|
||
Report |
The JAK/STAT pathway positively regulates DPP signaling in the Drosophila germline stem cell niche
Correspondence to Correspondence to Yu Cai: caiyu{at}tll.org.sg
The stem cell niche, formed by surrounding stromal cells, provides extrinsic signals that maintain stem cell self-renewal. However, it remains unclear how these extrinsic signals are regulated. In the Drosophila female germline stem cell (GSC) niche, Decapentaplegic (DPP) is an important niche factor for GSC self-renewal. The exact source of the DPP and how its transcription is regulated in this niche remain unclear. We show that dpp is expressed in somatic cells of the niche including the cap cells, a subtype of niche cells. Furthermore, our data show that the Janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway positively regulates dpp expression in the cap cells, suggesting that JAK/STAT activity is required in somatic niche cells to prevent precocious GSC differentiation. Our data suggest that the JAK/STAT pathway functions downstream/independently of cap cell formation induced by Notch signaling. JAK/STAT signaling may also regulate dpp expression in the male GSC niche, suggesting a common origin of female and male GSC niches.
| Introduction |
|---|
|
|
|---|
|
| Results and discussion |
|---|
|
|
|---|
In the wild-type germarium, there are 2–3 GSCs and 2–3 CBs, each of which contain a spectrosome, a spherical
-Spectrin–positive intracellular membranous organelle. During cyst formation, this structure branches to connect individual cystocytes and is referred to as a fusome (Fig. 1 B) (Lin et al., 1994). In germaria ectopically expressing upd, more than 90% (n > 100) of germaria exhibited extra spectrosome-containing cells (Fig. 1 C), consistent with a previous report (Decotto and Spradling, 2005). About 20% of these germaria (n = 90) contained hundreds of cells with a spectrosome (Fig. 1 D). We also noticed that a high proportion (> 50%, n > 400) of adult females were completely devoid of any ovary, suggesting that ectopic upd driven by c587-GAL4 may have other effects during early stages of gonadal development. Indeed, enlarged ovaries with abnormal structure were often observed in late larval stages (Fig. S1, available at http://www/jcb.org/cgi/content/full/jcb.200711022/DC1). To investigate whether ectopic expression of upd can induce formation of ectopic GSC-like cells in the adult ovary, we used the "flip-out" cassette to induce ectopic upd expression in adult germaria (see Materials and methods) (Ito et al., 1997); these germaria also contained extra spectrosome-containing cells, albeit to a lesser extent (Fig. 1 E; see Fig. S2 for additional methods to confirm this result). Formation of these ectopic spectrosome-containing cells by upd overexpression was suppressed in the stat92eTS background, suggesting that upd acts through the canonical JAK/STAT signaling pathway (Fig. 1, F and G). Together, these results show that ectopic activation of JAK/STAT signaling in the somatic cells of the adult ovary can induce the formation of ectopic spectrosome-containing cells.
The ectopic spectrosome-containing cells are GSC-like
To address the identity of these extra spectrosome-containing cells, we examined expression of bam, a key differentiation promoting factor that is turned off in GSCs but highly expressed in CBs and early differentiating cysts (McKearin and Ohlstein, 1995). As previously demonstrated by Chen and McKearin (2003b), in wild-type ovaries, bam-GFP is absent in GSCs but expressed in CBs and differentiating cysts (Fig. 1 H). However, in germaria with ectopic upd expression, most spectrosome-containing cells did not express bam-GFP (Fig. 1 I).
It has been shown that high levels of DPP signal reception within GSCs represses bam expression (Chen and McKearin, 2003a; Kai and Spradling, 2003; Song et al., 2004). We next assessed the status of DPP signal reception within these ectopic spectrosome-containing cells. In Drosophila, DPP binds and brings together type I and type II serine/threonine receptor kinases. The constitutively active type II receptor Punt phosphorylates type I receptor Tkv (Thick Vein) and/or Saxphone (Sax), which propagates signaling by phosphorylating and activating the R-Smad, Mad (Mothers against DPP). The phosphorylated Mad (p-Mad) forms a complex with Medea and translocates into the nucleus to regulate the expression of target gene such as Dad (Daughters against DPP) (Tabata and Takei, 2004). In wild type, only GSCs show high levels of Dad-lacZ (a lacZ insertion in Dad) (Tsuneizumi et al., 1997) and pMad expression (Fig. 2, A and C). However, in germaria ectopically expressing upd, most spectrosome-containing cells showed strong Dad-lacZ and pMad expression, indicating activation of DPP signaling (Fig. 2, B and D). These data show that ectopic activation of JAK/STAT signaling in germaria induces ectopic DPP signaling and excess GSC-like cells.
|
|
JAK/STAT signaling regulates dpp expression in the female GSC niche
The effects of ectopic expression of upd and dpp in somatic cells are similar. Both result in germ cell hyperplasia and arrest germ cells at a GSC-like stage with high levels of DPP signal reception and low levels of Bam expression (Fig. 2 G, and not depicted) (Xie and Spradling, 1998). These imply that JAK/STAT signaling and DPP signaling may function in a linear pathway to induce ectopic GSC-like cells. Consistent with this, reduction of DPP signaling in the upd overexpression background suppresses the ectopic GSC-like cell phenotype (Fig. 2 F and not depicted). Furthermore, DPP overexpression in somatic cells still induced ectopic GSC formation even in stat92eTS background. These data suggest that DPP signaling may function downstream of JAK/STAT signaling (Fig. 2 H).
We then asked how JAK/STAT signaling regulates DPP signaling. First, we examined the activation of JAK/STAT signaling in the germarium. Stat92E06346, a lacZ enhancer trap insertion in Stat92E, is strongly expressed in somatic cells, including the cap and ESC cells (Baksa et al., 2002; Decotto and Spradling, 2005). A STAT92E-GFP transgene, which apparently reflects the activity of the JAK/STAT pathway in Drosophila (Bach et al., 2007), is also expressed in cap and ESC cells. These data suggest that JAK/STAT signaling is activated in the somatic cells associated with the GSC niche (Fig. 2 I). Next, we examined the status of DPP signaling in stat92TS mutant germaria in which JAK/STAT signaling is compromised. In wild type, the 2–3 GSCs within the GSC niche show strong pMad expression, indicating that the DPP pathway is activated (Fig. 2 C). However, in stat92eTS germaria, more than 50% (n = 120) of GSCs show markedly reduced pMad expression, indicative of low levels of DPP signaling (Fig. 2 J). As Decotto and Spradling's (2005) previous report, we also observed that stat92eTS germaria showed progressive loss of GSCs as observed in dpp mutant germaria (Xie and Spradling, 1998; Decotto and Spradling, 2005). Together with the observation that JAK/STAT signaling is dispensable in the germline for GSC maintenance (Decotto and Spradling, 2005), these results suggest that there is a requirement for JAK/STAT signaling in the somatic cells of the niche for normal DPP signaling.
The observations that dpp mutants strongly suppress the ectopic GSC-like cell phenotype induced by upd overexpression suggest that JAK/STAT signaling may regulate dpp expression in the GSC niche. To address this, RNA in situ hybridization experiments were performed. In the wild-type GSC niche, dpp transcripts were invariably detected in cap cells (Fig. 2, K–L, see Fig. S3 for more images; available at http://www/jcb.org/cgi/content/full/jcb.200711022/DC1). In many gemaria, lower levels of dpp expression were also detected in some somatic cells next to cap cells, presumably ESCs. It is worthy to note that even within the same germarium, the signal intensity varies among individual cap cells. This may reflect the dynamic nature of dpp expression in cap cells. A similar observation was reported for the expression of Dad-lacZ (Casanueva and Ferguson, 2004). These results suggest that cap cells are likely a major source of dpp in the GSC niche and are consistent with the important role of cap cells in the GSC niche (Xie and Spradling, 2000; Song et al., 2007). We next examined dpp expression in germarium with compromised JAK/STAT activity. In stat92eTS germaria, dpp transcripts were strongly reduced/absent from the cap cells (Fig. 2, M and M'; see Fig. S3 for more images) and presumably the ESCs. In a complementary experiment, in germaria with ectopic upd expression, dpp transcripts were strongly up-regulated (Fig. 2, N and N'). Furthermore, ectopic upd expression could activate luciferase reporters containing dpp regulatory regions in the S2 cell (Fig. S3). Decotto and Spradling (2005) had shown that JAK/STAT signaling functions in ESCs to affect GSC maintenance, the loss of GSCs in stat92eTS germaria may reflect the collaborative roles of JAK/STAT signaling in cap cells and ESCs. We next examined whether JAK/STAT signaling is required in cap cells by generating cap cells mutant for STAT92E (see Materials and methods). Indeed, in 13% (n = 15) of these germaria, the GSC niche was occupied by a fusome-containing cyst, indicating precocious differentiation of GSCs (Fig. 2 O). Together, these data suggest that the JAK/STAT pathway positively regulates dpp expression in the GSC niche and DPP, in turn, acts to control GSC self-renewal.
The JAK/STAT pathway also appears to regulate dpp expression in the male GSC niche
The male GSC niche provides another well-established system to study stem cell biology (Gilboa and Lehmann, 2004; Yamashita et al., 2005; Fuller and Spradling, 2007). In the apical tip of the male testis, GSCs attach to a cluster of somatic hub cells, known as the niche. Upd is produced in the hub cells and functions as a short-range signal to activate downstream JAK/STAT signal reception within GSCs to maintain GSC self-renewal (Kiger et al., 2001; Tulina and Matunis, 2001). In addition to JAK/STAT signaling, DPP signaling is also implicated in the maintenance of GSC in male testis (Kawase et al., 2004). We examined whether JAK/STAT signaling may also regulate dpp expression in the male GSC niche.
In wild-type testis, GSCs undergo self-renewal division to generate a GSC daughter and a gonialblast, which initiates differentiation (Yamashita et al., 2005). pMad accumulates to high levels in GSCs located next to the hub cells and some gonialblasts, suggesting high levels of DPP/BMP signaling (Fig. 4, A and D) (Kawase et al., 2004). However, in stat92eTS testes, most GSCs show low levels of pMad accumulation, consistent with the notion that DPP/BMP signaling is low when JAK/STAT activity is compromised (Fig. 4, B and E). However, testes with ectopic activation of JAK/STAT signaling contain hundreds of cells containing a spectrosome (Kiger et al., 2001; Tulina and Matunis, 2001). Interestingly, pMad also accumulates to high levels in these ectopic spectrosome-containing cells, indicating high levels of DPP/BMP signaling in these cells (Fig. 4, C and F). In wild-type testis, dpp is expressed at low levels (Fig. 4 G) (Kawase et al., 2004). Consistent with the notion that the JAK/STAT pathway can positively regulate dpp expression in the testis, dpp transcript is strongly up-regulated in testes ectopically expressing upd (Fig. 4, G and H). Together, these suggest that similar to the female germaria, JAK/STAT signaling may also regulate dpp expression in the male GSC niche.
|
| Materials and methods |
|---|
|
|
|---|
All crosses (except for stat92eTS and uas-Nact experiments) were maintained at room temperature. Ovaries were dissected and examined from 4-d-old females (unless otherwise specified). For stat92eTS (stat92e06346/stat92eF) experiments, crosses were set up at 18°C (permissive temperature). Larvae at mid-L3 stage were shifted to 31°C (nonpermissive temperature) until early pupal stage (cap cell formation period), and then shifted back to 20°C. Newly hatched females were shifted to 31°C and examined within 2–4 d after temperature shift (unless otherwise specified). For c587-GAL4; uas-Nact; stat92eTS experiments, crosses were set up at 20°C, mid-L3 stage larvae were shifted to 31°C until early pupal stage, then shifted back to 20°C. Newly hatched females were shifted to 31°C and were examined within 4 d.
Generation of flp-out clone using Ay-GAL4 system
This technique combines the Flippase(flp)/FRT system and the GAL4/UAS system (Ito et al., 1997). Before heat-shock treatment, the Act5C promoter-GAL4 fusion gene is interrupted by a FRT cassette containing yellow (y+) gene. Upon heat-shock treatment, flp gene is activated. Consequently, FLP excises the FRT cassette from the Act5C promoter-GAL4 region. As a result, the Act5C-GAL4 activity is reconstituted and drives uas-upd and uas-lacZ expression.
Generation of cap cell clone
C587-GAL4 is expressed in most, if not all, somatic cells including TFs, cap cells during niche formation in L3 stage (Song et al., 2007). C587-GLA4 was recombined onto uas-flp chromosome. C587-GAL4-uas-flp/Fm7; FRT82B-ubi-GFP/Tb stock was established and crossed to FRT82B-stat92ej6c8 to generate cap cell clones. Females were examined 7–10 d after hatching.
In situ hybridization
Primers CAAGGAGGCGCTCATCAAG and TAATACGACTCACTATAGGGAGACACCAGCAGTCCGTAGTTGC were used to amplify dpp antisense in situ template from a cDNA pool generated from ovaries and confirmed by DNA sequencing. Primers for sense control in situ template are TAATACGACTCACTATAGGGAGACAAGGAGGCGCTCATCAAG and CACCAGCAGTCCGTAGTTGC. Probes are labeled using Roche DIG RNA labeling kit (SP6/T7) following manufacturer's instructions.
Protocol for fluorescent in situ hybridization for Fig. 2 follows Wilkie et al. (1999) and Vanzo and Ephrussi (2002).
Protocol for in situ hybridization for Fig. 4 was modified from conventional method used in embryos with DIG-labelled probes followed by alkaline phosphatase (AP)–based histochemical detection. Testes were dissected in PBS, then fixed in 4% paraformaldehyde, 0.1M Hepes (pH 7.4) in PBS for 20 min, washed 5 times with PBT (0.1% Tween20), washed with 1:1 PBT/hybridization solution (50% formamide, 4x SSC, 1x Denhardts, 250 ug/ml tRAN, 250 ug/ml ssDNA, 50 ug/ml heparin, 0.1% Tween 20, and 5% dextran sulfate), rinsed 3x with PBT, prehybridized at 52°C for 1 h, hybridized overnight with DIG-labelled RNA probe at 52°C, rinsed with wash buffer (50% formamide, 2x SSC, and 0.1% Tween 20), washed overnight with wash buffer, rinsed with PBT, incubated with anti-DIG-AP (1:2,000; Roche) in PBT (with 3% BSA) for 2 h, washed with PBT for 1 h, rinsed with AP buffer (100 mM Tris, pH 9.5, 100 mM Nacl, 50 mM MgCl2, and 0.1% Tween 20), incubated in 0.3 ml AP buffer containing 2.7 µl NBT/X-gal (Roche) until desired signal appears and then stopped with PBT, removed PBT, and mounted in Vectashield mounting medium (Vector Laboratories).
Immunostaining
Antibody stainings of ovaries were modified from (Tomancak et al., 2000) as follows. Females were dissected in PBS, ovaries were collected and then fixed in 4% paraformaldehyde, 0.1M Hepes (pH 7.4) in PBS for 20 min, blocked with PBS + 0.1% Triton X-100 + 3% BSA for 1 h, probed with primary antibody for 4 h at room temperature, washed 3x with PBS + 0.1% Triton X-100, probed with fluorescence-labeled secondary antibody for 2 h at room temperature, washed 3x with PBS + 0.1% Triton X-100, stained with ToPro-3 for 10 min, and then mounted in Vectashield mounting medium (Vector Laboratories). The following antibodies were used: rabbit anti-β-galactosidase (1:5,000; Cappel), rabbit anti-PS1 (1: 1,000; Tanimoto et al., 2000), rat anti-BamC (1:500; McKearin and Ohlstein, 1995), rabbit anti-
-Spectrin (1:500; Byers et al., 1987), mouse anti-
-Spectrin (3A9, 1:50; DSHB), mouse anti-β-galactosidase (1:1,000; Promega), mouse anti-lamin C (LC28.26, 1:50; DSHB), and Alexa 555/643/488 conjugated goat anti–mouse and rabbit secondary antibodies were used to detect primary antibodies (1:500; Molecular Probes).
Microscopy
Samples were mounted in Vectashield mounting medium (Vector Laboratories). Images were collected using a microscope (Axioplan 2) with an upright confocal system (LSM510 META; both from Carl Zeiss, Inc.) at room temperature. The objective lens used was a Plan NEOFLUAR 40x/1.3 oil and the imaging software used was Zeiss LSM510 (both from Carl Zeiss, Inc). The confocal images were extracted with LSM510 browser software (Carl Zeiss, Inc.) then processed in Adobe Photoshop 7.0.1 with adjustments of brightness and contrast. Bars are indicated in each individual image.
Online supplemental material
Fig. S1 shows abnormal ovary development in larval stage (L3) when upd is ectopically expressed. Fig. S2 shows additional data to show that ectopic activation of JAK/STAT signaling induces the formation of ectopic GSC-like cells. Fig. S3 contains additional data show that dpp is mainly expressed in cap cells of female GSC niche, and this expression depends on JAK/STAT signaling. In addition, ectopic upd expression in S2 culture cells could activate luciferase reporters containing regulatory regions of dpp locus. Online supplemental material is available at http://www.jcb.org/cgi/content/full/jcb.200711022/DC1.
| Acknowledgments |
|---|
This work was supported by the Temasek Lifesciences Laboratory and the Singapore Millennium Foundation.
Submitted: 5 November 2007
Accepted: 24 January 2008
| References |
|---|
|
|
|---|
Arbouzova, N.I., and M.P. Zeidler. 2006. JAK/STAT signalling in Drosophila: insights into conserved regulatory and cellular functions. Development. 133:2605–2616.
Bach, E.A., L.A. Ekas, A. Ayala-Camargo, M.S. Flaherty, H. Lee, N. Perrimon, and G.H. Baeg. 2007. GFP reporters detect the activation of the Drosophila JAK/STAT pathway in vivo. Gene Expr. Patterns. 7:323–331.[CrossRef][Medline]
Baksa, K., T. Parke, L.L. Dobens, and C.R. Dearolf. 2002. The Drosophila STAT protein, stat92E, regulates follicle cell differentiation during oogenesis. Dev. Biol. 243:166–175.[CrossRef][Medline]
Bangi, E., and K. Wharton. 2006. Dpp and Gbb exhibit different effective ranges in the establishment of the BMP activity gradient critical for Drosophila wing patterning. Dev. Biol. 295:178–193.[CrossRef][Medline]
Byers, T.J., R. Dubreuil, D. Branton, D.P. Kiehart, and L.S. Goldstein. 1987. Drosophila spectrin. II. Conserved features of the alpha-subunit are revealed by analysis of cDNA clones and fusion proteins. J. Cell Biol. 105:2103–2110.
Casanueva, M.O., and E.L. Ferguson. 2004. Germline stem cell number in the Drosophila ovary is regulated by redundant mechanisms that control Dpp signaling. Development. 131:1881–1890.
Chen, D., and D. McKearin. 2003a. Dpp signaling silences bam transcription directly to establish asymmetric divisions of germline stem cells. Curr. Biol. 13:1786–1791.[CrossRef][Medline]
Chen, D., and D.M. McKearin. 2003b. A discrete transcriptional silencer in the bam gene determines asymmetric division of the Drosophila germline stem cell. Development. 130:1159–1170.
Decotto, E., and A.C. Spradling. 2005. The Drosophila ovarian and testis stem cell niches: similar somatic stem cells and signals. Dev. Cell. 9:501–510.[CrossRef][Medline]
Fuchs, E., T. Tumbar, and G. Guasch. 2004. Socializing with the neighbors: stem cells and their niche. Cell. 116:769–778.[CrossRef][Medline]
Fuller, M.T., and A.C. Spradling. 2007. Male and female Drosophila germline stem cells: two versions of immortality. Science. 316:402–404.
Gilboa, L., and R. Lehmann. 2004. How different is Venus from Mars? The genetics of germ-line stem cells in Drosophila females and males. Development. 131:4895–4905.
Hombria, J.C., and S. Brown. 2002. The fertile field of Drosophila Jak/STAT signalling. Curr. Biol. 12:R569–R575.[CrossRef][Medline]
Hou, S.X., Z. Zheng, X. Chen, and N. Perrimon. 2002. The Jak/STAT pathway in model organisms: emerging roles in cell movement. Dev. Cell. 3:765–778.[CrossRef][Medline]
Hou, X.S., M.B. Melnick, and N. Perrimon. 1996. Marelle acts downstream of the Drosophila HOP/JAK kinase and encodes a protein similar to the mammalian STATs. Cell. 84:411–419.[CrossRef][Medline]
Ito, K., W. Awano, K. Suzuki, Y. Hiromi, and D. Yamamoto. 1997. The Drosophila mushroom body is a quadruple structure of clonal units each of which contains a virtually identical set of neurones and glial cells. Development. 124:761–771.[Abstract]
Jiang, J., and G. Struhl. 1995. Protein kinase A and hedgehog signaling in Drosophila limb development. Cell. 80:563–572.[CrossRef][Medline]
Kai, T., and A. Spradling. 2003. An empty Drosophila stem cell niche reactivates the proliferation of ectopic cells. Proc. Natl. Acad. Sci. USA. 100:4633–4638.
Kawase, E., M.D. Wong, B.C. Ding, and T. Xie. 2004. Gbb/Bmp signaling is essential for maintaining germline stem cells and for repressing bam transcription in the Drosophila testis. Development. 131:1365–1375.
Kiger, A.A., D.L. Jones, C. Schulz, M.B. Rogers, and M.T. Fuller. 2001. Stem cell self-renewal specified by JAK-STAT activation in response to a support cell cue. Science. 294:2542–2545.
Lin, H. 2002. The stem-cell niche theory: lessons from flies. Nat. Rev. Genet. 3:931–940.[CrossRef][Medline]
Lin, H., L. Yue, and A.C. Spradling. 1994. The Drosophila fusome, a germline-specific organelle, contains membrane skeletal proteins and functions in cyst formation. Development. 120:947–956.[Abstract]
Margolis, J., and A. Spradling. 1995. Identification and behavior of epithelial stem cells in the Drosophila ovary. Development. 121:3797–3807.[Abstract]
McKearin, D., and B. Ohlstein. 1995. A role for the Drosophila bag-of-marbles protein in the differentiation of cystoblasts from germline stem cells. Development. 121:2937–2947.[Abstract]
Nellen, D., M. Affolter, and K. Basler. 1994. Receptor serine/threonine kinases implicated in the control of Drosophila body pattern by decapentaplegic. Cell. 78:225–237.[CrossRef][Medline]
Ruberte, E., T. Marty, D. Nellen, M. Affolter, and K. Basler. 1995. An absolute requirement for both the type II and type I receptors, punt and thick veins, for dpp signaling in vivo. Cell. 80:889–897.[CrossRef][Medline]
Sekelsky, J.J., S.J. Newfeld, L.A. Raftery, E.H. Chartoff, and W.M. Gelbart. 1995. Genetic characterization and cloning of mothers against dpp, a gene required for decapentaplegic function in Drosophila melanogaster. Genetics. 139:1347–1358.[Abstract]
Singh, S.R., W. Zhen, Z. Zheng, H. Wang, S.W. Oh, W. Liu, B. Zbar, L.S. Schmidt, and S.X. Hou. 2006. The Drosophila homolog of the human tumor suppressor gene BHD interacts with the JAK-STAT and Dpp signaling pathways in regulating male germline stem cell maintenance. Oncogene. 25:5933–5941.[CrossRef][Medline]
Song, X., C.H. Zhu, C. Doan, and T. Xie. 2002. Germline stem cells anchored by adherens junctions in the Drosophila ovary niches. Science. 296:1855–1857.
Song, X., M.D. Wong, E. Kawase, R. Xi, B.C. Ding, J.J. McCarthy, and T. Xie. 2004. Bmp signals from niche cells directly repress transcription of a differentiation-promoting gene, bag of marbles, in germline stem cells in the Drosophila ovary. Development. 131:1353–1364.
Song, X., G.B. Call, D. Kirilly, and T. Xie. 2007. Notch signaling controls germline stem cell niche formation in the Drosophila ovary. Development. 134:1071–1080.
Spradling, A.C., D. Stern, A. Beaton, E.J. Rhem, T. Laverty, N. Mozden, S. Misra, and G.M. Rubin. 1999. The Berkeley Drosophila Genome Project gene disruption project: Single P-element insertions mutating 25% of vital Drosophila genes. Genetics. 153:135–177.
Tabata, T., and Y. Takei. 2004. Morphogens, their identification and regulation. Development. 131:703–712.
Tanimoto, H., S. Itoh, P. ten Dijke, and T. Tabata. 2000. Hedgehog creates a gradient of DPP activity in Drosophila wing imaginal discs. Mol. Cell. 5:59–71.[CrossRef][Medline]
Tomancak, P., F. Piano, V. Riechmann, K.C. Gunsalus, K.J. Kemphues, and A. Ephrussi. 2000. A Drosophila melanogaster homologue of Caenorhabditis elegans par-1 acts at an early step in embryonic-axis formation. Nat. Cell Biol. 2:458–460.[CrossRef][Medline]
Tracey, W.D. Jr., X. Ning, M. Klingler, S.G. Kramer, and J.P. Gergen. 2000. Quantitative analysis of gene function in the Drosophila embryo. Genetics. 154:273–284.
Tsuneizumi, K., T. Nakayama, Y. Kamoshida, T.B. Kornberg, J.L. Christian, and T. Tabata. 1997. Daughters against dpp modulates dpp organizing activity in Drosophila wing development. Nature. 389:627–631.[CrossRef][Medline]
Tulina, N., and E. Matunis. 2001. Control of stem cell self-renewal in Drosophila spermatogenesis by JAK-STAT signaling. Science. 294:2546–2549.
Vanzo, N.F., and A. Ephrussi. 2002. Oskar anchoring restricts pole plasm formation to the posterior of the Drosophila oocyte. Development. 129:3705–3714.
Ward, E.J., H.R. Shcherbata, S.H. Reynolds, K.A. Fischer, S.D. Hatfield, and H. Ruohola-Baker. 2006. Stem cells signal to the niche through the Notch pathway in the Drosophila ovary. Curr. Biol. 16:2352–2358.[CrossRef][Medline]
Wharton, K.A., R.P. Ray, and W.M. Gelbart. 1993. An activity gradient of decapentaplegic is necessary for the specification of dorsal pattern elements in the Drosophila embryo. Development. 117:807–822.[Abstract]
Wharton, K., R.P. Ray, S.D. Findley, H.E. Duncan, and W.M. Gelbart. 1996. Molecular lesions associated with alleles of decapentaplegic identify residues necessary for TGF-beta/BMP cell signaling in Drosophila melanogaster. Genetics. 142:493–505.[Abstract]
Wilkie, G.S., A.W. Shermoen, P.H. O'Farrell, and I. Davis. 1999. Transcribed genes are localized according to chromosomal position within polarized Drosophila embryonic nuclei. Curr. Biol. 9:1263–1266.[CrossRef][Medline]
Xie, T., and A.C. Spradling. 1998. decapentaplegic is essential for the maintenance and division of germline stem cells in the Drosophila ovary. Cell. 94:251–260.[CrossRef][Medline]
Xie, T., and A.C. Spradling. 2000. A niche maintaining germ line stem cells in the Drosophila ovary. Science. 290:328–330.
Xie, T., E. Kawase, D. Kirilly, and M.D. Wong. 2005. Intimate relationships with their neighbors: tales of stem cells in Drosophila reproductive systems. Dev. Dyn. 232:775–790.[CrossRef][Medline]
Xu, T., and G.M. Rubin. 1993. Analysis of genetic mosaics in developing and adult Drosophila tissues. Development. 117:1223–1237.[Abstract]
Xu, X., Z. Yin, J.B. Hudson, E.L. Ferguson, and M. Frasch. 1998. Smad proteins act in combination with synergistic and antagonistic regulators to target Dpp responses to the Drosophila mesoderm. Genes Dev. 12:2354–2370.
Yamashita, Y.M., M.T. Fuller, and D.L. Jones. 2005. Signaling in stem cell niches: lessons from the Drosophila germline. J. Cell Sci. 118:665–672.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|