|
|
|
|
|
|
|
||
Report |
Tektin 2 is required for central spindle microtubule organization and the completion of cytokinesis
Correspondence to Edward H. Hinchcliffe: Hinchcliffe.3{at}nd.edu
During anaphase, the nonkinetochore microtubules in the spindle midzone become compacted into the central spindle, a structure which is required to both initiate and complete cytokinesis. We show that Tektin 2 (Tek2) associates with the spindle poles throughout mitosis, organizes the spindle midzone microtubules during anaphase, and assembles into the midbody matrix surrounding the compacted midzone microtubules during cytokinesis. Tek2 small interfering RNA (siRNA) disrupts central spindle organization and proper localization of MKLP1, PRC1, and Aurora B to the midzone and prevents the formation of a midbody matrix. Video microscopy revealed that loss of Tek2 results in binucleate cell formation by aberrant fusion of daughter cells after cytokinesis. Although a myosin II inhibitor, blebbistatin, prevents actin-myosin contractility, the microtubules of the central spindle are compacted. Strikingly, Tek2 siRNA abolishes this actin-myosin–independent midzone microtubule compaction. Thus, Tek2-dependent organization of the central spindle during anaphase is essential for proper midbody formation and the segregation of daughter cells after cytokinesis.
T.M. Durcan's present address is Montreal Neurological Institute, McGill University, Montreal, Quebec, Canada H3A 2B4.
T. Rao's present address is Dept. of Biochemistry, McGill University, Montreal, Quebec, Canada H3G 1V6.
N.S. Collins' present address is Program in Genetic Counseling, University of Arkansas at Little Rock, Little Rock, AR 72204.
E.K. Tribble's present address is Dept. of Cell and Developmental Biology, University of North Carolina, Chapel Hill, NC 27599.
Abbreviations used in this paper: KD, knockdown; SCR, scrambled; UTR, untranslated region.
© 2008 Durcan et al. This article is distributed under the terms of an Attribution–Noncommercial–Share Alike–No Mirror Sites license for the first six months after the publication date (see http://www.jcb.org/misc/terms.shtml). After six months it is available under a Creative Commons License (Attribution–Noncommercial–Share Alike 3.0 Unported license, as described at http://creativecommons.org/licenses/by-nc-sa/3.0/).
 |
Introduction |
|---|
 TopAbstract Introduction Results and discussionMaterials and methodsReferences |
|---|
Several key mitotic regulators have been shown to redistribute to the central spindle during anaphase and then become highly organized into the midbody during cytokinesis (Skop et al., 2004; for review see Otegui et al., 2005). These include the centralspindlin complex, Polo-like kinase, the microtubule bundling protein PRC1, and the chromosome passenger complex, containing INCENP, survivin, borealin, and Aurora B kinase (for reviews see Adams et al., 2001; Vader et al., 2006). Disruption of these midzone components results in the lack of proper midbody assembly and failure of cytokinesis (Mishima et al., 2002; Mollinari et al., 2002; Matuliene, and Kuriyama, 2002).
Tektin 2 (the mammalian homologue of the sea urchin tektin B protein) was previously proposed to be a component of the mitotic spindle matrix (Pickett-Heaps et al., 1984; Steffen, and Linck, 1992), and yet little is known about its function in somatic cells (Setter et al., 2006). Tektins were originally identified as structural components of axonemal doublet microtubules in cilia and flagella (Linck, 1976; Linck, and Langevin, 1982). Tektins represent a family of elongated proteins that assemble into extended filaments, which are similar in structure to intermediate filaments but tektins are distinct from intermediate filaments proteins (Setter et al., 2006). Previous work revealed that one member of the tektin family, tektin B (i.e., tektin 2), associated with the centrosomes and the spindle remnant after Ca2+-induced microtubule depolymerization (Steffen, and Linck, 1992; Steffen et al., 1994). However, little is known about the function of tektin proteins in mammalian somatic cells, particularly during mitosis.
|
Results and discussion |
|---|
|
TopAbstractIntroductionResults and discussionMaterials and methodsReferences |
|---|
|
To determine whether Tek2 played a role during spindle assembly/cytokinesis, we knocked down Tek2 expression with siRNAs. Depletion of Tek2 protein by >90% did not prevent bipolar mitotic spindles from forming but led to an increase in binucleate interphase cells (Fig. 2). In cells transfected with siRNA constructs unique to either the untranslated region (UTR) or the ORF of mouse Tek2, the number of binucleate cells increased to 18 and 29%, respectively, compared with 8% in cells transfected with scrambled (SCR) Tek2 siRNA and 5% in untransfected cells (Fig. 2 C).
|
-tubulin at the midbody region. In other cases, there was no pronounced connection between the two daughter cells before refusion (Fig. 2 A). This suggests that the lack of Tek2 allowed the microtubule plus ends of each daughter to interact beyond the midzone overlap, leading to the fusion of daughter cells. We next examined the localization of the previously characterized central spindle proteins Aur B, MKLP1, and PRC1. Imaging of cells transfected with the SCR Tek2 siRNA construct (SCR control cells) revealed that the localization of these proteins to the central spindle was not affected by the transfection/selection process (Fig. 3, A, D, and G) compared with untransfected controls (Fig. S2, available at http://www.jcb.org/cgi/content/full/jcb.200711160/DC1).
|
To further examine the role of Tek2 in midbody organization, we used blebbistatin, a small molecule inhibitor that is specific for nonmuscle myosin II (Straight et al., 2003). In blebbistatin, cells enter mitosis, proceed through anaphase, and build a normal central spindle. However, because they lack actin/myosin contractility, the cleavage furrow does not contract (Straight et al., 2003). These cells eventually exit mitosis and reform interphase nuclei without cleaving. The two daughter cells remain transiently interconnected by a central spindle. This allows for the observation of postanaphase events of central spindle microtubule organization without the contraction of the cleavage furrow, which obscures the morphological features of the midzone structure.
Pairs of interconnected daughter cells with decondensed chromosomes were identified. These cells had exited mitosis without cleaving, but the pair of interphase daughter cells remained connected by an intact central spindle (Fig. 4, A and B). Interestingly, the central spindle in these pairs of SCR control cells maintained their characteristic compact shape and also contained the presumptive midbody region, which is indicated by a central area that excludes anti-tubulin staining, even in the absence of a cleavage furrow (Fig. 4, A and B, arrows). In these cells, Tek2 was concentrated in this presumptive midbody region, as was Aur B, which was used as a marker for midzone organization (Fig. 4, A and B, arrows). This suggests that during normal anaphase (elaborated by blebbistatin treatment), there is an activity that functions to bundle and compact the central spindle independently of actin-myosin contractility induced by the cleavage furrow, which is similar to that previously observed (Martineau et al., 1995; Straight et al., 2003; Yüce et al., 2005).
|
To determine if Tek2 localization to the midbody matrix required intact microtubules, CHO cells were treated with blebbistatin to elaborate postanaphase cells. The blebbistatin was then washed out in the presence of colcemid to depolymerize the postanaphase microtubule network (Fig. 5). Colcemid treatment of control cells in either interphase or mitosis did not disrupt Tek2 localization to the centrosome (Fig. 5, A and B). In blebbistatin-released anaphase cells, microtubule depolymerization with colcemid induced the loss of Tek2 to the midzone/midbody region (Fig. 5, C–E). These observations reveal that Tek2 localization to the midzone and midbody is dependent on intact microtubules. Interestingly, in some cells the midzone microtubule depolymerized, and a cleavage furrow formed as the blebbistatin was washed out in the presence of colcemid (Fig. 5 E). Midzone microtubules are thought to be highly resistant to drug-induced depolymerization, although they can depolymerize in the presence of cold and colcemid or nocodazole (Uetake and Sluder, 2007), and their continued presence is required to allow ingression of the cleavage furrow (Wheatley and Wang, 1996). Perhaps the phenomenon we observed here is related to the timing of washout. The presence of the midzone during prolonged anaphase may obviate the need for intact midzone microtubules, as is seen for cell washed out of cytochalasin (Martineau et al., 1995).
|
Tektins are evolutionarily conserved from Chlamydomonas reinhardtii to human, including both Caenorhabditis elegans and Drosophila melanogaster, and are essential for many developmental processes, such as fertilization and neuronal development, which are dependent upon cilia and flagella (Norrander et al., 1998; Keller et al., 2005; Setter et al., 2006). During axoneme/basal body assembly, tektins directly interact with microtubules, imparting the intricate arrangement of doublet/triplet microtubules necessary for these organelles (Nojima et al., 1995; Hinchcliffe and Linck, 1998). In this paper, we show that in somatic cells, Tek2 plays a similar structural role in building the central spindle, and our results suggest that tektin may contribute to providing the complex morphology and inherent stability to the midzone microtubules necessary during cytokinesis.
Midzone microtubules form a characteristic overlap and, as anaphase proceeds, the length of the plus-end overlap decreases (Saxton and McIntosh, 1987; Shelden and Wadsworth, 1990; Mastronarde et al., 1993). In Tek2-KD cells, the microtubule overlap does not appear well defined, resulting in diffuse midzone microtubules with ill-defined boundaries (Fig. 3). This observation, combined with the broad diffuse localization of Aur B, MKLP1, and, in particular, PRC1, suggests that Tek2 serves to stabilize the plus-end boundaries of microtubules in the midzone. This phenotype is also evident in images of Tek2-KD cells arrested with blebbistatin, where the boundaries of microtubule overlap appear particularly ill defined (Fig. 4). During the assembly of ciliary and flagellar axonemes, tektins presumably interact with the growing plus end of doublet microtubules as they grow out, and tektins also serve to limit the length of the axoneme (Norrander et al., 1995; Linck, and Stephens, 2007). At present, we support the model where Tek2 functions to delineate the plus-end boundaries of the midzone microtubules, perhaps by stabilizing them via direct interaction. Alternatively, association of Tek2 with the midzone overlap provides structural cues that contribute to the recruitment of key midzone components, such as PRC1, centralspindlin, and the chromosome passenger complex, which themselves interconnect and stabilize the microtubule overlap. Although further work is needed to understand the interactions between tektins and midzone microtubules, this study has provided insight into the complex events that lead to the formation, bundling, and organization of the midzone microtubules in the central spindle.
|
Materials and methods |
|---|
|
TopAbstractIntroductionResults and discussionMaterials and methodsReferences |
|---|
Cell culture and treatments
CHO-K1 cells (American Type Culture Collection) were cultured in Ham's F12 media containing 10% FCS and 1 mg/ml pen-strep (Invitrogen).
Anti-Tek2 polyclonal antibodies
Full-length mouse tektin 2 (Open Biosystems; accession no. NM_011902) was sub-cloned into the pET14 vector (EMD) and transformed into lBL21 bacteria (DE3; Invitrogen), and protein expression was induced by IPTG. Recombinant Tek2 was separated on a 7.5% SDS-PAGE curtain gel and transblotted onto nitrocellulose. The tektin 2 band was cut out as a strip used to immunize rabbits, and antisera was affinity purified as previously described (Hinchcliffe and Linck, 1998).
GFP–tektin 2 construct and stable cell line creation
Full-length mouse tektin 2 was subcloned into pBluescript II containing the GFP gene, and the GFP–tektin 2 fragment was subcloned into the pCI-Neo expression vector (Promega)
CHO-K1 cells stably expressing Tek2-GFP were generated as previously described (Durcan et al., 2008). Cells were transfected with Fugene 6 (Roche), and the day after transfection, Hepes-buffered F12 media containing 2 mg/ml G418 was added to cells. After 3 d in G418, cells were passaged, small groups of cells were seeded into 24-well dishes, and the concentration of G418 was lowered to 50 µg/ml. CHO–tektin 2 (CHO-GT2) cells were screened by fluorescence microscopy. Tertiary clones were identified with maximal numbers of cells showing optimal GFP–tektin 2 expression and aliquots were frozen down.
Mitotic spindle isolation
Mitotic spindles and midbodies were isolated as previously described (Sellitto and Kuriyama, 1988). Once the extraction was complete, as monitored by phase microscopy, the spindles or midbodies were spun onto coverslips at 14,000 g for 15 min at 4°C.
Microscopy
Cells on coverslips were fixed in ice-cold methanol. Immunofluorescence was performed using -tubulin (mouse D1a clone; Sigma-Aldrich), and either anti-Tek2 (this study) anti–Aur B, anti-MKLP1, or anti-PRC1 (all obtained from Santa Cruz Biotechnology, Inc.). Secondary antibodies used were Alexa-594 goat anti–rabbit (Invitrogen) and Alexa-488 goat anti–mouse. Fixed cells were imaged at room temperature with a 63x 1.4 NA Apo oil immersion lens on an upright microscope (DM RXA2; Leica). Images were acquired with Simple PCI software (Compix Media) using a cooled charge-coupled device camera (ORCA-ER; Hamamatsu Photonics). Images were acquired as a Z stack at 0.2-µm intervals and compiled as maximum projections, and image overlays were created with Photoshop 6.0 (Adobe).
For time-lapse imaging, CHO-GT2 cells were plated onto biocleaned glass coverslips in imaging media (Ham's F-12 without phenol red; PromoCell GmbH) containing 12 mM Hepes, pH 7.2, and 10% FBS and assembled onto aluminium support slides, as previously described (Hinchcliffe et al., 2001). Time-lapse images were captured using a microscope stand (DM RXA2; Leica) equipped with fluorescence and differential interference optics and enclosed in a custom-made Plexiglas box maintained at 37°C. Live-cell differential interference contrast image sequences were captured with a 40x 0.7 NA Apo dry objective. Live-cell fluorescence images were captured using a spinning disk confocal head (CSU-10; Yokagawa), as modified by McBain Industries, using a 488-nm 200-mW Sapphire continuous-wave optically pumped solid-state laser (CW-OPSL; Coherent), connected through a fiber optic cable into the excitation port of the spinning disk confocal head, and shuttered via a TTL pulse through a shutter controller (MAC5000; Ludl). Confocal fluorescent images were taken through a Plan Apo 63x 1.3 NA 37°C glycerol immersion objective (Leica). The detector on the confocal microscope was a digital charge-coupled device camera (ORCA-AG; Hamamatsu Photonics), and images were captured using Simple PCI imaging software.
Tektin 2 siRNA KD
To transiently knock down levels of tektin 2 in CHO-K1 cells, oligos were created to target sequences within the mouse tektin 2 genes. For transient transfections, these oligos were cloned into the pSHAG vector (G. Hannon, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY; Paddison et al., 2004). Oligos were created to target sequences in both the 5' UTR and the ORF of Tek2. An SCR ORF oligo was created as a control siRNA oligo that would not knock down tektin 2 (T2 ORF, AACATGACAATAGGACCCGCC; T2 SCR, agacaacacgcactaatgcgc; T2 UTR, AAGACAGACCACTGAGGAAATACAG).
To transiently knock down tektin 2 levels, CHO cells were transiently transfected with the pSHAG constructs described in the previous paragraph in a 4:1 ratio with pBluescriptII-RFP to allow identification of transfected cells. To generate CHO cells stably expressing either the Tek2 ORF or SCR constructs, oligos were cloned behind a U6 promoter in a pBluescriptII vector containing the neomycin gene. Cells were transfected and selected with G418, and tektin 2 KD was verified by both RT-PCR and Western blot. Only low passage number cells were used in experiments, as cells transfected with the siRNA construct became multinucleate over time.
RT-PCR
Total RNA was harvested from cells using Qiashredder and the RNeasy mini kit (QIAGEN). For a reverse transcription reaction in an RNase free environment, 2 µg mRNA was added to an RNase-free PCR tube (Ambion). The mRNA was amplified using 2 µM of random hexamers, creating first-strand cDNA. After reverse transcription, the RT mix was incubated in the presence of either tektin 2, 18s ribosomal RNA, or both sets of PCR primers. The PCR reactions were run at standard temperatures on a 2% TBE agarose gel for 37 cycles, with a melting temperature of 54°C (1 min).
Blebbistatin treatment
Blebbistatin (– active enantiomer; EMD) was added at a final concentration of 100 µM to unsynchronized CHO cells expressing the Tek2 ORF siRNA, the Tek2 SCR siRNA, or no transfected for two hours. Cells were then fixed and immunolabeled for -tubulin and either anti-Tek2 or anti–Aur B.
Online supplemental material
Fig. S1 shows that Tek2 localizes to isolated CHO mitotic spindles. Fig. S2 shows localization of Aur B, MKLP1, and PRC1 in control CHO cells. Fig. S3 shows that Tek2 compacts the central spindle microtubules. Online supplemental material is available at http://www.jcb.org/cgi/content/full/jcb.200711160/DC1.
|
Acknowledgments |
|---|
This research was sponsored by National Institutes of Health grant R01 GM072754 to E.H. Hinchcliffe. E.H. Hinchcliffe is a Research Scholar of the American Cancer Society.
Submitted: 30 November 2007
Accepted: 17 April 2008
|
References |
|---|
|
TopAbstractIntroductionResults and discussionMaterials and methodsReferences |
|---|
Adams, R.R., M. Carmena, and W.C. Earnshaw. 2001. Chromosomal passengers and the (aurora) ABCs of mitosis. Trends Cell Biol. 11:49–54.[CrossRef][Medline]
Doxsey, S.J. 2005. Molecular links between centrosome and midbody. Mol. Cell. 20:170–172.[CrossRef][Medline]
Durcan, T.M., E.S. Halpin, L. Casaletti, K.T. Vaughan, M. Pierson, S. Woods, and E.H. Hinchcliffe. 2008. Centrosome duplication proceeds during mimosine-induced G1 cell cycle arrest. J. Cell. Physiol. 215:182–191.[CrossRef][Medline]
Fabbro, M., B.B. Zhou, M. Takahashi, B. Sarcevic, P. Lal, M.E. Graham, B.G. Gabrielli, P.J. Robinson, E.A. Nigg, Y. Ono, and K.K. Khanna. 2005. Cdk1/Erk2- and Plk1-dependent phosphorylation of a centrosome protein, Cep55, is required for its recruitment to midbody and cytokinesis. Dev. Cell. 9:477–488.[CrossRef][Medline]
Glotzer, M. 2005. The molecular requirements for cytokinesis. Science. 307:1735–1739.
Gromley, A., A. Jurczyk, J. Sillibourne, E. Halilovic, M. Mogensen, I. Groisman, M. Blomberg, and S. Doxsey. 2003. A novel human protein of the maternal centriole is required for the final stages of cytokinesis and entry into S phase. J. Cell Biol. 161:535–545.
Gromley, A., C. Yeaman, J. Rosa, S. Redick, C.T. Chen, S. Mirabelle, M. Guha, J. Sillibourne, and S.J. Doxsey. 2005. Centriolin anchoring of exocyst and SNARE complexes at the midbody is required for secretory-vesicle-mediated abscission. Cell. 123:75–87.[CrossRef][Medline]
Hinchcliffe, E.H. 2003. Cell cycle: seeking permission from the mother centriole. Curr. Biol. 13:R646–R648.[CrossRef][Medline]
Hinchcliffe, E.H., and R.W. Linck. 1998. Two proteins isolated from sea urchin sperm flagella: structural components common to the stable microtubules of axonemes and centrioles. J. Cell Sci. 111:585–595.[Abstract]
Hinchcliffe, E.H., F.J. Miller, M. Cham, A. Khodjakov, and G. Sluder. 2001. Requirement of a centrosomal activity for cell cycle progression through G1 into S phase. Science. 291:1547–1550.
Keller, L.C., E.P. Romijn, I. Zamora, J.R. Yates, and W.F. Marshall. 2005. Proteomic analysis of isolated chlamydomonas centrioles reveals orthologs of ciliary-disease genes. Curr. Biol. 15:1090–1098.[CrossRef][Medline]
Kurasawa, Y., W.C. Earnshaw, Y. Mochizuki, N. Dohmae, and K. Todokoro. 2004. Essential roles for KIF4 and its binding partner PRC1 in organized central spindle midzone formation. EMBO J. 23:3237–3248.[CrossRef][Medline]
Linck, R.W. 1976. Flagellar doublet microtubules: fractionation of minor components and alpha-tubulin from specific regions of the A-tubule. J. Cell Sci. 20:405–439.[Abstract]
Linck, R.W., and G.L. Langevin. 1982. Structure and chemical composition of insoluble filamentous components of sperm flagellar microtubules. J. Cell Sci. 58:1–22.[Abstract]
Linck, R.W., and R.E. Stephens. 2007. Functional protofilament numbering of ciliary, flagellar, and centriolar microtubules. Cell Motil. Cytoskeleton. 64:489–495.[CrossRef][Medline]
Martineau, S.N., P.R. Andreassen, and R.L. Margolis. 1995. Delay of HeLa cell cleavage into interphase using dihydrocytochalasin B: retention of a postmitotic spindle and telophase disc correlates with synchronous cleavage recovery. J. Cell Biol. 131:191–205.
Matuliene, J., and R. Kuriyama. 2002. Kinesin-like protein CHO1 is required for the formation of midbody matrix and the completion of cytokinesis in mammalian cells. Mol. Biol. Cell. 13:1832–1845.
Mastronarde, D.N., K.L. McDonald, R. Ding, and J.R. McIntosh. 1993. Interpolar microtubules in PTK cells. J. Cell Biol. 123:1475–1489.
McCollum, D. 2004. Cytokinesis: the central spindle takes center stage. Curr. Biol. 14:R953–R955.[CrossRef][Medline]
Mishima, M., S. Kaitna, and M. Glotzer. 2002. Central spindle assembly and cytokinesis require a kinesin-like protein/RhoGAP complex with microtubule bundling activity. Dev. Cell. 2:41–54.[CrossRef][Medline]
Mollinari, C., J.P. Kleman, W. Jiang, G. Schoehn, T. Hunter, and R.L. Margolis. 2002. PRC1 is a microtubule binding and bundling protein essential to maintain the mitotic spindle midzone. J. Cell Biol. 157:1175–1186.
Mullins, J.M., and J.J. Biesele. 1977. Terminal phase of cytokinesis in D-98s cells. J. Cell Biol. 73:672–684.
Mullins, J.M., and J.R. McIntosh. 1982. Isolation and initial characterization of the mammalian midbody. J. Cell Biol. 94:654–661.
Nojima, D., R.W. Linck, and E.H. Egelman. 1995. At least one of the protofilaments in flagellar microtubules is not composed of tubulin. Curr. Biol. 5:158–167.[CrossRef][Medline]
Norrander, J.M., R.W. Linck, and R.E. Stephens. 1995. Transcriptional control of tektin A mRNA correlates with cilia development and length determination during sea urchin embryogenesis. Development. 121:1615–1623.[Abstract]
Norrander, J., M. Larson, S. Ståhl, C. Höög, and R. Linck. 1998. Expression of ciliary tektins in brain and sensory development. J. Neurosci. 18:8912–8918.
Oegema, K., and T.J. Mitchison. 1997. Rappaport rules: cleavage furrow induction in animal cells. Proc. Natl. Acad. Sci. USA. 94:4817–4820.
Otegui, M.S., K.J. Verbrugghe, and A.R. Skop. 2005. Midbodies and phragmoplasts: analogous structures involved in cytokinesis. Trends Cell Biol. 15:404–413.[CrossRef][Medline]
Paddison, P.J., M. Cleary, J.M. Silva, C.K. Hang, N. Sheth, R. Sachidanandam, and G.J. Hannon. 2004. Cloning of short hairpin RNAs for gene knockdown in mammalian cells. Nat. Methods. 1:163–167.[CrossRef][Medline]
Pickett-Heaps, J., T. Spurck, and D. Tippit. 1984. Chromosome motion and the spindle matrix. J. Cell Biol. 99:137s–143s.
Saxton, W.M., and J.R. McIntosh. 1987. Interzone microtubule behavior in late anaphase and telophase spindles. J. Cell Biol. 105:875–886.
Salmon, E.D., D. Goode, T.M. Maugel, and D.B. Bonar. 1976. Pressure-induced depolymerization of spindle microtubules. III. Differential stability in HeLa cells. J. Cell Biol. 69:443–454.
Sellitto, C., and R. Kuriyama. 1988. Distribution of a matrix component of the midbody during the cell cycle in Chinese hamster ovary cells. J. Cell Biol. 106:431–439.
Setter, P.W., E. Malvey-Dorn, W. Steffen, R.E. Stephens, and R.W. Linck. 2006. Tektin interactions and a model for molecular functions. Exp. Cell Res. 312:2880–2896.[CrossRef][Medline]
Shelden, E., and P. Wadsworth. 1990. Interzonal microtubules are dynamic during spindle elongation. J. Cell Sci. 97:273–281.
Skop, A.R., H. Liu, J. Yates, B.J. Meyer, and R. Heald. 2004. Dissection of the mammalian midbody proteome reveals conserved cytokinesis mechanisms. Science. 305:61–66.
Steffen, W., and R.W. Linck. 1992. Evidence for a non-tubulin spindle matrix and for spindle components immunologically related to tektin filaments. J. Cell Sci. 101:809–822.
Steffen, W., E.A. Fajer, and R.W. Linck. 1994. Centrosomal components immunologically related to tektins from ciliary and flagellar microtubules. J. Cell Sci. 107:2095–2105.[Abstract]
Straight, A.F., and C.M. Field. 2000. Microtubules, membranes and cytokinesis. Curr. Biol. 10:R760–R770.[CrossRef][Medline]
Straight, A.F., A. Cheung, J. Limouze, I. Chen, N.J. Westwood, J.R. Sellers, and T.J. Mitchison. 2003. Dissecting temporal and spatial control of cytokinesis with a myosin II Inhibitor. Science. 299:1743–1747.
Uetake, Y., and G. Sluder. 2007. Cell cycle progression without an intact microtubule cytoskeleton. Curr. Biol. 17:2081–2086.[CrossRef][Medline]
Vader, G., R.H. Medema, and S.M. Lens. 2006. The chromosomal passenger complex: guiding Aurora-B through mitosis. J. Cell Biol. 173:833–837.
Wheatley, S.P., and Y. Wang. 1996. Midzone microtubule bundles are continuously required for cytokinesis in cultured epithelial cells. J. Cell Biol. 135:981–989.
Yüce, O., A. Piekny, and M. Glotzer. 2005. An ECT2–centralspindlin complex regulates the localization and function of RhoA. J. Cell Biol. 170:571–582.
Zhao, W.M., A. Seki, and G. Fang. 2006. Cep55, a microtubule-bundling protein, associates with centralspindlin to control the midbody integrity and cell abscission during cytokinesis. Mol. Biol. Cell. 17:3881–3896.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
Related In this Issue article
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|
