|
||
Report |
A genome-wide RNAi screen reveals multiple regulators of caspase activation
Correspondence to Junying Yuan: jyuan{at}hms.harvard.edu
Apoptosis is an evolutionally conserved cellular suicide mechanism that can be activated in response to a variety of stressful stimuli. Increasing evidence suggests that apoptotic regulation relies on specialized cell death signaling pathways and also integrates diverse signals from additional regulatory circuits, including those of cellular homeostasis. We present a genome-wide RNA interference screen to systematically identify regulators of apoptosis induced by DNA damage in Drosophila melanogaster cells. We identify 47 double- stranded RNA that target a functionally diverse set of genes, including several with a known function in promoting cell death. Further characterization uncovers 10 genes that influence caspase activation upon the removal of Drosophila inhibitor of apoptosis 1. This set includes the Drosophila initiator caspase Dronc and, surprisingly, several metabolic regulators, a candidate tumor suppressor, Charlatan, and an N-acetyltransferase, ARD1. Importantly, several of these genes show functional conservation in regulating apoptosis in mammalian cells. Our data suggest a previously unappreciated fundamental connection between various cellular processes and caspase-dependent cell death.
Abbreviations used in this paper: Chn, Charlatan; DIAP1, Drosophila inhibitor of apoptosis 1; dox, doxorubicin; dsRNA, double-stranded RNA; NRSF, neuron-restrictive silencer factor; REST, RE1-silencing transcription factor.
| Introduction |
|---|
|
|
|---|
| Results and discussion |
|---|
|
|
|---|
A diverse set of dsRNAs protects fly cells from dox-induced apoptosis
To identify dsRNAs that inhibit DNA damage–induced apoptosis in Kc cells, we performed a high-throughput screen using an established genome-wide Drosophila RNAi library that targets 19,470 genes (Boutros et al., 2004). 81 dsRNAs resulted in a z score >2, which was the threshold for defining a hit in our primary screen (Fig. 1 A).
To eliminate dsRNAs that directly enhanced cellular ATP levels, the effect of dsRNAs on ATP levels was measured in the rescreen. We verified that 62 dsRNAs specifically protected cells against dox-induced apoptosis (Fig. 1 B). To minimize off-target effects, we further examined any dsRNA with at least 19-nucleotide sequence identity with an off-target gene (Echeverri et al., 2006; Ma et al., 2006) by testing alternative dsRNAs distinct from the original targeting sequence for protection against cell death induced by dox treatment (Fig. S2 A, available at http://www.jcb.org/cgi/content/full/jcb.200708090/DC1) and for caspase suppression induced by Drosophila inhibitor of apoptosis 1 (diap1) RNAi treatment as described in Fig. 3 (Fig. S2 B). Any dsRNA for a given gene failing to provide significant protection (P < 0.05) in either of these assays was eliminated, resulting in a final set of 47 genes (Fig. 1 B and Table S1).
|
Approximately 85% of the genes identified in the RNAi screen are characterized genes of known function or contain well-conserved functional domains, which regulate a wide range of cellular processes, including signaling, metabolism, and transcription, whereas the remaining 15% of the genes have no known functional domains (Fig. 1 C). Altogether, our RNAi screen implicates cell death genes (three), signaling molecules (13), metabolic regulators (10), metabolite transport factors (four), genes involved in ER/Golgi trafficking (four), chromatin/transcription regulators (two), RNA-processing factors (two), structural and cytoskeletal proteins (two), and genes of unknown function (seven) in mediating DNA damage–induced apoptosis (Table S1). Strikingly, 20% of the genes are directly involved in cellular metabolic processes (Fig. 1 C), supporting an earlier proposal that the cellular metabolic state critically influences the threshold for induction of apoptosis (Hammerman et al., 2004). To investigate where these genes operate in the apoptotic pathway, we conducted specific enzymatic and epistatic assays in fly and mammalian cells.
Identification of genes involved in caspase-dependent cell death
Next, we classified the genes that are specifically involved in caspase-dependent cell death. We observed the substantial induction of caspase activity 8 h after dox treatment, preceding detectable cell death (Fig. S1, A and D). Any RNAi suppressing this activity implicates the target gene in early regulation of caspase activation. In addition to dcp-1 RNAi, knockdown of dronc and jra significantly (P < 0.05) suppressed caspase-3/7–like activity in the presence of dox, whereas the negative control, RNAi against calpain A, a calcium-dependent cysteine protease, did not affect this pathway (Fig. 2 A).
We expanded this analysis to all of the genes identified in the initial RNAi screen and discovered 20 dsRNAs that suppressed caspase activation induced by DNA damage (Table S1). Interestingly, as shown in Fig. 2 B, 12 of these genes were found to be epistatic to diap1, as discussed in the next section.
|
|
|
Evolutionary conservation of the novel regulators of apoptosis
To further explore the significance of our findings, we examined whether silencing the mammalian orthologues of the fly genes identified from the RNAi screen confers protection against dox-induced cell death in mammalian cells. We selected a set of mammalian orthologues that are believed to be nonredundant. The list includes the orthologues of dMiro, which functions as a Rho-like GTPase; dARD1, which functions as an N-acetyltransferase; CG12170, which functions as a fatty acid synthase; and Chn, which functions as a transcriptional repressor (RHOT1, hARD1, OXSM, and REST, respectively; FlyBase). In addition, we tested Plk3, a mammalian orthologue of Polo, as dsRNA targeting polo potently protected against dox treatment (Fig. 1).
We assessed the ability of siRNAs targeting a gene of interest to protect against DNA damage in HeLa cells. As a positive control, cells were transfected with siRNAs targeting Bax or Bak, two central regulators of mammalian cell death (Wei et al., 2001; Zong et al., 2001). Indeed, silencing of Bax or Bak resulted in significant protection (P < 0.05) against dox- induced cell death (Fig. 4 A). We observed that plk3 RNAi provided partial protection against dox treatment, which is consistent with previous studies implicating Plk3 in stress-induced apoptosis (Xie et al., 2001a,b; Bahassi et al., 2002). Interestingly, the knockdown of hARD1 dramatically enhanced cell survival in the presence of dox to levels similar to that of Bak. This protective effect was also evident at the morphological level. In cells transfected with a nontargeting control siRNA, dox treatment resulted in typical apoptotic morphology, including cell rounding and membrane blebbing (Fig. 4 B). In direct contrast, cells transfected with siRNAs against hARD1 maintained a normal and healthy morphology and continued to proliferate in the presence of dox.
|
Because the silencing of hARD1 dramatically suppressed activation of the downstream caspases, we examined whether activation of the upstream caspases in response to dox treatment is also perturbed. Remarkably, hARD1 RNAi inhibited the cleavage of caspase-2 and -9 in cells treated with dox, whereas caspase cleavage was readily detected in control cells (Fig. 4 E). Thus, we propose that hARD1 regulates the signal transduction pathway apical to the apoptotic machinery in the DNA damage response itself or the activation of upstream caspases.
Consistent with the results of the caspase-3/7 assay (Fig. 4 C), silencing of hARD1 completely inhibited the appearance of activated caspase-3 induced by dox (Fig. 4 E). We used this assay for a hARD1 complementation experiment to demonstrate the proapoptotic role of hARD1 in response to DNA damage. We used a new siRNA pool targeting the 5' untranslated region of hARD1 (5'si), which inhibited caspase-3 cleavage induced by dox treatment (Fig. 4 F). Furthermore, we observed caspase-3 cleavage in reconstituted hARD1 knockdown cells. Because six out of six siRNAs against hARD1 provided strong protection against DNA damage–induced apoptosis and complementation of hARD1-sensitized cells to caspase activation, we conclude that the functional role of ARD1 for dox-induced apoptosis is evolutionally conserved from Drosophila to mammals.
In contrast to our results, Arnesen et al. (2006) reported that hARD1 is necessary to maintain cell survival. One possible explanation for this discrepancy can be attributed to the inherent differences between the siRNAs used in this study and that used by Arnesen et al. We observed that two out of two siRNAs used in the Arnesen et al. (2006) study resulted in a decrease in cell survival in the absence of stress signal, whereas none of the siRNAs tested as such had a negative effect on cell survival (Fig. S2 D).
In summary, we used an unbiased RNAi screening platform in Drosophila cells to identify genes involved in promoting DNA damage–induced apoptosis. We isolated 47 dsRNAs that suppress cell death induced by dox. These genes encode for known apoptotic regulators such as Dronc, the Drosophila orthologue of the known proapoptotic transcriptional factor c-Jun, and an ecdysone-regulated protein, Eip63F-1, thereby validating our primary screen. Furthermore, our study implicates a large class of metabolic genes that were previously not suspected to have a role in modulating caspase activation and apoptosis, such as genes involved in fatty acid biosynthesis (CG11798), amino acid/carbohydrate metabolism (CG31674), citrate metabolism (CG14740), complex carbohydrate metabolism (CG10725), and ribosome biosynthesis (CG6712). These results support an earlier proposal (Hammerman et al., 2004; Nutt et al., 2005) that the cellular metabolic status regulates the threshold for activation of apoptosis and thus plays a critical role in the decision of a cell to live or die.
Of particular interest is the identification of ARD1. We present evidence that RNAi against ARD1 provides protection against cell death and leads to the suppression of caspase activation induced by DNA damage in fly cells and HeLa cells. Furthermore, deficiency in dARD1 renders fly cells resistant to the spontaneous caspase activity and cell death associated with loss of Diap1. Importantly, we provide substantial evidence that hARD1 is required for caspase activation in the presence of DNA damage in mammalian cells. Cleavage of initiator and executioner caspases are suppressed in hARD1 RNAi cells treated with dox, suggesting that hARD1 functions further upstream of caspase activation, and the complementation of hARD1 knockdown cells restores caspase-3 cleavage. These data indicate that ARD1 is necessary for DNA damage–induced apoptosis in flies and mammals.
ARD1 functions in a complex with N-acetyltransferase to catalyze the acetylation of the N
-terminal residue of newly synthesized polypeptides and has been implicated in the regulation of heterochromatin, DNA repair, and the maintenance of genomic stability in yeast (Mullen et al., 1989; Aparicio et al., 1991; Ouspenski et al., 1999; Wilson, 2002; Bilton et al., 2006). These studies suggest that ARD1 may be involved in regulating an early step in response to DNA damage. We anticipate that future studies will focus on determining whether ARD1 functions in similar processes in mammals. The diversity of genes identified in our screen illustrates the complex cellular integration of survival and death signals through multiple pathways.
| Materials and methods |
|---|
|
|
|---|
RNAi screening
Drosophila Kc cells (105/well in 384-well plates) were transfected with prealiquoted dsRNAs (0.5 µg/well) followed by a 48-h incubation to allow for protein turnover. Subsequently, cells were treated with 5 µg/ml dox (Sigma-Aldrich) for an additional 48-h incubation. Cell viability was determined by measuring cellular ATP levels (CellTiter-Glo luminescent cell viability assay; Promega). Positive hits for this screen were defined as dsRNAs that increased cellular ATP levels by at least two units of SD above the mean level of the plate, a z score of two, in duplicate.
Rescreen
Confirmation of these hits was performed using newly synthesized dsRNAs. cDNA was amplified from fly genomic DNA using primers optimally designed for RNAi (sequences provided by N. Ramadan, Drosophila RNAi Screening Center, Harvard Medical School, Boston, MA). dsRNA synthesis was conducted according to the manufacturer's recommended protocol (MEGAscript; Ambion). Kc cells (2 x 105/well in 96-well plates) were transfected with dsRNAs (1 µg/well) followed by treatment with dox. Each dsRNA was tested in triplicate and in at least two independent experiments. Cell viability was determined as a ratio between ATP levels of cells treated with a given dsRNA in the presence of dox and control cells treated with the dsRNA only. Statistically significant protection (P < 0.05) against dox-induced cell death was determined by comparing the cell viability of cells treated with RNAi in the presence of dox with the cell viability of cells treated with dox alone. Fold protection against dox was determined as the ratio between the mean cell viability of cells transfected with dsRNA in the presence of dox and cells treated with only dox.
Caspase activation assay
Kc cells were transfected in 96-well plates with the 62 dsRNAs that were confirmed in the primary screen followed by treatment with dox for 8 h to induce caspase activation. Each dsRNA was tested in triplicate and in at least two independent experiments. Caspase-3/7–like activity was quantified using a luciferin-labeled DEVD peptide substrate (Caspase-Glo 3/7 assay; Promega). Fold caspase-3/7–like activity was determined as the ratio between the mean caspase-3/7–like activity of cells transfected with dsRNA in the presence of dox and cells treated with dox only.
DIAP1 epistasis studies
Kc cells were transfected in 96-well plates with individual dsRNAs targeting the 62 genes confirmed in the initial screen. After a 24-h incubation, these cells were transfected with 1 µg diap1 dsRNA for an additional 48-h incubation when cell viability was quantified (as described in the Rescreen section). Fold protection against diap1 RNAi was determined as the ratio between the mean cell viability of cells transfected with the indicated dsRNA and diap1 RNAi and the mean cell viability of cells transfected with diap1 RNAi only. For the caspase activation assay, Kc cells were transfected with dsRNA as indicated followed by transfection with dsRNA against diap1 and an additional 24-h incubation.
Mammalian RNAi studies
Low-passage HeLa cells were transiently transfected (5 x 105/well in 96-well plates) with a pool of four siRNAs unless otherwise indicated (50 nM; predesigned ON-TARGETplus siRNAs; Dharmacon) using HiPerFect transfection reagent (QIAGEN). After a 48-h incubation, cells were treated with dox (concentrations and incubation times are noted in figures). siRNAs were tested in triplicate for each independent experiment. Cell viability and caspase-3/7 activity was quantified as described for KC cells. Images were obtained using bright-field microscopy.
For detection of caspase cleavage, HeLa cells were transfected with siRNAs (1.5 x 105/well in six-well plates) followed by treatment with dox. Cells were lysed directly in SDS sample buffer and subjected to SDS-PAGE analysis. Caspases were detected by immunoblotting using the following antibodies: caspase-9 (R&D Systems), caspase-2 (Alexis), caspase-3 (Cell Signaling Technology), and cleaved caspase-3 (Cell Signaling Technology). hARD1 was detected using a rabbit polyclonal antibody (provided by M.C. Brahimi-Horn, University of Nice, Centre National de la Recherche Scientifique, Nice, France).
For hARD1 reconstitution experiments, HeLa cells were transfected with a pool of two siRNAs targeting the 5' untranslated region of hARD1 (sequences CUGACUGCGCCUUCACGAUUU and GCUGACUGCGCCUUCACGAUU; Dharmacon) in six-well plates followed by a 24-h incubation. This was followed by transient transfection of C-terminal–tagged hARD1-myc/his using TransIT-LT1 transfection reagent (Mirus) and an additional 24-h incubation. After dox treatment, cells were lysed and analyzed by Western blotting.
Microscopy
Images of HeLa cells were obtained using a microscope (Eclipse TE300; Nikon) with a 10x Ph L objective lens and a camera (ORCA-ER; Hamamatsu) at room temperature. Openlab 3.1.7 acquisition software (Improvision) was used to analyze the images.
Online supplemental material
Fig. S1 shows a characterization of dox-induced cell death and controls for RNAi screen. Fig. S2 presents semiquantitative analysis of dsRNAs to validate the RNAi library. Table S1 provides a comprehensive list of genes identified in the primary screen. Online supplemental material is available at http://www.jcb.org/cgi/content/full/jcb.200708090/DC1.
| Acknowledgments |
|---|
This work was supported, in part, by an Innovator's Award from the U.S. Army Breast Cancer Research Program (grant DAMD17-02-1-0403), a grant from the National Institute of Aging (R37-012859) to J. Yuan, a graduate research fellowship from the National Science Foundation to D.K. Sogah, and a Kirchstein National Research Service Award from the National Institute of Neurological Disorders and Stroke (grant 1F31NS057872-01) to C.H. Yi.
Submitted: 27 August 2007
Accepted: 15 October 2007
| References |
|---|
|
|
|---|
Aparicio, O.M., B.L. Billington, and D.E. Gottschling. 1991. Modifiers of position effect are shared between telomeric and silent mating-type loci in S. cerevisiae. Cell. 66:1279–1287.
Arnesen, T., D. Gromyko, F. Pendino, A. Ryningen, J.E. Varhaug, and J.R. Lillehaug. 2006. Induction of apoptosis in human cells by RNAi- mediated knockdown of hARD1 and NATH, components of the protein N-alpha-acetyltransferase complex. Oncogene. 25:4350–4360.[CrossRef][Medline]
Bahassi, El M., C.W. Conn, D.L. Myer, R.F. Hennigan, C.H. McGowan, Y. Sanchez, and P.J. Stambrook. 2002. Mammalian Polo-like kinase 3 (Plk3) is a multifunctional protein involved in stress response pathways. Oncogene. 21:6633–40.[CrossRef][Medline]
Bilton, R., E. Trottier, J. Pouyssegur, and M.C. Brahimi-Horn. 2006. ARDent about acetylation and deacetylation in hypoxia signalling. Trends Cell Biol. 16:616–621.[CrossRef][Medline]
Boutros, M., A.A. Kiger, S. Armknecht, K. Kerr, M. Hild, B. Koch, S.A. Haas, H.F. Consortium, R. Paro, and N. Perrimon. 2004. Genome-wide RNAi analysis of growth and viability in Drosophila cells. Science. 303:832–835.
Chai, J., N. Yan, J.R. Huh, J.W. Wu, W. Li, B.A. Hay, and Y. Shi. 2003. Molecular mechanism of Reaper-Grim-Hid-mediated suppression of DIAP1-dependent Dronc ubiquitination. Nat. Struct. Biol. 10:892–898.[CrossRef][Medline]
Chew, S.K., F. Akdemir, P. Chen, W.J. Lu, K. Mills, T. Daish, S. Kumar, A. Rodriguez, and J.M. Abrams. 2004. The apical caspase dronc governs programmed and unprogrammed cell death in Drosophila. Dev. Cell. 7:897–907.[CrossRef][Medline]
Chong, J.A., J. Tapia-Ramirez, S. Kim, J.J. Toledo-Aral, Y. Zheng, M.C. Boutros, Y.M. Altshuller, M.A. Frohman, S.D. Kraner, and G. Mandel. 1995. REST: a mammalian silencer protein that restricts sodium channel gene expression to neurons. Cell. 80:949–957.[CrossRef][Medline]
Daish, T.J., K. Mills, and S. Kumar. 2004. Drosophila caspase DRONC is required for specific developmental cell death pathways and stress-induced apoptosis. Dev. Cell. 7:909–915.[CrossRef][Medline]
Echeverri, C.J., P.A. Beachy, B. Baum, M. Boutros, F. Buchholz, S.K. Chanda, J. Downward, J. Ellenberg, A.G. Fraser, N. Hacohen, et al. 2006. Minimizing the risk of reporting false positives in large-scale RNAi screens. Nat. Methods. 3:777–779.[CrossRef][Medline]
Gorski, S.M., S. Chittaranjan, E.D. Pleasance, J.D. Freeman, C.L. Anderson, R.J. Varhol, S.M. Coughlin, S.D. Zuyderduyn, S.J. Jones, and M.A. Marra. 2003. A SAGE approach to discovery of genes involved in autophagic cell death. Curr. Biol. 13:358–363.[CrossRef][Medline]
Hammerman, P.S., C.J. Fox, and C.B. Thompson. 2004. Beginnings of a signal-transduction pathway for bioenergetic control of cell survival. Trends Biochem. Sci. 29:586–592.[CrossRef][Medline]
Ma, Y., A. Creanga, L. Lum, and P.A. Beachy. 2006. Prevalence of off-target effects in Drosophila RNA interference screens. Nature. 443:359–363.[CrossRef][Medline]
Meier, P., J. Silke, S.J. Leevers, and G.I. Evan. 2000. The Drosophila caspase DRONC is regulated by DIAP1. EMBO J. 19:598–611.[CrossRef][Medline]
Mullen, J.R., P.S. Kayne, R.P. Moerschell, S. Tsunasawa, M. Gribskov, M. Colavito-Shepanski, M. Grunstein, F. Sherman, and R. Sternglanz. 1989. Identification and characterization of genes and mutants for an N-terminal acetyltransferase from yeast. EMBO J. 8:2067–2075.[Medline]
Nutt, L.K., S.S. Margolis, M. Jensen, C.E. Herman, W.G. Dunphy, J.C. Rathmell, and S. Kornbluth. 2005. Metabolic regulation of oocyte cell death through the CaMKII-mediated phosphorylation of caspase-2. Cell. 123:89–103.[CrossRef][Medline]
Ouspenski, I.I., S.J. Elledge, and B.R. Brinkley. 1999. New yeast genes important for chromosome integrity and segregation identified by dosage effects on genome stability. Nucleic Acids Res. 27:3001–3008.
Rusten, T.E., K. Lindmo, G. Juhasz, M. Sass, P.O. Seglen, A. Brech, and H. Stenmark. 2004. Programmed autophagy in the Drosophila fat body is induced by ecdysone through regulation of the PI3K pathway. Dev. Cell. 7:179–192.[CrossRef][Medline]
Schoenherr, C.J., and D.J. Anderson. 1995. The neuron-restrictive silencer factor (NRSF): a coordinate repressor of multiple neuron-specific genes. Science. 267:1360–1363.
Song, Z., B. Guan, A. Bergman, D.W. Nicholson, N.A. Thornberry, E.P. Peterson, and H. Steller. 2000. Biochemical and genetic interactions between Drosophila caspases and the proapoptotic genes rpr, hid, and grim. Mol. Cell. Biol. 20:2907–2914.
Tsuda, L., M. Kaido, Y.M. Lim, K. Kato, T. Aigaki, and S. Hayashi. 2006. An NRSF/REST-like repressor downstream of Ebi/SMRTER/Su(H) regulates eye development in Drosophila. EMBO J. 25:3191–3202.[CrossRef][Medline]
Verheij, M., R. Bose, X.H. Lin, B. Yao, W.D. Jarvis, S. Grant, M.J. Birrer, E. Szabo, L.I. Zon, J.M. Kyriakis, et al. 1996. Requirement for ceramide-initiated SAPK/JNK signalling in stress-induced apoptosis. Nature. 380:75–79.[CrossRef][Medline]
Wang, S.L., C.J. Hawkins, S.J. Yoo, H.A. Muller, and B.A. Hay. 1999. The Drosophila caspase inhibitor DIAP1 is essential for cell survival and is negatively regulated by HID. Cell. 98:453–463.[CrossRef][Medline]
Wei, M.C., W.X. Zong, E.H. Cheng, T. Lindsten, V. Panoutsakopoulou, A.J. Ross, K.A. Roth, G.R. MacGregor, C.B. Thompson, and S.J. Korsmeyer. 2001. Proapoptotic BAX and BAK: a requisite gateway to mitochondrial dysfunction and death. Science. 292:727–730.
Westbrook, T.F., E.S. Martin, M.R. Schlabach, Y. Leng, A.C. Liang, B. Feng, J.J. Zhao, T.M. Roberts, G. Mandel, G.J. Hannon, et al. 2005. A genetic screen for candidate tumor suppressors identifies REST. Cell. 121:837–848.[CrossRef][Medline]
Whiteway, M., and J.W. Szostak. 1985. The ARD1 gene of yeast functions in the switch between the mitotic cell cycle and alternative developmental pathways. Cell. 43:483–492.[CrossRef][Medline]
Wilson, T.E. 2002. A genomics-based screen for yeast mutants with an altered recombination/end-joining repair ratio. Genetics. 162:677–688.
Xie, S., Q. Wang, H. Wu, J. Cogswell, L. Lu, M. Jhanwar-Uniyal, and W. Dai. 2001a. Reactive oxygen species-induced phosphorylation of p53 on serine 20 is mediated in part by polo-like kinase-3. J. Biol. Chem. 276:36194–36199.
Xie, S., H. Wu, Q. Wang, J.P. Cogswell, I. Husain, C. Conn, P. Stambrook, M. Jhanwar-Uniyal, and W. Dai. 2001b. Plk3 functionally links DNA damage to cell cycle arrest and apoptosis at least in part via the p53 pathway. J. Biol. Chem. 276:43305–43312.
Xu, D., Y. Wang, R. Willecke, Z. Chen, T. Ding, and A. Bergmann. 2006. The effector caspases drICE and dcp-1 have partially overlapping functions in the apoptotic pathway in Drosophila. Cell Death Differ. 13:1697–1706.[CrossRef][Medline]
Zong, W.X., T. Lindsten, A.J. Ross, G.R. MacGregor, and C.B. Thompson. 2001. BH3-only proteins that bind pro-survival Bcl-2 family members fail to induce apoptosis in the absence of Bax and Bak. Genes Dev. 15:1481–1486.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|