|
||
Report |
Moesin and its activating kinase Slik are required for cortical stability and microtubule organization in mitotic cells
Correspondence to Sébastien Carreno: carreno{at}cict.fr
Cell division requires cell shape changes involving the localized reorganization of cortical actin, which must be tightly linked with chromosome segregation operated by the mitotic spindle. How this multistep process is coordinated remains poorly understood. In this study, we show that the actin/membrane linker moesin, the single ERM (ezrin, radixin, and moesin) protein in Drosophila melanogaster, is required to maintain cortical stability during mitosis. Mitosis onset is characterized by a burst of moesin activation mediated by a Slik kinase–dependent phosphorylation. Activated moesin homogenously localizes at the cortex in prometaphase and is progressively restricted at the equator in later stages. Lack of moesin or inhibition of its activation destabilized the cortex throughout mitosis, resulting in severe cortical deformations and abnormal distribution of actomyosin regulators. Inhibiting moesin activation also impaired microtubule organization and precluded stable positioning of the mitotic spindle. We propose that the spatiotemporal control of moesin activation at the mitotic cortex provides localized cues to coordinate cortical contractility and microtubule interactions during cell division.
S. Carreno's present address is Institute for Research in Immunology and Cancer, Université de Montréal, Montréal, Québec H2W 1R7, Canada.
Abbreviations used in this paper: dsRNA, double-stranded RNA; F-actin, filamentous actin; p-moesin, phosphorylated moesin.
| Introduction |
|---|
|
|
|---|
ERM (ezrin, radixin, and moesin) proteins, which link actin with membrane proteins in a signal-dependent manner, participate in the regulation of cortical cohesion in interphase (Bretscher et al., 2002; Polesello et al., 2002; Charras et al., 2005; Hughes and Fehon, 2007). During mitosis, ERM proteins have long been known to be activated at the cleavage furrow (Sato et al., 1991), but their potential role in cell division was presumably hampered by functional redundancy between ezrin, radixin, and moesin in vertebrates. Studies in Drosophila melanogaster, which encodes a unique ERM gene (dmoesin or moesin), have revealed roles for ERM proteins in cell polarity (Polesello et al., 2002; Pilot et al., 2006), epithelial integrity (Speck et al., 2003; Hipfner et al., 2004) and light response (Chorna-Ornan et al., 2005). Here, we show that the activation of moesin is critical to maintain cortical stability, spindle organization, and proper spindle position in mitotic cells.
| Results and discussion |
|---|
|
|
|---|
Besides a low rate of cytokinesis failure, the main defects resulting from efficient moesin inhibition in S2 cells were observed in earlier mitotic stages. First, we noticed an increased proportion of cells in metaphase compared with the other stages of cell division, showing that moesin depletion caused a delay in anaphase onset (Fig. 1 A). Second, live cell imaging revealed a role of moesin in cell shape changes throughout cell division. The volume of moesin-depleted cells in metaphase was significantly increased when compared with controls (Fig. 1 and Fig. S2 A, available at http://www.jcb.org/cgi/content/full/jcb.200709161/DC1). Furthermore, as early as prophase and until telophase, moesin-depleted cells displayed large and transient cytoplasmic bulges that deformed the mitotic cortex (Fig. 1, B and C; and see Fig. 4 B). These results suggest that moesin depletion impairs cortical integrity and rigidity. Interestingly, ezrin was shown to be critical for the resorption of short-lived blebs induced by the alteration of cortical tension in mammalian cells (Charras et al., 2005). Consistent with a role of moesin in the regulation of cortical contractility during mitosis, localization of contractile factors at the cortex was abnormal in dividing moesin-depleted cells. Unlike wild-type conditions, filamentous actin (F-actin) and myosin II were distributed irregularly, with an accumulation at cortical deformations in pro/metaphase, and were not properly restricted at the equator in ana/telophase of moesin-depleted cells (Fig. 1, C and D). Live analysis showed transient accumulation of the myosin regulatory light chain Sqh-GFP at ectopic sites of the metaphase cortex in moesin-depleted cells (Fig. 1 E and Videos 3 and 4). Previous work indicated that the increased cortical tension characteristic of early mitosis depends on the activity of the small GTPase Rho (Maddox and Burridge, 2003). We found that RhoA was abnormally localized in the absence of moesin. RhoA was unevenly distributed at the metaphase cortex and accumulated in the cortical deformations induced upon moesin depletion until later stages of cell division (Fig. 1 F). Consistently, the occurrence of cortical bulges was reduced (more than threefold) by the simultaneous depletion of RhoA along with moesin in S2 cells (Fig. S2). However, cells depleted for both RhoA and moesin still displayed highly abnormal mitosis, including increased cell volume and a high proportion of multinucleated cells (Fig. S2). Numerous studies have demonstrated a complex cross talk between Rho and ERM proteins (Bretscher et al., 2002) ranging from positive (Verdier et al., 2006) to antagonistic interactions (Speck et al., 2003; Hipfner et al., 2004) in different Drosophila tissues. Therefore, future studies will be required to further decipher the interactions that might exist between ERM proteins and the RhoA pathway during cell division. All together, our data show that moesin is required for the dynamic distribution of actomyosin contractility at the cortex to account for cell shape transformations during cell division.
|
|
Absence of moesin or alteration of its activation disrupts spindle organization
The alteration of moesin activity also affected organization and stable positioning of microtubule components of the mitotic spindle from metaphase to ana/telophase. Cortical deformations were frequently associated with abnormally long astral microtubules, as observed both in fixed and living cells (Fig. 3, A and C).
These data suggest that astrals might influence contractility of the cortex or, alternatively, keep growing until they meet the deformed cell cortex. In addition, the distance between the two metaphase centrosomes was significantly reduced, leading to a smaller spindle length (Figs. 3, A and B; and S2 A). These abnormal spindles were also often asymmetrical, with one of the two asters clearly more prominent than the other (Fig. 3, A and B). Although the center of the metaphase spindle was always close to the geometric center in wild type, spindles were off center in 90% of moesin-depleted cells (Fig. 3, A and B). Live imaging further revealed a continuous variation of the spindle orientation in the absence of moesin. It started during the elongated metaphase and occurred until telophase (Fig. 3 C, Fig. 4 B, and Videos 6 and 7, available at http://www.jcb.org/cgi/content/full/jcb.200709161/DC1).
This instability in spindle positioning appeared unlikely to only result from a general relaxation of physical constraints (Fig. S2). It presumably involved unregulated actin-mediated contractility because it was suppressed by simultaneous treatment with RhoA-dsRNA or an F-actin–inhibiting drug (Figs. 3 C and S2 and Video 8). Finally, we observed that the absence of Slik activity mimicked the effects of moesin loss of function on the organization of the mitotic spindle. Slik depletion led to abnormal astral microtubules, spindle off-centering, as well as to destabilization of the spindle orientation from an elongated metaphase to ana/telophase (Figs. 2 F and S2 C). Therefore, these data show that Slik-mediated activation of moesin at the mitotic cortex is required for proper organization of the mitotic spindle.
|
|
Conclusion
Our results indicate that spatiotemporal regulation of moesin by the Slik kinase contributes to organization of the actomyosin cortex during mitosis to account for the stereotyped cell shape transformations that occur throughout cell division. In addition, our data suggest that homogenous distribution of activated moesin at the metaphase cortex is important for the proper positioning of the spindle. This model predicts that uneven ERM phosphorylation in metaphase could influence spindle orientation, a hypothesis consistent with the recent finding that extracellular matrix can guide orientation of the spindle, correlating with restricted localization of activated ERM at the cell cortex (Thery et al., 2005). Finally, activated moesin might directly or indirectly affect additional aspects of cell division because the absence of moesin or Slik lead to abnormal microtubule spindles with an asymmetrical organization, a smaller length, and delayed anaphase onset. It is possible that these spindle defects contribute to extend the metaphase stage (e.g., through activation of mitotic checkpoints).
Thus, these results shed new light on the cross talk that occurs between microtubules and the cell cortex during mitosis. The importance of ERM proteins for normal mitosis may be relevant to human cancers that involve deregulated ERM activity (Yu et al., 2004).
| Materials and methods |
|---|
|
|
|---|
DH/CyO, UAS-dsRNA Moe/CyO, and MS1096-Gal4/FM7. To define the spermatid phenotype of cytokinesis in moesin and Slik mutants, late larval or early pupal testes were examined in living squashed preparations by phase-contrast microscopy according to Giansanti et al. (2004).
Genetic interactions in wings
UAS-Pbl
DH and/or UAS-dsRNA moesin were driven at 18°C by the dorsal wing–specific driver MS1096. Quantification of the MWH (multiwing hairs) phenotype and cytokinesis defects was performed in the third posterior cell compartment under the posterior cross vein as described previously (Echard and O'Farrell, 2003).
Cell culture and dsRNA treatment
Drosophila S2 cells were grown in FCS-supplemented Schneider's medium (Invitrogen). dsRNAs were produced and used as previously described (Echard et al., 2004). For moesin and Slik extinction, we used at least two nonoverlapping regions to rule out off-target effects. Moesin-T559A and -T559D (Polesello et al., 2002) were subcloned into pAc5.1. For immunofluorescence analysis, cells were cultured for 10 min on glass coverslips coated with 10 µg concanavalin A (Sigma-Aldrich), fixed in 4% formaldehyde (except for p-moesin and RhoA staining, in which the cells were fixed in 10% TCA), and processed for immunostaining (Echard et al., 2004). We used antimoesin (Polesello et al., 2002) at 1:5,000, anti–p-moesin (Karagiosis and Ready, 2004) at 1:500, anti–
-tubulin (Sigma-Aldrich) at 1:200, anti-RhoA (Magie et al., 2002) at 1:50, anti–myosin-Hc (obtained from R. Karess, Centre National de la Recherche Scientifique/Centre de Genetique Moleculaire, Gif-Sur-Yvette, France) at 1:200, and anti-Slik (Hipfner et al., 2004) at 1:100. AlexaFluor488, AlexaFluor546, and Cy5-conjugated secondary antibodies (Invitrogen) were used at 1:500. Texas red-X phalloidin (Invitrogen) was used at 1:200 for F-actin staining. The primer sequences used are as follows: Moe_1 (forward, AACGCCAAGGATGAGGAGAC; reverse, ACGCTTTGTGTTGCCCTTAC), Moe_2 (forward, AGGAGCTGATCCAGGACATTACA; reverse, CTGCTGTTTGGCATTCTTCTC), Moe_3 (forward, AGACGCTTTGTCTCCTCATCC; reverse, GAAAAGAAGCAGCAGGAGTACG), Slik_1 (forward, ACTTTGTCAAAAAGGGTAAGGC; reverse, ACCTCACTTTCATCCAGTTTGC), Slik_2 (forward, TAGGACAGCAGCAATGAGCTGG; reverse, TTCACGTAGCTCCTGCTTACGG), and RhoA (forward, ATCAAGAACAACCAGAACATCG; reverse, TTTGTTTTGTGTTTAGTTCGGC).
Imaging of fixed samples and time-lapse recording
Images of fixed cells mounted in Vectashield (Vector Laboratories) were acquired using a microscope (DMIRE2; Leica) with voxels collected at 104-nm lateral and 200-nm axial intervals using a stage (PIFOC piezo; Physik Instrumente) and a cooled camera (MicroMax-1300Y-HS; Princeton Instruments). Deconvolution was performed using Huygens software (Scientific Volume Imaging) on a Silicon Graphics Origin computer.
Video microscopy (Eggert et al., 2006; Hickson et al., 2006) was performed using stable cell lines expressing histone-GFP, tubulin-GFP, or Spaghetti-squash-GFP plated directly on 96-well glass-bottom plates (Greiner) at 25°C and imaged with a microscope (DMIRBE; Leica) and a MicroMax cooled CCD camera controlled by MetaMorph 6.1 software (MDS Analytical Technologies). Z series of five 1-µm sections were used to generate maximum intensity projections, and images were processed using Huygens software. All images were prepared for publication using Photoshop software (Adobe).
Online supplemental material
Fig. S1 shows that the reduction of moesin activity led to mild cytokinesis defects in vivo and in S2 cultured cells. Fig. S2 shows quantification of the mitotic defects observed in S2 cells after moesin depletion and other treatments. Videos 1 and 2 show phase-contrast and histone-GFP in control S2 cells (Video 1) and in moesin-depleted S2 cells (6 d of dsRNA treatment; Video 2). Videos 3 and 4 show Sqh-GFP in control S2 cells (Video 3) and in moesin-depleted S2 cells (6 d of dsRNA treatment; Video 4). Videos 5 and 6 show tubulin-GFP in Slik-depleted S2 cells (6 d of dsRNA treatment; Video 5) and in control S2 cells (Video 6). Videos 7 and 8 show tubulin-GFP in moesin-depleted S2 cells (6 d of dsRNA treatment; Video 7) and in moesin + RhoA double-depleted S2 cells (moesin, 6 d of dsRNA treatment; RhoA, 3 d of dsRNA treatment; Video 8). Online supplemental material is available at http://www.jcb.org/cgi/content/full/jcb.200709161/DC1.
| Acknowledgments |
|---|
This work was supported by the Ministère de la Recherche et de la Technologie (grant to I. Kouranti), the American Heart Association Western States Affiliate (grant to E.S. Glusman), National Institutes of Health (grant 1R01GM62276 to M.T. Fuller), the Association pour la Recherche sur le Cancer (no. 3832; grant to F. Payre), the Fondation pour la Recherche Médicale (fellowships to S. Carreno and programme équipe 2005), Agence Nationale de Recherche (grant JC07-188506 to A. Echard), and by a Career Development Award (grant HFSP CDA-2006 to S. Carreno).
Note added in proof. A recent study from Kunda et al. (2008) reports a similar role of dmoesin and its regulator Slik in the cortical organization of another Drosophila cell line during division.
Submitted: 25 September 2007
Accepted: 24 January 2008
| References |
|---|
|
|
|---|
Bement, W.M., H.A. Benink, and G. von Dassow. 2005. A microtubule-dependent zone of active RhoA during cleavage plane specification. J. Cell Biol. 170:91–101.
Bettencourt-Dias, M., R. Giet, R. Sinka, A. Mazumdar, W.G. Lock, F. Balloux, P.J. Zafiropoulos, S. Yamaguchi, S. Winter, R.W. Carthew, et al. 2004. Genome-wide survey of protein kinases required for cell cycle progression. Nature. 432:980–987.[CrossRef][Medline]
Bjorklund, M., M. Taipale, M. Varjosalo, J. Saharinen, J. Lahdenpera, and J. Taipale. 2006. Identification of pathways regulating cell size and cell-cycle progression by RNAi. Nature. 439:1009–1013.[CrossRef][Medline]
Bretscher, A., K. Edwards, and R.G. Fehon. 2002. ERM proteins and merlin: integrators at the cell cortex. Nat. Rev. Mol. Cell Biol. 3:586–599.[CrossRef][Medline]
Canman, J.C., L.A. Cameron, P.S. Maddox, A. Straight, J.S. Tirnauer, T.J. Mitchison, G. Fang, T.M. Kapoor, and E.D. Salmon. 2003. Determining the position of the cell division plane. Nature. 424:1074–1078.[CrossRef][Medline]
Charras, G.T., J.C. Yarrow, M.A. Horton, L. Mahadevan, and T.J. Mitchison. 2005. Non-equilibration of hydrostatic pressure in blebbing cells. Nature. 435:365–369.[CrossRef][Medline]
Chorna-Ornan, I., V. Tzarfaty, G. Ankri-Eliahoo, T. Joel-Almagor, N.E. Meyer, A. Huber, F. Payre, and B. Minke. 2005. Light-regulated interaction of Dmoesin with TRP and TRPL channels is required for maintenance of photoreceptors. J. Cell Biol. 171:143–152.
Coscoy, S., F. Waharte, A. Gautreau, M. Martin, D. Louvard, P. Mangeat, M. Arpin, and F. Amblard. 2002. Molecular analysis of microscopic ezrin dynamics by two-photon FRAP. Proc. Natl. Acad. Sci. USA. 99:12813–12818.
Echard, A., and P.H. O'Farrell. 2003. The degradation of two mitotic cyclins contributes to the timing of cytokinesis. Curr. Biol. 13:373–383.[CrossRef][Medline]
Echard, A., G.R. Hickson, E. Foley, and P.H. O'Farrell. 2004. Terminal cytokinesis events uncovered after an RNAi screen. Curr. Biol. 14:1685–1693.[CrossRef][Medline]
Eggert, U.S., A.A. Kiger, C. Richter, Z.E. Perlman, N. Perrimon, T.J. Mitchison, and C.M. Field. 2004. Parallel chemical genetic and genome-wide RNAi screens identify cytokinesis inhibitors and targets. PLoS Biol. 2:e379.[CrossRef][Medline]
Eggert, U.S., T.J. Mitchison, and C.M. Field. 2006. Animal cytokinesis: from parts list to mechanisms. Annu. Rev. Biochem. 75:543–566.[CrossRef][Medline]
Giansanti, M.G., R.M. Farkas, S. Bonaccorsi, D.L. Lindsley, B.T. Wakimoto, M.T. Fuller, and M. Gatti. 2004. Genetic dissection of meiotic cytokinesis in Drosophila males. Mol. Biol. Cell. 15:2509–2522.
Glotzer, M. 2005. The molecular requirements for cytokinesis. Science. 307:1735–1739.
Hickson, G.R., A. Echard, and P.H. O'Farrell. 2006. Rho-kinase controls cell shape changes during cytokinesis. Curr. Biol. 16:359–370.[CrossRef][Medline]
Hipfner, D.R., N. Keller, and S.M. Cohen. 2004. Slik Sterile-20 kinase regulates Moesin activity to promote epithelial integrity during tissue growth. Genes Dev. 18:2243–2248.
Hughes, S.C., and R.G. Fehon. 2006. Phosphorylation and activity of the tumor suppressor Merlin and the ERM protein Moesin are coordinately regulated by the Slik kinase. J. Cell Biol. 175:305–313.
Hughes, S.C., and R.G. Fehon. 2007. Understanding ERM proteins–the awesome power of genetics finally brought to bear. Curr. Opin. Cell Biol. 19:51–56.[CrossRef][Medline]
Jankovics, F., R. Sinka, T. Lukacsovich, and M. Erdelyi. 2002. MOESIN crosslinks actin and cell membrane in Drosophila oocytes and is required for OSKAR anchoring. Curr. Biol. 12:2060–2065.[CrossRef][Medline]
Karagiosis, S.A., and D.F. Ready. 2004. Moesin contributes an essential structural role in Drosophila photoreceptor morphogenesis. Development. 131:725–732.
Kunda, P., A.E. Pelling, T. Liu, and B. Baum. 2008. Moesin controls cortical rigidity, cell rounding, and spindle morphogenesis during mitosis. Curr. Biol. 18:91–101.[CrossRef][Medline]
Maddox, A.S., and K. Burridge. 2003. RhoA is required for cortical retraction and rigidity during mitotic cell rounding. J. Cell Biol. 160:255–265.
Magie, C.R., D. Pinto-Santini, and S.M. Parkhurst. 2002. Rho1 interacts with p120ctn and alpha-catenin, and regulates cadherin-based adherens junction components in Drosophila. Development. 129:3771–3782.[Medline]
Matzke, R., K. Jacobson, and M. Radmacher. 2001. Direct, high-resolution measurement of furrow stiffening during division of adherent cells. Nat. Cell Biol. 3:607–610.[CrossRef][Medline]
Pilot, F., J.M. Philippe, C. Lemmers, and T. Lecuit. 2006. Spatial control of actin organization at adherens junctions by a synaptotagmin-like protein Btsz. Nature. 442:580–584.[CrossRef][Medline]
Polesello, C., I. Delon, P. Valenti, P. Ferrer, and F. Payre. 2002. Dmoesin controls actin-based cell shape and polarity during Drosophila melanogaster oogenesis. Nat. Cell Biol. 4:782–789.[CrossRef][Medline]
Sato, N., S. Yonemura, T. Obinata, S. Tsukita, and S. Tsukita. 1991. Radixin, a barbed end-capping actin-modulating protein, is concentrated at the cleavage furrow during cytokinesis. J. Cell Biol. 113:321–330.
Speck, O., S.C. Hughes, N.K. Noren, R.M. Kulikauskas, and R.G. Fehon. 2003. Moesin functions antagonistically to the Rho pathway to maintain epithelial integrity. Nature. 421:83–87.[CrossRef][Medline]
Strickland, L.I., E.J. Donnelly, and D.R. Burgess. 2005a. Induction of cytokinesis is independent of precisely regulated microtubule dynamics. Mol. Biol. Cell. 16:4485–4494.
Strickland, L.I., Y. Wen, G.G. Gundersen, and D.R. Burgess. 2005b. Interaction between EB1 and p150glued is required for anaphase astral microtubule elongation and stimulation of cytokinesis. Curr. Biol. 15:2249–2255.[CrossRef][Medline]
Thery, M., V. Racine, A. Pepin, M. Piel, Y. Chen, J.B. Sibarita, and M. Bornens. 2005. The extracellular matrix guides the orientation of the cell division axis. Nat. Cell Biol. 7:947–953.[CrossRef][Medline]
Verdier, V., J.E. Johndrow, M. Betson, G.C. Chen, D.A. Hughes, S.M. Parkhurst, and J. Settleman. 2006. Drosophila Rho-kinase (DRok) is required for tissue morphogenesis in diverse compartments of the egg chamber during oogenesis. Dev. Biol. 297:417–432.[CrossRef][Medline]
Yu, Y., J. Khan, C. Khanna, L. Helman, P.S. Meltzer, and G. Merlino. 2004. Expression profiling identifies the cytoskeletal organizer ezrin and the developmental homeoprotein Six-1 as key metastatic regulators. Nat. Med. 10:175–181.[CrossRef][Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|