDNA to indicate successful transfection. The control cells expressing transfected GFP exhibited normal cell spreading on fibrinogen (Fig. 7, B and E). In contrast, the cells transfected with the dominant-negative c-Src showed a defect in cell spreading similar to that caused by PP2 (Fig. 7, B and D). This inhibitory effect of the dominant-negative c-Src was reversed when cells were cotransfected with an equal concentration of dominant-negative RhoA (N19-RhoA; Fig. 7, B and D; Qiu et al., 1995). The data obtained with cDNA transfection is thus consistent with the data using inhibitors of SFK and ROCK, indicating that integrin-dependent cell spreading occurs independent of c-Src when RhoA-mediated retractile signaling is disabled. Because integrin-mediated c-Src activation inhibits RhoA but does not affect cdc42 and Rac functions (Arthur et al., 2000), our data indicate that c-Src promotes integrin-dependent cell spreading by its inhibition of RhoA-mediated retractile signals. Furthermore, the SFK inhibitor PP2 corrected the defective RhoA activation in calpain cleavage–resistant R760E cells, restoring RhoA activation and inhibiting the spreading of R760E cells (Fig. 7, C and F), which is similar to the phenotype observed in
759 cells expressing the calpain-cleaved form of ß3. These results indicate that without calpain cleavage of ß3, ß3-dependent c-Src activity inhibits RhoA activation and thus promotes cell spreading. Conversely, inhibition of SFK with PP2 dramatically enhanced clot retraction (Fig. 7 G), further demonstrating that SFK inhibits cell retractile machinery. Therefore, cleavage of ß3 at Y759 relieves the inhibitory effect of c-Src on RhoA activation, switches on RhoA-ROCK–dependent cell retraction, and thus changes the functional outcome of integrin signaling from cell spreading to cell retraction.
|
759) mutants of ß3. All three cell lines were similarly capable of inducing considerable c-Src phosphorylation at Y416 (an indicator of c-Src activation) when allowed to adhere and spread onto fibrinogen-coated surfaces (Fig. 8 A), suggesting that deletion of the c-Src binding site in ß3 did not affect the overall integrin-mediated c-Src activation.
Furthermore, if c-Src activity alone was sufficient to mediate the inhibition of RhoA, constitutively active c-Src would be able to induce integrin-mediated cell spreading. Thus,
759 cells were transfected with cDNA encoding a constitutively active mutant of c-Src (E378G) and cotransfected with 1/6 quantity of GFP cDNA to indicate successful transfection. Increased levels of total c-Src and expression of constitutively active c-Src (Y416 phosphorylated) in E378G c-Src–transfected
759 cells in suspension were verified by Western blot (Fig. 8 B). The E378G c-Src–transfected
759 cells are not different from the GFP-expressing control
759 cells in that both spread poorly on fibrinogen (Fig. 8, C and D). These data suggest that the inhibitory effect of ß3 cleavage on cell spreading is not because of its effect on overall c-Src activation but is associated with dissociation of c-Src (and therefore c-Src activity) from the ß3 cytoplasmic domain. Thus, only the ß3-associated c-Src activity is responsible for mediating RhoA inhibition and promoting cell spreading. Collectively, our results strongly suggest that cleavage of ß3 at Y759 dissociates c-Src from the ß3 C-terminal domain and thus relieves the inhibitory effect of ß3-associated c-Src on RhoA activation, stimulating the RhoA-ROCK retractile signals, which switches the functional outcome of integrin signaling from mediating cell spreading to promoting cell retraction.
|
| Discussion |
|---|
|
|
|---|
The data supporting our conclusions in this study are mainly obtained using the reconstituted integrin signaling model in CHO cells expressing WT and calpain cleavage–resistant or –mimicking mutants of ß3. Integrins play critical roles in all mammalian cells that adhere to extracellular matrix. Although different cell types express different members of the integrin family, integrin signaling, particularly outside-in signaling, is generally conserved in adherent cells, including CHO cells. In the past 20 yr, many important findings in ß3 integrin function and signaling have been discovered using the CHO cell model expressing the WT and mutant ß3 integrins, including the finding of the important role of talin in integrin activation (O'Toole et al., 1990; Calderwood et al., 1999; Tadokoro et al., 2003; Xi et al., 2003). Furthermore, the results obtained in CHO cells have been consistently verified in native ß3-expressing cells, such as platelets (Li et al., 2001, 2003a, 2006; Tadokoro et al., 2003; Zou et al., 2007), indicating the validity of the CHO cell model. Importantly, the data obtained in CHO cell models in this study are consistent with the role of calpain I in clot retraction and in ß3 cleavage as indicated in experiments using human and mouse platelets. Nevertheless, it is recognized that CHO cells are not totally identical to native ß3-expressing cells such as platelets, and thus the results obtained with the CHO cell model will need to be further verified in platelets and other ß3-expressing cells in the future.
We have previously shown that the cytoplasmic domain of ß3 is a calpain substrate and that the cleavage occurs mainly at Y759, removing the C-terminal RGT sequence (Du et al., 1995; Xi et al., 2003). However, although calpain is activated after calcium elevation is induced by ligand binding to the integrin, very little cleavage of ß3 occurs early during cell spreading because of the protection of integrin from calpain cleavage by tyrosine phosphorylation of the ß3 cytoplasmic domain, especially at the periphery of a cell (Xi et al., 2006). In contrast, at a later time during cell spreading when Y759 of ß3 becomes dephosphorylated, substantial ß3 cleavage occurs (Xi et al., 2006). Also, calpain cleavage of ß3 is readily detectable both during clot retraction in platelets and in the ß3-expressing CHO cells. The kinetics of integrin cleavage are consistent with our data, indicating a role for calpain in the transition between cell spreading and cell retraction in both CHO cells and in platelets. In fact, the data obtained with cells expressing the calpain-resistant and calpain cleavage–mimicking mutants clearly reveal that cleavage of ß3 at Y759 generates the change in integrin signaling from mediating cell spreading to promoting cell retraction. Thus, we have discovered a calpain-dependent molecular switch that is regulated temporally and topographically by tyrosine phosphorylation of ß3 and that controls the direction of membrane and cytoskeleton movement induced by integrin outside-in signaling. It is important to note that the cleavage-mimicking mutant of ß3 creates an experimental condition where 100% of ß3 cytoplasmic domain is cleaved at Y759, which serves to clearly reveal the cleavage-induced changes in functional outcome. In platelets, >22% of ß3 is cleaved at Y759 within an hour after platelet activation (Xi et al., 2003), which coincides with the occurrence of marked clot retraction. However, in more delicate situations, such as during cell spreading and migration, local and dynamic calpain activation signals are likely to cause localized cleavage of a small percentage of ß3 molecules and thus dynamically control the local movement of membranes and cytoskeleton.
The ß3 cleavage–mediated inhibition of cell spreading and promotion of cell retraction is not caused by its inhibition of cell spreading mechanisms but is mediated by the integrin cleavage-dependent activation of the RhoA retractile signaling pathway. Previous studies suggest that Rac and cdc42 play important roles in mediating cell spreading (filopodia and lamellipodia formation) and that RhoA is increasingly activated in spread cells (Hall, 2005). RhoA activates ROCK, which phosphorylates and inactivates myosin light chain phosphatase, and enhances myosin light chain phosphorylation and retractile function of the actomyosin complex (Giuliano et al., 1992; Amano et al., 1996; Kimura et al., 1996), inducing cell retraction. Cleavage of ß3 at Y759 inhibits integrin-mediated cell spreading (Fig. 3; Xi et al., 2003). If the inhibitory effects of ß3 cleavage on cell spreading should result from its inhibition of Rac- and cdc42-mediated cell spreading signaling, this inhibitory effect should not be corrected by inhibition of RhoA pathway. Therefore, our data that ß3 cleavage–dependent inhibition of cell spreading is corrected by ROCK inhibitors indicate that calpain cleavage of ß3 activates RhoA-dependent cell retraction, which subsequently inhibits the opposite movement of cell membrane resulting in inhibition of cell spreading.
Previous studies indicate that members of SFK are required for integrin-mediated signaling that leads to cell spreading (Shattil, 2005). The mechanism responsible for this role of SFK is not clear but is believed to be an early step in cell spreading signaling. However, we show that the inhibitory effect of an SFK inhibitor and a dominant-negative c-Src mutant on ß3-mediated cell spreading is reversed by inhibition of the RhoA signaling pathway, indicating that cell spreading is independent of c-Src when RhoA signaling is abrogated. These data therefore provide the first direct evidence that the role of SFK in promoting integrin-dependent cell spreading is not that it is required for cdc42- and Rac-dependent cell spreading signaling, but rather is its inhibition of RhoA-dependent retractile signaling and thus cell retraction, which confines the outward movement of the cell membrane and cytoskeleton. Our data are consistent with the previous studies, which show that SFK inhibits RhoA activity but has no effect on the activity of cdc42 and Rac (Arthur et al., 2000). Our data are also consistent with the finding that RhoA inactivation by p190RhoGAP promotes membrane protrusion and polarity (Arthur and Burridge, 2001). More importantly, we show that cleavage of ß3 at Y759 abolishes c-Src binding to ß3 but does not significantly affect overall c-Src activation in cells spread on fibrinogen, and that the RhoA-dependent inhibition of cell spreading by ß3 cleavage at Y759 is not reversed by expression of a constitutively active Src. These data suggest that whereas overall intracellular c-Src activation during cell adhesion does not require c-Src association with ß3, active c-Src molecules dissociated from ß3 are not capable of inhibiting the RhoA signaling pathway and promoting cell spreading on ß3 ligands, possibly because of the lack of ß3 scaffold. However, the calpain cleavage–resistant mutation in ß3 inhibits RhoA activation in a Src-dependent manner. Thus, our results suggest that only the ß3-associated c-Src is responsible for the inhibition of the RhoA pathway and facilitation of cell spreading. Conversely, our results suggest that calpain cleavage of ß3, which abolishes Src binding to ß3 (Fig. 6; Arias-Salgado et al., 2005b), relieves the inhibitory effects of ß3-associated c-Src on the RhoA pathway, activates RhoA, and thus switches the outcome of integrin signaling from cell spreading to retraction.
Interestingly, ß3 cleavage–dependent relief of c-Src– mediated RhoA inhibition and activation of RhoA-dependent cell retraction is associated with the cleavage of only a fraction of ß3 molecules (Fig. 2; Xi et al., 2003) and cannot be prevented by the presence of uncleaved ß3 molecules in the same cell. This apparently dominant effect of ß3 cleavage suggests that c-Src activity at one location in a cell does not cross-inhibit RhoA activation induced by calpain cleavage of ß3 at a different location and is consistent with the knowledge that spreading (such as filopodia and lamellipodia) and retraction can occur simultaneously at different locations within a cell (such as during cell migration). The requirement of c-Src association with ß3 for the c-Src–mediated RhoA inhibition provides a mechanism for the localized role of c-Src in promoting cell spreading. Further studies are required to understand how ß3-associated c-Src activity locally regulates RhoA and whether additional mechanisms are needed for RhoA activation when ß3 cleavage by calpain relieves the inhibitory effect of ß3-associated c-Src.
Based on data from this and other studies, we propose a new model of integrin signaling that incorporates a phosphorylation- and protease-mediated mechanism regulating integrin-mediated cell membrane movements. In this model (Fig. 9), initial integrin signaling activates protein tyrosine kinases, which induce phosphorylation of the cytoplasmic domain of ß3 (Law et al., 1996, 1999), and elevates intracellular calcium levels, which activate calpain (Fox et al., 1993). Tyrosine phosphorylation at Y759 of ß3 in the early phase of cell spreading protects the c-Src binding site in the C-terminal domain of ß3 from calpain cleavage (Xi et al., 2006). The interaction of c-Src with ß3 promotes activation of ß3-associated c-Src by a Csk- (Obergfell et al., 2002) and protein tyrosine phosphatase IB–dependent mechanism (Arias-Salgado et al., 2005a) and/or allows c-Src–dependent signaling in the vicinity of the ß3 C terminus, which facilitates cell spreading by inhibiting RhoA-dependent cell retraction. In spread cells, Y759 of ß3 becomes dephosphorylated (Xi et al., 2006), allowing ß3 cleavage by activated calpain, which removes the C-terminal RGT sequence of ß3 important in c-Src binding. Integrin cleavage by calpain thus relieves the local inhibitory effect of ß3-associated c-Src on the RhoA-ROCK signaling pathway and locally activates RhoA-dependent cell retractile signals (Xi et al., 2003; Arias-Salgado et al., 2005b). Thus, calpain cleavage of ß3 switches the direction of integrin outside-in signaling from mediating spreading to promoting cell retraction.
|
| Materials and methods |
|---|
|
|
|---|
Construction of R760E mutant
The ß3 R760E mutation was performed using PCR. The forward primer has the sequence of AGAGCTTAAGGACAC. The reverse primers (CTCATTAAGTCCCCTCGTAGGTGATATTGG) contain an XhoI digestion site, stop codon, and the 18-nucleotide C-terminal ß3 sequence coding the intended R760E mutation. PCR products were digested with AspI and XhoI and ligated into a ß3 cDNA construct in a modified cDM8 vector containing only one XhoI site at the 3' end of the multiple cloning site. The construct was verified by DNA sequencing.
Cell lines and transfection
CHO cells stably expressing WT human
IIbß3 (2b3a), human glycoprotein Ib-IX (GPIb-IX; 1b9), or both
IIbß3 and GPIb-IX (123) were previously described in Gu et al. (1999) and Xi et al. (2003). CHO cells expressing GPIb-IX and a truncation mutant ß3, mimicking calpain cleavage at Y759, and complexed with WT
IIb (
759) were also described previously in Gu et al. (1999) and Xi et al. (2003). DNA transfection was performed using Lipofectamine 2000 (Invitrogen). R760E ß3 mutant cDNA was cotransfected with WT
IIb and pcDNA 3.1/Hyg plasmid at a ratio of 5:5:1 into 1b9 cells. Complex formation between
IIb and ß3 subunits was verified by flow cytometry using antibody D57 against
IIbß3 complex. Stable R760E mutant cell lines were obtained by antibiotic selection and repeated cell sorting using D57 as previously described (Gu et al., 1999). To ensure comparable expression, R760E and
759 cells were sorted using the expression level of the stable WT
IIbß3-expressing (123) cells as a gate (Gu et al., 1999; Xi et al., 2003). For transient transfections, cells stably coexpressing WT
IIbß3 were transfected with either 2 µg GFP, 2 µg GFP plus 12 µg of dominant-negative c-Src (Mukhopadhyay et al., 1995), 2 µg GFP plus 12 µg of dominant-negative N19-RhoA (Qiu et al., 1995), or 2 µg GFP plus 12 µg of both dominant-negative c-Src and N19-RhoA, using Lipofectamine 2000. In some experiments, cells were transiently transfected with either 2 µg GFP or 2 µg GFP plus 12 µg of constitutively active c-Src (E378G). Cells were analyzed 24 h after transfection.
Calpain cleavage of ß3 in CHO cells and mouse platelets
107 CHO cells were directly solubilized in buffer containing 2% Triton X-100, 0.15 M NaCl, 1 mM CaCl2, and 0.02 M Tris, pH 7.4, in the presence or absence of 10 mM EDTA. Cell lysates were incubated for 40 min at 37°C with or without 1 µg of purified µ-calpain. SDS-PAGE sample buffer containing 10 mM EDTA, 1 mM PMSF, and 0.2 mM E64 was added to stop reactions. For experiments using mice, 6–8-wk-old mice of either sex were anesthetized by intraperitoneal injection of pentobarbital and blood was drawn from the inferior vena cava. Blood from 5–6 (calpain I+/+ and calpain I–/–; Azam et al., 2001) mice was pooled or platelets were isolated by differential centrifugation as described in Li et al. (2003b). 3 x 108/ml washed platelets were resuspended in modified Tyrode's buffer (Du et al., 1991) and incubated at 22°C for 2 h before use. Platelets were stimulated with 0.1 U/ml thrombin in a platelet aggregometer at 37° for 7 min, and then solubilized in SDS-PAGE sample buffer. All samples were analyzed by SDS-PAGE using 4–15% gradient gels and were immunoblotted using various antibodies. Enhanced chemiluminescence (GE Healthcare) was used for visualization of antibody reactions.
Immunofluorescence and confocal microscopy
Chamber slides (Lab-Tek; Nunc) were precoated with 10 µg/ml fibrinogen and blocked with 5% BSA in PBS. 50 µl CHO cells (expressing WT or mutant integrins; 5 x 105/ml) in Tyrode's buffer was added to the wells and incubated at 37°C for 1 h. After washing, cells were fixed with 4% paraformaldehyde and permeabilized with 0.1% Triton X-100, 0.1 M Tris, 10 mM EGTA, 0.15 M NaCl, 5 mM MgCl2, 1 mM PMSF, 0.1 mM E64, and 1% BSA (permeabilization buffer, pH 7.5). Samples were blocked with 5% BSA, incubated with 10 µg/ml mAb 15 and 0.5 µg/ml of purified Ab759, and, after washing, stained with fluorescently labeled secondary antibodies. To detect RhoA activation, cells were fixed in 4% paraformaldehyde in PBS with 10 mM MgCl2 and incubated with 0.7 µg/ml mAb 15 and Alexa Fluor 555–labeled GST-RBD in permeabilization buffer containing 10 mM MgCl2. After further staining with Alexa Fluor 488–conjugated goat anti–mouse IgG and washes, the antibody and GST-RBD staining were detected using a confocal microscope (Carl Zeiss MicroImaging, Inc.). In some experiments, cells were also preincubated with or without 5 µg/ml of cell-permeable C3 transferase to inhibit RhoA, according to the manufacturer's instructions, and then stained with GST-RBD-555. Surface area in spreading cells was estimated by measuring total pixel number per cell in digitally recorded images using Image J software (National Institutes of Health). Quantitation of 555-nm fluorescence in R760E cells was determined by using the area tool in LSM 5 software (Carl Zeiss MicroImaging, Inc.) and expressed as total pixel number. Statistical significance was determined using a t test.
Clot retraction
400 µl of indicated CHO cell lines (4 x 106/ml), in complete DME in the presence or absence of 5 µM ROCK inhibitors H-1152 or Y-27632 or calpain inhibitor MDL 28170, was mixed with 100 µl of plasma, 2 U/ml thrombin, and 5 mM CaCl2 in a partially Sigmacote-treated glass cuvette (Chrono-Log). For platelet samples, citrated platelet-rich plasma was mixed with 0.2 U/ml thrombin. The clots were allowed to retract at 37°C and were photographed at various times. The two-dimensional sizes of retracted clots on photographs were quantified using Image J software and were expressed as clot size. Statistical significance was determined using a t test.
Confocal microscopy analysis of clot sections
Clots were fixed with 4% paraformaldehyde, embedded in 50% Tissue-Tek OCT compound (Sakura Finetek), placed in 25 x 20 x 5-mm Tissue-Tek Cryomolds (Sakura Finetek), and snap frozen in liquid nitrogen. Frozen sections were made using a cryostat microtome (Microm HM 505 E; Carl Zeiss MicroImaging, Inc.). Slides were then washed and quenched with 5% Sudan black (wt/vol) in 70% ethanol. Sections were permeabilized with 0.1% Triton X-100, 0.1 M Tris, 10 mM EGTA, 0.15 M NaCl, 5 mM MgCl2, 1 mM PMSF, 0.1 mM E64, and 1% BSA, pH 7.5 (permeabilization buffer), blocked with 5% BSA, and immunolabeled with 10 µg/ml mAb 15 and 0.5 µg/ml of purified Ab 759. After washing, cells were stained with Alexa Fluor 594–conjugated anti–rabbit IgG and 488–conjugated anti–mouse IgG. Data was collected using a confocal microscope.
Spreading assays
CHO cells expressing WT, R760E mutant, and
759 mutant integrins (100 µl/well, 1.5 x 105/ml) in complete DME were incubated in fibrinogen- coated chamber slides at 37°C for 20, 40, and 60 min. At each time, cells were immediately rinsed and fixed with 4% paraformaldehyde. For assays using PP2 and ROCK inhibitors, cells were preincubated at 22°C for 30 min with or without 10 µM PP2 and/or 4 µM H-1152 or Y-27632. Cells were allowed to spread for 1 h at 37°C, rinsed, and fixed with 4% paraformaldehyde. Images were captured using a microscope (DM IRB; Leica). The size of the cells from four random fields for each time and cell line was determined using Image J software. Relative increase in cell size was calculated by dividing the mean size of spread cells by the mean size of suspended cells from each cell line. Statistical significance was determined using a t test.
Immunoprecipitation
Cells were lysed in lysis buffer containing 1% NP-40, 150 mM NaCl, 50 mM Tris, pH 7.4, 1 mM sodium orthovanadate, 1 mM NaF, and Complete protease inhibitor mixture (Roche Molecular Biochemicals). Lysates were incubated with either rabbit anti-ß3 or an equal amount of rabbit IgG and subsequently with protein A–Sepharose (GE Healthcare). Beads were washed four times with lysis buffer, analyzed by SDS-PAGE using 4–15% gradient gels, and immunoblotted with mAb 15 for ß3 and monoclonal anti-Src (Calbiochem).
Immunoblot analysis of c-Src activation in cells adherent on fibrinogen-coated surfaces
10-cm polystyrene dishes (Fisher Scientific) were coated with 10 µg/ml fibrinogen and blocked with 5% BSA in PBS. Equal suspensions containing 5 x 106 CHO cells stably expressing WT, R760E mutant, or
759 mutant integrins in modified Tyrode's buffer were either kept in suspension or added to the dishes and incubated at 37°C for 30 min. Plates were rinsed three times with PBS and cells were subsequently lysed with the buffer containing 1% NP-40, 150 mM NaCl, 50 mM Tris, pH 7.4, 1 mM sodium orthovanadate, 1 mM NaF, and Complete protease inhibitor mixture. Lysates were analyzed by SDS-PAGE using 4–15% gradient gels, and then immunoblotted with anti–phospho-Src Y416 and anti–c-Src.
| Acknowledgments |
|---|
This work is supported by grants from the National Institutes of Health/National Heart, Lung, and Blood Institute (HL080264, HL062350, and HL068819; to X. Du).
Submitted: 28 March 2007
Accepted: 1 October 2007
| References |
|---|
|
|
|---|
Amano, M., M. Ito, K. Kimura, Y. Fukata, K. Chihara, T. Nakano, Y. Matsuura, and K. Kaibuchi. 1996. Phosphorylation and activation of myosin by Rho-associated kinase (Rho-kinase). J. Biol. Chem. 271:20246–20249.
Arias-Salgado, E.G., S. Lizano, S. Sarkar, J.S. Brugge, M.H. Ginsberg, and S.J. Shattil. 2003. Src kinase activation by direct interaction with the integrin beta cytoplasmic domain. Proc. Natl. Acad. Sci. USA. 100:13298–13302.
Arias-Salgado, E.G., F. Haj, C. Dubois, B. Moran, A. Kasirer-Friede, B.C. Furie, B. Furie, B.G. Neel, and S.J. Shattil. 2005a. PTP-1B is an essential positive regulator of platelet integrin signaling. J. Cell Biol. 170:837–845.
Arias-Salgado, E.G., S. Lizano, S.J. Shattil, and M.H. Ginsberg. 2005b. Specification of the direction of adhesive signaling by the integrin beta cytoplasmic domain. J. Biol. Chem. 280:29699–29707.
Arthur, W.T., and K. Burridge. 2001. RhoA inactivation by p190RhoGAP regulates cell spreading and migration by promoting membrane protrusion and polarity. Mol. Biol. Cell. 12:2711–2720.
Arthur, W.T., L.A. Petch, and K. Burridge. 2000. Integrin engagement suppresses RhoA activity via a c-Src-dependent mechanism. Curr. Biol. 10:719–722.[CrossRef][Medline]
Azam, M., S.S. Andrabi, K.E. Sahr, L. Kamath, A. Kuliopulos, and A.H. Chishti. 2001. Disruption of the mouse mu-calpain gene reveals an essential role in platelet function. Mol. Cell. Biol. 21:2213–2220.
Calderwood, D.A., R. Zent, R. Grant, D.J. Rees, R.O. Hynes, and M.H. Ginsberg. 1999. The Talin head domain binds to integrin beta subunit cytoplasmic tails and regulates integrin activation. J. Biol. Chem. 274:28071–28074.
Chen, Y.P., T.E. O'Toole, J. Ylanne, J.P. Rosa, and M.H. Ginsberg. 1994. A point mutation in the integrin beta 3 cytoplasmic domain (S752
P) impairs bidirectional signaling through alpha IIb beta 3 (platelet glycoprotein IIb-IIIa). Blood. 84:1857–1865.
Du, X.P., E.F. Plow, A.L.I. Frelinger, T.E. O'Toole, J.C. Loftus, and M.H. Ginsberg. 1991. Ligands "activate" integrin
IIbß3 (platelet GPIIb-IIIa). Cell. 65:409–416.[CrossRef][Medline]
Du, X., T.C. Saido, S. Tsubuki, F.E. Indig, M.J. Williams, and M.H. Ginsberg. 1995. Calpain cleavage of the cytoplasmic domain of the integrin ß3 subunit. J. Biol. Chem. 270:26146–26151.
Fox, J.E., R.G. Taylor, M. Taffarel, J.K. Boyles, and D.E. Goll. 1993. Evidence that activation of platelet calpain is induced as a consequence of binding of adhesive ligand to the integrin, glycoprotein IIb-IIIa. J. Cell Biol. 120:1501–1507.
Ginsberg, M.H., A. Partridge, and S.J. Shattil. 2005. Integrin regulation. Curr. Opin. Cell Biol. 17:509–516.[CrossRef][Medline]
Giuliano, K.A., J. Kolega, R.L. DeBiasio, and D.L. Taylor. 1992. Myosin II phosphorylation and the dynamics of stress fibers in serum-deprived and stimulated fibroblasts. Mol. Biol. Cell. 3:1037–1048.[Abstract]
Gu, M., X. Xi, G.D. Englund, M.C. Berndt, and X. Du. 1999. Analysis of the roles of 14-3-3 in the platelet glycoprotein Ib-IX–mediated activation of integrin
IIbß3 using a reconstituted mammalian cell expression model. J. Cell Biol. 147:1085–1096.
Hall, A. 2005. Rho GTPases and the control of cell behaviour. Biochem. Soc. Trans. 33:891–895.[CrossRef][Medline]
Hynes, R.O. 2002. Integrins: bidirectional, allosteric signaling machines. Cell. 110:673–687.[CrossRef][Medline]
Jaffe, A.B., and A. Hall. 2003. Cell biology. Smurfing at the leading edge. Science. 302:1690–1691.
Kaplan, K.B., J.R. Swedlow, D.O. Morgan, and H.E. Varmus. 1995. c-Src enhances the spreading of src–/– fibroblasts on fibronectin by a kinase-independent mechanism. Genes Dev. 9:1505–1517.
Kimura, K., M. Ito, M. Amano, K. Chihara, Y. Fukata, M. Nakafuku, B. Yamamori, J. Feng, T. Nakano, K. Okawa, et al. 1996. Regulation of myosin phosphatase by Rho and Rho-associated kinase (Rho-kinase). Science. 273:245–248.[Abstract]
Law, D.A., A.L. Nannizzi, and D.R. Phillips. 1996. Outside-in integrin signal transduction.
IIbß3-(GPIIb-IIIa) tyrosine phosphorylation induced by platelet aggregation. J. Biol. Chem. 271:10811–10815.
Law, D.A., F.R. DeGuzman, P. Heiser, K. Ministri-Madrid, N. Killeen, and D.R. Phillips. 1999. Integrin cytoplasmic tyrosine motif is required for outside-in alphaIIbbeta3 signalling and platelet function. Nature. 401:808–811.[CrossRef][Medline]
Li, Z., X. Xi, and X. Du. 2001. A mitogen-activated protein kinase-dependent signaling pathway in the activation of platelet integrin
IIbß3. J. Biol. Chem. 276:42226–42232.
Li, Z., X. Xi, M. Gu, R. Feil, R.D. Ye, M. Eigenthaler, F. Hofmann, and X. Du. 2003a. A stimulatory role for cGMP-dependent protein kinase in platelet activation. Cell. 112:77–86.[CrossRef][Medline]
Li, Z., G. Zhang, G.C. Le Breton, X. Gao, A.B. Malik, and X. Du. 2003b. Two waves of platelet secretion induced by thromboxane A2 receptor and a critical role for phosphoinositide 3-kinases. J. Biol. Chem. 278:30725–30731.
Li, Z., G. Zhang, R. Feil, J. Han, and X. Du. 2006. Sequential activation of p38 and ERK pathways by cGMP-dependent protein kinase leading to activation of the platelet integrin {alpha}IIb{beta}3. Blood. 107:965–972.
Mukhopadhyay, D., L. Tsiokas, X.M. Zhou, D. Foster, J.S. Brugge, and V.P. Sukhatme. 1995. Hypoxic induction of human vascular endothelial growth factor expression through c-Src activation. Nature. 375:577–581.[CrossRef][Medline]
O'Toole, T.E., J.C. Loftus, X.P. Du, A.A. Glass, Z.M. Ruggeri, S.J. Shattil, E.F. Plow, and M.H. Ginsberg. 1990. Affinity modulation of the alpha IIb beta 3 integrin (platelet GPIIb-IIIa) is an intrinsic property of the receptor. Cell Regul. 1:883–893.[Medline]
Obergfell, A., K. Eto, A. Mocsai, C. Buensuceso, S.L. Moores, J.S. Brugge, C.A. Lowell, and S.J. Shattil. 2002. Coordinate interactions of Csk, Src, and Syk kinases with
IIbß3 initiate integrin signaling to the cytoskeleton. J. Cell Biol. 157:265–275.
Pfaff, M., X. Du, and M.H. Ginsberg. 1999. Calpain cleavage of integrin beta cytoplasmic domains. FEBS Lett. 460:17–22.[CrossRef][Medline]
Qiu, R.G., J. Chen, F. McCormick, and M. Symons. 1995. A role for Rho in Ras transformation. Proc. Natl. Acad. Sci. USA. 92:11781–11785.
Ren, X.D., and M.A. Schwartz. 2000. Determination of GTP loading on Rho. Methods Enzymol. 325:264–272.[Medline]
Shattil, S.J. 2005. Integrins and Src: dynamic duo of adhesion signaling. Trends Cell Biol. 15:399–403.[CrossRef][Medline]
Shattil, S.J., and P.J. Newman. 2004. Integrins: dynamic scaffolds for adhesion and signaling in platelets. Blood. 104:1606–1615.
Tadokoro, S., S.J. Shattil, K. Eto, V. Tai, R.C. Liddington, J.M. de Pereda, M.H. Ginsberg, and D.A. Calderwood. 2003. Talin binding to integrin beta tails: a final common step in integrin activation. Science. 302:103–106.
Vinogradova, O., A. Velyvis, A. Velyviene, B. Hu, T. Haas, E. Plow, and J. Qin. 2002. A structural mechanism of integrin alpha(IIb)beta(3) "inside-out" activation as regulated by its cytoplasmic face. Cell. 110:587–597.[CrossRef][Medline]
Wegener, K.L., A.W. Partridge, J. Han, A.R. Pickford, R.C. Liddington, M.H. Ginsberg, and I.D. Campbell. 2007. Structural basis of integrin activation by talin. Cell. 128:171–182.[CrossRef][Medline]
Xi, X., R.J. Bodnar, Z. Li, S.C.-T. Lam, and X. Du. 2003. Critical roles for the COOH-terminal NITY and RGT sequences of the integrin ß3 cytoplasmic domain in inside-out and outside-in signaling. J. Cell Biol. 162:329–339.
Xi, X., P. Flevaris, A. Stojanovic, A. Chishti, D.R. Phillips, S.C. Lam, and X. Du. 2006. Tyrosine phosphorylation of the integrin ß3 subunit regulates beta(3) cleavage by calpain. J. Biol. Chem. 281:29426–29430.
Zou, Z., H. Chen, A.A. Schmaier, R.O. Hynes, and M.L. Kahn. 2007. Structure-function analysis reveals discrete beta3 integrin inside-out and outside-in signaling pathways in platelets. Blood. 109:3284–3290.
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|