|
||
Article |
Cardiolipin provides an essential activating platform for caspase-8 on mitochondria
Correspondence to Eyal Gottlieb: e.gottlieb{at}beatson.gla.ac.uk
Cardiolipin is a mitochondria-specific phospholipid known to be intimately involved with apoptosis. However, the lack of appropriate cellular models to date restricted analysis of its role in cell death. The maturation of cardiolipin requires the transacylase tafazzin, which is mutated in the human disorder Barth syndrome. Using Barth syndrome patient-derived cells and HeLa cells in which tafazzin was knocked down, we show that cardiolipin is required for apoptosis in the type II mitochondria-dependent response to Fas stimulation. Cardiolipin provides an anchor and activating platform for caspase-8 translocation to, and embedding in, the mitochondrial membrane, where it oligomerizes and is further activated, steps that are necessary for an efficient type II apoptotic response.
© 2008 Gonzalvez et al. This article is distributed under the terms of an Attribution–Noncommercial–Share Alike–No Mirror Sites license for the first six months after the publication date (see http://www.jcb.org/misc/terms.shtml). After six months it is available under a Creative Commons License (Attribution–Noncommercial–Share Alike 3.0 Unported license, as described at http://creativecommons.org/licenses/by-nc-sa/3.0/).
| Introduction |
|---|
|
|
|---|
Cardiolipin (CL), a phospholipid of the mitochondrial membrane, participates in several mitochondria-dependent apoptotic steps (Gonzalvez and Gottlieb, 2007), including the proapoptotic function of Bcl-2 proteins. CL can serve as a "docking site" for tBid on the mitochondrial membrane (Lutter et al., 2000) and is required for Bax activation and mitochondrial outer membrane permeabilization (Kuwana et al., 2002). By anchoring cytochrome c to the mitochondrial inner membrane, CL both facilitates the electron transport chain and encumbers cytochrome c release during apoptosis, which indicates that the complete release of cytochrome c requires the disruption of its interactions with CL (Shidoji et al., 1999; Ott et al., 2002). This is further supported by the fact that CL peroxidation, catalyzed by cytochrome c, is required for cytochrome c release from mitochondria (Kagan et al., 2005).
Despite the growing body of evidence implicating CL in apoptosis, the mechanism remains unresolved. To address the role of CL in apoptosis in a cellular system, Barth syndrome–derived lymphoblastoid cells and Barth syndrome–like cells were used. Barth syndrome (Barth et al., 1983; Kelley et al., 1991) is the only known human genetic disorder where alterations in CL metabolism are its primary cause (Hauff and Hatch, 2006; Gonzalvez and Gottlieb, 2007). Barth syndrome is caused by mutations in tafazzin (Bione et al., 1996), which encodes a transacylase that directs CL maturation (Xu et al., 2006). After synthesis in mitochondria, CL is actively remodeled by tafazzin to generate its mature acyl form. CL contains four acyl chains. During CL maturation, phospholipase A removes one saturated acyl chain to generate monolyso-CL (MLCL) while tafazzin replaces it with an unsaturated acyl chain taken from phosphatidylcholine (PC), a process repeated until remodeling is complete (Xu et al., 2006). Therefore, in Barth syndrome, mature CL levels are low, whereas the levels of MLCL are high (Valianpour et al., 2005), making it a unique model for studying the role of mature CL in apoptosis in intact cells.
In this study, we show that CL is required for the type II extrinsic apoptotic pathway. In particular, CL is fundamental for the formation of an apoptotic signaling platform on the mitochondrial outer membrane supporting the recruitment, oligomerization, and processing of caspase-8. This step is critical for the release of apoptogenic factors from the mitochondrial intermembrane space. We show that unlike the type I response to Fas signaling, where caspase-8 is activated on the plasma membrane's DISC, in the type II response, caspase-8 relocates to the mitochondrial outer membrane, where its accumulation and activation relies on CL.
| Results |
|---|
|
|
|---|
or with anti-Fas antibody, a dramatic decrease in cell death was observed in the CL-deficient Barth syndrome–derived lymphoblastoid cells (Fig. 1 C), which prompted focus on the role of CL in Fas-mediated apoptosis. FACS demonstrated that cell surface-exposed Fas levels were unaltered in CL-deficient cells (Fig. S1, available at http://www.jcb.org/cgi/content/full/jcb.200803129/DC1). However, measurement of Annexin V binding to PI-negative cells (which is indicative of early apoptotic cells) showed a clear reduction in the response of Barth syndrome–derived lymphoblastoid cells to anti-Fas antibody compared with control cells (Fig. 1 D). These results indicate that CL-deficient lymphoblastoid cells are defective in the pathway that links the death receptor with the core apoptotic machinery.
|
To generate a model for Barth syndrome, RNA interference was used to knock down tafazzin. Short hairpin RNA (shRNA)-encoding plasmids were constructed using either a tafazzin-specific sequence or a nonspecific shRNA control. HeLa cells were stably transfected, and cell clones (shTaz1, shTaz2, shCont1, and shCont2) were isolated. Quantitative PCR analysis showed that in shTaz1 and shTaz2 cells, the endogenous tafazzin RNA levels were reduced significantly (Fig. S3, available at http://www.jcb.org/cgi/content/full/jcb.200803129/DC1). A corresponding Western blot for endogenous tafazzin confirmed efficient knockdown of the protein (Fig. 2 A). Finally, the CL pattern of the tafazzin knockdown cells resembled that of Barth syndrome–derived lymphoblastoid cells (Fig. 2 B). Although the increase in MLCL is modest compared with Barth syndrome lymphoblastoid cells, a significant and comparable decrease in CL is evident in shTaz1 and shTaz2 cells with a dramatic loss of the major peaks of each cluster of CL species, which indicates severely defective maturation of CL (Fig. 2 B). Moreover, like Barth syndrome patients (Vreken et al., 2000), lack of tafazzin in HeLa cells has no effect on other major phospholipids (Fig. S4).
|
To confirm that loss of mature CL and not the loss of tafazzin itself is the cause of apoptosis resistance in tafazzin-deficient cells, tafazzin was transiently knocked down for 48 h using siRNA oligonucleotides. HeLa cells were transfected with a plasmid encoding a GFP-tafazzin fusion protein and with either nonspecific or tafazzin-targeting siRNAs. The GFP-tafazzin protein colocalized with the mitochondria-specific fluorescent dye tetramethyl rhodamine ethyl ester (TMRE), confirming its location in the mitochondria, and was efficiently knocked down in cells transfected with tafazzin-specific siRNA (Fig. S5 A, available at http://www.jcb.org/cgi/content/full/jcb.200803129/DC1). The efficiency of the tafazzin-targeting siRNA was further verified by Western blot analysis (Fig. S5 B). However, under these conditions, the CL pattern was unaltered in these cells, likely because of the low turnover of the lipids in these cells (Fig. S5 C). It was previously shown that, in the liver, the half-life of CL is the longest of all mitochondrial phospholipids (Landriscina et al., 1976). Importantly, transient depletion of tafazzin (without affecting the CL level) in HeLa cells did not modify the sensitivity of these cells to Fas-induced apoptosis (Fig. S5 D), ruling out a CL-independent role for tafazzin in the apoptotic process.
Cytochrome c release is impaired in Fas-induced CL-deficient cells
To understand the role of CL in Fas-induced apoptosis, the known steps of this pathway were investigated in tafazzin-knockdown cells. Caspase-3, which in type II cells requires cytochrome c release and apoptosome formation for its activation, showed a marked decrease in both autocleavage and cleavage of its substrate poly-ADP ribose polymerase (PARP; Fig. 3 A).
Next, the Fas-induced release of cytochrome c and Smac/Diablo from mitochondria of tafazzin-knockdown cells was analyzed by immunostaining. It is worth mentioning that the levels of cytochrome c within the mitochondria were unaltered in untreated cells regardless of the CL status (Figs. 3 B and 4 C).
Although in many control cells (Fig. 3 B and C, white arrows), cytochrome c and Smac/Diablo appeared in the cytosol after Fas activation, both proteins were retained in the mitochondria in all CL-deficient cells (Fig. 3, B and C). Western blot analysis of cytosolic fractions confirmed a block in cytochrome c release from the mitochondria of tafazzin-knockdown cells after Fas activation (Fig. 3 D). Therefore, the apoptotic block in CL-deficient cells is caused by defects in mitochondrial outer membrane permeabilization or upstream events.
|
|
Activation of caspase-8 on the mitochondria requires CL
Bid cleavage was then analyzed in control and tafazzin-deficient cells. Because of technical difficulties in immunodetecting tBid in total cell extracts, changes in the levels of full-length Bid rather than of tBid were initially measured. Fas activation decreased the levels of full-length Bid in control but not in CL-deficient cells, which indicates a block in Bid processing (Fig. 5, A and B).
To detect tBid directly, mitochondria from control and tafazzin-knockdown HeLa cells were isolated before and after Fas activation. As expected, tBid was clearly detected on mitochondria of Fas-activated control cells, whereas on mitochondria of tafazzin-knockdown cells, tBid formation was markedly reduced (Fig. 5 C). Because Bid is cleaved by caspase-8 after Fas activation, it seemed likely that in tafazzin-deficient cells, Bid was not processed because of the inactivity of caspase-8. Therefore IETDase (caspase-8–like) activity was monitored in lymphoblastoid and HeLa cells, and was indeed found to be diminished in tafazzin-deficient cells (Fig. 5, D and E).
|
|
, even though they were protected from cell death, formation of p43 but not of p18 was clearly observed (Fig. 6 E). In addition, similar results were obtained in HeLa cells in which mitochondria-dependent apoptosis upstream of caspase-3 activity was blocked by overexpression of Bcl-xL (Fig. 6 F). Put together, these results indicate that although caspase-3 amplification (downstream to the mitochondria) is required for full activation of caspase-8, it is not required for the early stage of caspase-8 processing. Because in CL-deficient cells the block in caspase-8 activation is seen in the initial processing of procaspase-8 into p43 (Fig. 6, B and C), the CL-dependent apoptotic step is most likely independent of caspase-3 and lies either at or upstream of the mitochondrial steps of apoptosis. It was previously found that caspase-8 interacts with mitochondria under both physiological (Stegh et al., 2000) and apoptotic conditions (Stegh et al., 2002; Chandra et al., 2004). Seeing that a mitochondrial lipid affected caspase-8 activity in type II apoptotic signaling, we investigated whether CL is required for caspase-8 interaction and activation on the mitochondria. Cytosolic and mitochondrial fractions of control, tafazzin-deficient lymphoblastoid and HeLa cells were isolated before and after Fas activation and analyzed for caspase-8 levels. Although after Fas-activation, mitochondria of control cells displayed cleaved caspase-8 products, including p43 and p18 (Fig. 7, A and B, lane 6), on mitochondria of CL-deficient cells, these products were significantly reduced (Fig. 7, A and B, compare lanes 6 and 8). The activity of caspase-8 on isolated mitochondria was measured using benzyloxycarbonyl-Leu-Glu-Thr-Asp (zLETD)-aminoluciferin as a substrate. LETDase activity was much higher in mitochondria isolated from Fas-activated control HeLa cells compared with the tafazzin-deficient HeLa cells (Fig. 7 C), which indicates a defect in caspase-8 processing in tafazzin-deficient mitochondria. This suggests that mitochondria are a required location for full activity of caspase-8. Importantly, the p43 and p18 mitochondria-associated products, and to a lesser extent procaspase-8 or the DED domain, were resistant to alkaline wash (Fig. 7 D). This indicates the strong insertion of the p18-exposed isoforms of caspase-8 into the mitochondrial membrane. To determine if caspase-8 completely inserts into the mitochondria, mitochondria were isolated from HeLa cells that had been transiently transfected with the partially active caspase-8 mutant C360S fused to GFP in the presence of zVAD-fmk (for more details on this mutant, see Fig. 8 C). The isolated mitochondria were incubated with increasing concentrations of trypsin. The data indicated that C360S-GFP and p43-C360S were sensitive to trypsin treatment (Fig. 7 E) and suggested that caspase-8 is only partially inserted into the mitochondrial outer membrane, where it mostly faces the cytosol.
|
Importantly, after Fas activation in both tafazzin-knockdown and control cells, the cytosolic procaspase-8 was fully cleaved into its early mature form (p43; Fig. 7 B, lanes 2 and 4). This indicates that in the cytosol, the initiating process of caspase-8 cleavage (on the DISC) is unaffected in tafazzin-knockdown cells, and that the major defects in these cells lie in the steps of docking and activation of caspase-8 on the mitochondria. In type II cells, the activation of caspase-8 on the DISC is limited, hence the need for a mitochondria-mediated amplification step. To test whether loss of CL hinders only the mitochondria-dependent (but not mitochondria-independent) apoptotic steps, a caspase-8–GFP fusion protein was transiently expressed in HeLa cells. This fusion protein can oligomerize and self-activate in the cytosol in the absence of Fas signaling, inducing a type I–like response (unpublished data). When overexpressed in HeLa cells, caspase-8–GFP induced cell death, which could not be blocked by Bcl-xL (Fig. 8, A and B). Because the tafazzin-knockdown cells are GFP positive (see Materials and methods for details), cell death after caspase-8–GFP transfection was assessed in these cells by PARP cleavage, an indicator for caspase-3 activation. As can be seen in Fig. 8 B, overexpressing caspase-8–GFP induced comparable cell death in both control and tafazzin knockdown cells. These results indicate that like Bcl-xL overexpression, tafazzin knockdown provides protection from the mitochondria-dependent but not from the mitochondria-independent apoptotic steps.
|
Finally, it was investigated whether caspase-8 translocation to the mitochondria is required for its activation. As mentioned before, initiator caspases are activated via induced proximity, and it seemed possible that after its insertion into the CL-enriched mitochondrial membrane, caspase-8 dimerizes and autoprocesses to become activated. Therefore, caspase-8 oligomerization on the mitochondrial membrane after Fas activation was examined. Isolated mitochondria from Fas-activated shCont1 cells were treated with the cross-linker Bis-maleimidohexane (BMH). p43 monomers were noted in control (DMSO) lanes but were absent in the BMH-treated lanes. However, higher molecular weight oligomers were present in the BMH-treated mitochondria lanes (Fig. 9).
In particular,
53-kD and
80-kD forms were observed, which indicates that upon mitochondrial translocation, caspase-8 forms a p43/p10 homo-heterodimer (Fig. 9). This tetrameric form of caspase-8 is known to be active (though not to its full capacity) and can explain the caspase-8 activity observed on isolated mitochondria (Fig. 7 C). However, this form may be an intermediate on its way to be processed to form the p18–p10 fully active complex. The fate of this caspase-8 form is still unclear and is under investigation. Interestingly, however, higher molecular weight forms were also observed, indicating that caspase-8 may further oligomerize on the mitochondria or that it is associated with other mitochondrial proteins. It is of note that once cleaved from p43, the DED domain (p26) on its own is no longer affected by the cross-linker and is probably released from the oligomer when caspase-8 is further processed to its fully active p18–p10 form. To summarize: the localization, oligomerization, and cleavage of caspase-8 on the mitochondria after Fas activation, and the deficits in these processes in CL-deficient cells, strongly indicates that CL provides an activating platform for caspase-8 on the mitochondria after Fas stimulation.
|
| Discussion |
|---|
|
|
|---|
The activation of initiator caspases requires an activating platform that enables their association with each other. Such triggering complexes include the DISC for caspase-8 and -10 (Kischkel et al., 1995), the apoptosome for caspase-9 (Zou et al., 1999), the PIDDosome for caspase-2 (Tinel and Tschopp, 2004), and the inflammasome for caspase 1 and 5 (Martinon et al., 2002). In this work, CL was identified as a potential new mitochondria-associated triggering platform required for caspase-8 translocation, oligomerization, and activation after Fas signaling in type II cells. Our data show that once the first cleavage of procaspase-8 occurs, the p43/p10 heteromer product inserts into the mitochondrial membrane, where it further oligomerizes and may potentially undergo cleavage to form a mitochondria-associated p18–p10 active complex. Though CL is mostly found in the mitochondrial inner membrane, several works have demonstrated an enrichment of CL in the contact sites between the inner and the outer mitochondrial membranes (Ardail et al., 1990; Hovius et al., 1990; Simbeni et al., 1991; Lutter et al., 2001; Kim et al., 2004). At the contact sites, CL mediates the binding of tBid to the mitochondrial outer membrane (Lutter et al., 2001). Therefore, it is likely that caspase-8 binding to the mitochondria is regulated in a similar way. It remains to be determined whether other proteins, such as BAR and FLASH, which were shown to mediate caspase-8 translocation to the mitochondria (Zhang et al., 2000; Milovic-Holm et al., 2007), play an auxiliary role in these processes.
In this paper, the role of CL in apoptosis was studied in cells after Fas activation. However, caspase-8 also operates in response to other death signals. Caspase-8 prevents metastasis formation from primary tumors (Stupack et al., 2006). It will be interesting to learn whether mitochondria in general and CL in particular are required for activating caspase-8 under these conditions, and whether CL levels are altered during advanced tumor development. A decrease in tafazzin expression levels has been reported in B cell lymphoma and breast carcinoma, which suggests that tafazzin loss may contribute to tumor progression (Wilson et al., 2002; Kobayashi et al., 2003). To date, Barth syndrome has not been associated with apoptotic defects or cancers. However, most cells in vivo are type I, and the mitochondrial amplification steps are only required in cells in which the DISC has been compromised, as is the case in many epithelial cancer cells (Shell et al., 2007). In addition, the early mortality age of Barth syndrome patients may explain the absence of increased cancer incidents. Importantly, however, Barth syndrome is often characterized by a developmental defect of noncompaction of the left ventricular myocardium (Bleyl et al., 1997), and a similar defect was observed in mice deficient in caspase-8 (Varfolomeev et al., 1998). Therefore, it is possible that the developmental abnormalities associated with Barth syndrome are due, at least partially, to inactivation of caspase-8. The role of mitochondria-associated caspase-8 in several in vivo processes should be further investigated.
| Materials and methods |
|---|
|
|
|---|
Cells culture and transfection
The lymphoblastoid cells lines were generated from two unrelated Barth syndrome patients (DB105.2 and DB105.3) or two different controls (DB037 and DB015.2), and were a gift from R. Kelley (Johns Hopkins University School of Medicine, Baltimore, MD). DB105.2 and DB105.3 express tafazzin containing a single point mutation at G197E or I209D, respectively, which inactivates the protein. Lymphoblasts were immortalized ex vivo by Epstein-Barr virus infection. These cells were cultured in RPMI 1640 supplemented with 10% FCS, 2 mM L-glutamine, penicillin, and streptomycin. The cervical carcinoma HeLa cell lines were cultured in DME supplemented with 10% FCS and L-glutamine. Transfection of HeLa cells was performed using Lipofectamine 2000 (Invitrogen). Bcl-xL, shTaz, and shCont stable HeLa cell lines were generated by transfection with pcDNA3/Bcl-xL, pSUPER/shTaz, or pSUPER/shCont, respectively, and selected in G418. The revertant shTaz1R cell line was generated by cotransfecting shTaz1 HeLa cells with pLpC vector (for the puromycin resistance gene), and pcDNA3/Tazmut and stable clones were selected in puromycin.
For siRNA transfection, unless otherwise stated, HeLa cells were transfected with 50 nM of the indicated siRNA, and the efficiency of gene silencing was validated by Western blotting 48 h after transfection. The sequence targeted by siBid and siTaz were GAAGACATCATCCGGAATATT and GGGAAAGTGAACATGAGTTTT, respectively. A nontargeting siRNA pool (Thermo Fisher Scientific) was used as control.
Lipid analysis
Lipid analysis was performed as described previously (Valianpour et al., 2002). Cells were sonicated for 20 s in PBS, and phospholipids were extracted from the equivalent of 1 mg of protein of the homogenates as follows: after the addition of 3 ml of 1:1 chloroform/methanol (vol/vol), the internal standards (0.4 nmol of tetramyristoyl-CL and 0.16 nmol of dimyristoyl-phosphatidylglycerol; Avanti Polar Lipids) were added. This mixture was shaken vigorously and placed on ice for 15 min, after which it was centrifuged at 1,000 g for 10 min. The supernatant was transferred to new tubes, and the protein pellet was reextracted with 3 ml of 2:1 chloroform/methanol (vol/vol). The combined organic layers were evaporated under nitrogen at 45°C. The residue was dissolved in 150 µl chloroform/methanol/water (50:45:5 vol/vol/vol) containing 0.01% NH4OH, and 10 µl of the solution was injected into the HPLC mass spectrometry system (Thermo Electron Corporation). The column temperature was maintained at 25°C. The lipid extract was injected onto a 2.1 x 250 mm silica column with 5-µm particle diameter (Merck). The phospholipids were separated from interfering compounds by a linear gradient between solution B (97:3 chloroform/methanol, vol/vol) and solution A (85:15 methanol/water, vol/vol). Solution A and B contained 0.1 ml and 0.01 ml of 25% (vol/vol) aqueous ammonia per liter of eluent, respectively. The gradient (0.3 ml/min) was as follows: 0–10 min, 20% A to 100% A; 10–12 min, 100% A; 12–12.1 min, 100% A to 0% A; and 12.1–17 min, equilibration with 0% A. All gradient steps were linear, and the total analysis time, including the equilibration, was 17 min. A splitter between the HPLC column and the mass spectrometer was used, and 75 µl/min eluent was introduced into the mass spectrometer. A TSQ Quantum AM (Thermo Fisher Scientific) was used in the negative electrospray ionization mode. Nitrogen was used as nebulizing gas. The source collision-induced dissociation collision energy was set at 10 V, the spray voltage used was 3,600 V, and the capillary temperature was 300°C. Mass spectra of CL and MLCL molecular species were obtained by continuous scanning from m/z 400 to m/z 1,000 with a scan time of 2 s. The spectra of CL and MLCL species were acquired during their corresponding retention time in the HPLC elution profile. The CL internal standard was set at 100% in each spectrum.
Induction and assessment of cell death
Cells were treated with the optimal concentrations (0.3 µg/ml for lymphoblastoid cells or 0.5 µg/ml for HeLa cells) of an CH11 anti-Fas antibody clone (Millipore) or with the indicated amounts of etoposide or cisplatin. Cells were stained with PI (Invitrogen) alone or in combination with FITC-tagged Annexin V (BD). Cell death was quantified by FACS (BD).
Caspase activities were monitored using the caspase-3 and caspase-8 detection kits (EMD) according to the manufacturer's instructions, and analyzed by FACS. Alternatively, isolated mitochondria were incubated for 1 h at room temperature at a 1:1 dilution with caspase-Glo 8 reagent (Promega). The relative light unit (RLU) produced by caspase-8 cleavage of zLETD-aminoluciferin was recorded using GLOMAX software on a microplate luminometer (Veritas; Turner Biosystems).
For precipitation of active caspase-8, shCont1 and shTaz2 HeLa cells were treated with anti-Fas antibody for 16 h. After treatment, cells were lysed in a solubilization buffer supplemented with protease inhibitors and bVADfmk (EMD). Active caspase-8 was precipitated for 6 h at 4°C using streptavidin-agarose (EMD) and analyzed by immunoblotting.
For immunostaining of cytochrome c and Smac/Diablo, HeLa cells were seeded on coverslips at 2 x 105 cells/ml and treated with anti-Fas antibody in the presence of 20 µM DEVD-fmk. 12 h after treatment, cells were fixed in 3.7% paraformaldehyde and then permeabilized in PBS/0.2% Triton X-100 and blocked in 10% FCS for 1 h. Samples were stained using anti–cytochrome c antibody (BD) or anti-Smac/Diablo antibody (BD), and then incubated with cyanine 3–conjugated anti–mouse IgG (Jackson ImmunoResearch Laboratories). The coverslips were finally mounted in medium containing DAPI (Vectashield; Vector Laboratories). Samples were analyzed under a confocal microscope (SP2; Leica).
Immunofluorescence microscopy
In general, cells were grown in 6-well plates on coverslips. Cells were washed with PBS and fixed in 4% PFA for 20 min at RT. When appropriate cells, were permeabilized in 0.2% Triton X-100 in PBS, blocked with 5% BSA, and incubated overnight in anti-TOM20 (Santa Cruz Biotechnology, Inc.). Coverslips were washed and incubated in anti–rabbit IgG conjugated to Alexa 647 (Invitrogen) for 1 h and then mounted in immunofluorescence mounting medium (Vectashield; Vector Laboratories). Specimens were analyzed at room temperature using a confocal microscope (SP2 DMIRBE laser scanning confocal with SP2 software) equipped with a 63x/1.32 NA ph3 oil HCX Plan Apo lens (all from Leica).
Immunoblot analysis
Antibodies used for immunoblot analyses were: anti–β-actin (Sigma-Aldrich), anti-Bak (Millipore), anti–Bcl-xL serum (a gift from C. Thompson, University of Pennsylvania, Philadelphia, PA), anti–human Bid (Cell Signaling Technology), anti–mouse Bid (Santa Cruz Biotechnology, Inc.), anti–caspase-3 (Cell Signaling Technology), anti–caspase-8 p43/p18 domain (Cell Signaling Technology), anti–caspase-8 DED domain (BD), anti–cytochrome c (7H8.2C12; BD), anti–complex I (NADH dehydrogenase subunit 6; Invitrogen), anti–complex IV (cytochrome c oxidase IV; Invitrogen), anti–complex II (succinate dehydrogenase subunit B; Invitrogen), anti-PARP (BD), anti–cleaved PARP (Cell Signaling Technology), anti-Smac/Diablo (BD), and anti-tafazzin (Abcam).
Cell fractionation
HeLa cells were harvested and washed twice in cold PBS. Cells were then washed once in cold mitochondria isolation buffer (MIB; 200 mM mannitol, 70 mM sucrose, 1 mM EGTA, 10 mM Hepes, and 0.05% BSA, pH 7.4). Pellets were then resuspended in 1 ml of MIB and incubated at 4°C for 5 min. The cells were homogenized in Dounce homogenizer. The nuclei were separated and discarded by centrifugation at 750 g for 5 min, and the mitochondria and cytosolic fractions were finally separated by centrifugation at 10,000 g. The mitochondria-enriched fractions were resuspended in a minimal volume of MIB, and the mitochondrial and cytosolic protein concentrations were assessed using the BCA Protein Assay kit (Thermo Fisher Scientific).
In vitro cytochrome c and Smac/Diablo release
Mitochondria were isolated from HeLa or lymphoblastoid cells, as described in "Cell fractionation." Isolated mitochondria were resuspended at 0.5 mg/ml in a reaction buffer (125 mM KCl, 1 mM KH2PO4, 2.5 mM MgCl2, 0.2 mM EGTA, 5 mM Hepes, and 0.1% BSA, pH 7.4) in the presence of 10 mM succinate and 1 µM rotenone. After 5 min incubation at RT, the recombinant tBid protein (a gift from L. Scorrano, University of Padua, Padua, Italy) was added at the indicated concentrations and mitochondria were incubated for 15 min at 37°C. Mitochondria were then collected by centrifugation at 10,000 g for 5 min. Supernatants and pellets were analyzed by immunoblotting.
Protein oligomerization analyses
For the analysis of oligomerization of Bak and/or caspase-8, mitochondria were incubated for 30 min at room temperature in the presence of DMSO (control) or 10 mM BMH (Thermo Fisher Scientific). Mitochondria were then pelleted, and the cross-linking reaction was quenched by addition of NuPAGE sample buffer containing DTT. Pellets were then analyzed by SDS-PAGE in a 4–12% acrylamide gradient gel (NuPAGE; Invitrogen), followed by immunoblotting.
For the analysis of endogenous caspase-8 oligomerization on the mitochondria, cells were trypsinized, washed in PBS, resuspended in cross-linking buffer (210 mM mannitol, 70 mM sucrose, 1 mM EGTA, and 5 mM Hepes, pH 7.4), and permeabilized using 0.05% digitonin (EMD). 10 mM BMH (or DMSO for control) was added, and the permeabilized cells were incubated for 30 min at RT. The cells were then homogenized with a Dounce homogenizer, and mitochondrial fractions were prepared as described in "Cell fractionation." Mitochondrial pellets were resuspended in protein sample buffer containing DTT and analyzed by 4–12% gradient SDS-PAGE (NuPAGE).
Alkaline wash and trypsinization of mitochondrial proteins
Isolated mitochondria were incubated for 30 min at 4°C in MIB buffer containing 0.1 M Na2CO3 (pH 11.5). The mitochondrial membranes, containing the integrated proteins, were pelleted by ultracentrifugation at 100,000 g for 30 min at 4°C. The supernatants were also collected. Both fractions were then analyzed by Western blotting. The efficiency of the alkaline extraction was controlled using two mitochondrial proteins, NADH-dehydrogenase subunit 6 (an integral membrane protein) and succinate dehydrogenase subunit B (loosely associated to the matrix side of the mitochondrial inner membrane).
The susceptibility of mitochondria-associated caspase-8 to trypsin digestion was checked by isolating mitochondria from HeLa cells transiently expressing caspase-8–C360S-GFP in the presence of zVAD-fmk (EMD). Isolated mitochondria were resuspended in trypsin digestion buffer and incubated with various concentrations of trypsin (Sigma-Aldrich) for 20 min on ice. The proteolysis was stopped by the addition of a 10-fold excess of soybean trypsin inhibitor (Sigma Aldrich). Mitochondria were pelleted at 100,000 g for 30 min at 4°C and analyzed by immunoblotting.
Liposome preparation and analysis
The lipid composition of liposomes was based on the composition of mitochondrial contact sites as described previously (Lutter et al., 2000). Liposomes containing CL consisted of 41 mol% (molar percentage) PC, 22 mol% PE, 8 mol% PI, 9 mol% cholesterol, and 20 mol% CL. In the liposomes lacking CL, we increased both the PC and PE content to compensate for the lack of CL. Bovine liver PC, PE, and PI were obtained from Avanti Polar Lipids, Inc., and bovine heart CL (
98% pure, >80% polyunsaturated fatty acids, primarily linoleic acid) and cholesterol were obtained from Sigma-Aldrich. For the preparation of the liposomes, lipids were dissolved in chloroform, dried under nitrogen, and resuspended in binding buffer containing 100 mM NaCl, 2 mM MgCl2, and 10 mM Tris, pH 7.1. The lipid mixture was passed 11 times through a 400-nm polycarbonate membrane of a Mini-Extruder (Avanti Polar Lipids, Inc.) to form large unilamellar vesicles. After precipitation and wash of liposomes at 100,000 g for 15 min at 4°C, the presence or absence of CL was confirmed by mass spectrometry analysis. The indicated proteins were incubated with the liposomes in binding buffer at 37°C for 30 min, and liposomes were then centrifuged, washed in binding buffer, 0.1 M Na2CO3, pH 11.5, or 1 M NaCl, and lysed for protein analysis by immunoblotting.
Online supplemental material
Fig. S1 shows the Fas expression for all lymphoblastoid cell lines. Fig. S2 shows the effect of siBid or Bcl-XL on anti-Fas stimulated cell death in HeLa cells. Fig. S3 shows the mRNA expression levels of tafazzin in the tafazzin knockdown HeLa cells compared with controls. Fig. S4 shows the lipid content of shCont1, shCont2, shTaz1, and shTaz2. Fig. S5 shows the expression of and localization of tafazzin-GFP and that transient knockdown of tafazzin did not alter CL levels or prevent cell death induced by anti-Fas antibody. Online supplemental material is available at http://www.jcb.org/cgi/content/full/jcb.200803129/DC1.
| Acknowledgments |
|---|
This work was supported by Cancer Research UK. F.M. Vaz was supported by Prinses Beatrix Fonds (grant No. WAR05-0126) and by the Barth Syndrome Foundation. P.X. Petit was supported by the Association Française contre les Myophaties (grant No. 11557). The generation of Barth syndrome lymphoblastoid cells was supported by National Institute of Child Health and Human Development Mental Retardation Research Center grant No. HD-2406.
Submitted: 25 March 2008
Accepted: 22 October 2008
| References |
|---|
|
|
|---|
Ardail, D., J.P. Privat, M. Egret-Charlier, C. Levrat, F. Lerme, and P. Louisot. 1990. Mitochondrial contact sites. Lipid composition and dynamics. J. Biol. Chem. 265:18797–18802.
Barth, P.G., H.R. Scholte, J.A. Berden, J.M. Van der Klei-Van Moorsel, I.E. Luyt-Houwen, E.T. Van 't Veer-Korthof, J.J. Van der Harten, and M.A. Sobotka-Plojhar. 1983. An X-linked mitochondrial disease affecting cardiac muscle, skeletal muscle and neutrophil leucocytes. J. Neurol. Sci. 62:327–355.[CrossRef][Medline]
Bione, S., P. D'Adamo, E. Maestrini, A.K. Gedeon, P.A. Bolhuis, and D. Toniolo. 1996. A novel X-linked gene, G4.5. is responsible for Barth syndrome. Nat. Genet. 12:385–389.[CrossRef][Medline]
Bleyl, S.B., B.R. Mumford, V. Thompson, J.C. Carey, T.J. Pysher, T.K. Chin, and K. Ward. 1997. Neonatal, lethal noncompaction of the left ventricular myocardium is allelic with Barth syndrome. Am. J. Hum. Genet. 61:868–872.[Medline]
Chandra, D., G. Choy, X. Deng, B. Bhatia, P. Daniel, and D.G. Tang. 2004. Association of active caspase 8 with the mitochondrial membrane during apoptosis: potential roles in cleaving BAP31 and caspase 3 and mediating mitochondrion-endoplasmic reticulum cross talk in etoposide-induced cell death. Mol. Cell. Biol. 24:6592–6607.
Chang, D.W., Z. Xing, V.L. Capacio, M.E. Peter, and X. Yang. 2003. Interdimer processing mechanism of procaspase-8 activation. EMBO J. 22:4132–4142.[CrossRef][Medline]
Chen, M., A. Orozco, D.M. Spencer, and J. Wang. 2002. Activation of initiator caspases through a stable dimeric intermediate. J. Biol. Chem. 277:50761–50767.
Choi, S.Y., F. Gonzalvez, G.M. Jenkins, C. Slomianny, D. Chretien, D. Arnoult, P.X. Petit, and M.A. Frohman. 2007. Cardiolipin deficiency releases cytochrome c from the inner mitochondrial membrane and accelerates stimuli-elicited apoptosis. Cell Death Differ. 14:597–606.[CrossRef][Medline]
Donepudi, M., A. Mac Sweeney, C. Briand, and M.G. Grutter. 2003. Insights into the regulatory mechanism for caspase-8 activation. Mol. Cell. 11:543–549.[CrossRef][Medline]
Esposti, M.D., I.M. Cristea, S.J. Gaskell, Y. Nakao, and C. Dive. 2003. Proapoptotic Bid binds to monolysocardiolipin, a new molecular connection between mitochondrial membranes and cell death. Cell Death Differ. 10:1300–1309.[CrossRef][Medline]
Gonzalvez, F., and E. Gottlieb. 2007. Cardiolipin: Setting the beat of apoptosis. Apoptosis. 12:877–885.[CrossRef][Medline]
Gonzalvez, F., J.J. Bessoule, F. Rocchiccioli, S. Manon, and P.X. Petit. 2005a. Role of cardiolipin on tBid and tBid/Bax synergistic effects on yeast mitochondria. Cell Death Differ. 12:659–667.[CrossRef][Medline]
Gonzalvez, F., F. Pariselli, P. Dupaigne, I. Budihardjo, M. Lutter, B. Antonsson, P. Diolez, S. Manon, J.C. Martinou, M. Goubern, et al. 2005b. tBid interaction with cardiolipin primarily orchestrates mitochondrial dysfunctions and subsequently activates Bax and Bak. Cell Death Differ. 12:614–626.[CrossRef][Medline]
Hauff, K.D., and G.M. Hatch. 2006. Cardiolipin metabolism and Barth syndrome. Prog. Lipid Res. 45:91–101.[CrossRef][Medline]
Hovius, R., H. Lambrechts, K. Nicolay, and B. de Kruijff. 1990. Improved methods to isolate and subfractionate rat liver mitochondria. Lipid composition of the inner and outer membrane. Biochim. Biophys. Acta. 1021:217–226.[Medline]
Kagan, V.E., V.A. Tyurin, J. Jiang, Y.Y. Tyurina, V.B. Ritov, A.A. Amoscato, A.N. Osipov, N.A. Belikova, A.A. Kapralov, V. Kini, et al. 2005. Cytochrome c acts as a cardiolipin oxygenase required for release of proapoptotic factors. Nat. Chem. Biol. 1:223–232.[CrossRef][Medline]
Kelley, R.I., J.P. Cheatham, B.J. Clark, M.A. Nigro, B.R. Powell, G.W. Sherwood, J.T. Sladky, and W.P. Swisher. 1991. X-linked dilated cardiomyopathy with neutropenia, growth retardation, and 3-methylglutaconic aciduria. J. Pediatr. 119:738–747.[CrossRef][Medline]
Kim, T.H., Y. Zhao, W.X. Ding, J.N. Shin, X. He, Y.W. Seo, J. Chen, H. Rabinowich, A.A. Amoscato, and X.M. Yin. 2004. Bid-cardiolipin interaction at mitochondrial contact site contributes to mitochondrial cristae reorganization and cytochrome C release. Mol. Biol. Cell. 15:3061–3072.
Kischkel, F.C., S. Hellbardt, I. Behrmann, M. Germer, M. Pawlita, P.H. Krammer, and M.E. Peter. 1995. Cytotoxicity-dependent APO-1 (Fas/CD95)-associated proteins form a death-inducing signaling complex (DISC) with the receptor. EMBO J. 14:5579–5588.[Medline]
Kobayashi, T., M. Yamaguchi, S. Kim, J. Morikawa, S. Ogawa, S. Ueno, E. Suh, E. Dougherty, I. Shmulevich, H. Shiku, and W. Zhang. 2003. Microarray reveals differences in both tumors and vascular specific gene expression in de novo CD5+ and CD5- diffuse large B-cell lymphomas. Cancer Res. 63:60–66.
Kuwana, T., M.R. Mackey, G. Perkins, M.H. Ellisman, M. Latterich, R. Schneiter, D.R. Green, and D.D. Newmeyer. 2002. Bid, bax, and lipids cooperate to form supramolecular openings in the outer mitochondrial membrane. Cell. 111:331–342.[CrossRef][Medline]
Landriscina, C., F.M. Megli, and E. Quagliariello. 1976. Turnover of fatty acids in rat liver cardiolipin: comparison with other mitochondrial phospholipids. Lipids. 11:61–66.[CrossRef][Medline]
Li, H., H. Zhu, C.J. Xu, and J. Yuan. 1998. Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis. Cell. 94:491–501.[CrossRef][Medline]
Liu, J., A. Weiss, D. Durrant, N.W. Chi, and R.M. Lee. 2004. The cardiolipin-binding domain of Bid affects mitochondrial respiration and enhances cytochrome c release. Apoptosis. 9:533–541.[CrossRef][Medline]
Liu, J., D. Durrant, H.S. Yang, Y. He, F.G. Whitby, D.G. Myszka, and R.M. Lee. 2005. The interaction between tBid and cardiolipin or monolysocardiolipin. Biochem. Biophys. Res. Commun. 330:865–870.[CrossRef][Medline]
Luo, X., I. Budihardjo, H. Zou, C. Slaughter, and X. Wang. 1998. Bid, a Bcl2 interacting protein, mediates cytochrome c release from mitochondria in response to activation of cell surface death receptors. Cell. 94:481–490.[CrossRef][Medline]
Lutter, M., M. Fang, X. Luo, M. Nishijima, X. Xie, and X. Wang. 2000. Cardiolipin provides specificity for targeting of tBid to mitochondria. Nat. Cell Biol. 2:754–761.[CrossRef][Medline]
Lutter, M., G.A. Perkins, and X. Wang. 2001. The pro-apoptotic Bcl-2 family member tBid localizes to mitochondrial contact sites. BMC Cell Biol. 2:22.[CrossRef][Medline]
Martinon, F., K. Burns, and J. Tschopp. 2002. The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Mol. Cell. 10:417–426.[CrossRef][Medline]
Milovic-Holm, K., E. Krieghoff, K. Jensen, H. Will, and T.G. Hofmann. 2007. FLASH links the CD95 signaling pathway to the cell nucleus and nuclear bodies. EMBO J. 26:391–401.[CrossRef][Medline]
Ott, M., J.D. Robertson, V. Gogvadze, B. Zhivotovsky, and S. Orrenius. 2002. Cytochrome c release from mitochondria proceeds by a two-step process. Proc. Natl. Acad. Sci. USA. 99:1259–1263.
Scaffidi, C., S. Fulda, A. Srinivasan, C. Friesen, F. Li, K.J. Tomaselli, K.M. Debatin, P.H. Krammer, and M.E. Peter. 1998. Two CD95 (APO-1/Fas) signaling pathways. EMBO J. 17:1675–1687.[CrossRef][Medline]
Shell, S., S.M. Park, A.R. Radjabi, R. Schickel, E.O. Kistner, D.A. Jewell, C. Feig, E. Lengyel, and M.E. Peter. 2007. Let-7 expression defines two differentiation stages of cancer. Proc. Natl. Acad. Sci. USA. 104:11400–11405.
Shidoji, Y., K. Hayashi, S. Komura, N. Ohishi, and K. Yagi. 1999. Loss of molecular interaction between cytochrome c and cardiolipin due to lipid peroxidation. Biochem. Biophys. Res. Commun. 264:343–347.[CrossRef][Medline]
Simbeni, R., L. Pon, E. Zinser, F. Paltauf, and G. Daum. 1991. Mitochondrial membrane contact sites of yeast. Characterization of lipid components and possible involvement in intramitochondrial translocation of phospholipids. J. Biol. Chem. 266:10047–10049.
Slee, E.A., M.T. Harte, R.M. Kluck, B.B. Wolf, C.A. Casiano, D.D. Newmeyer, H.G. Wang, J.C. Reed, D.W. Nicholson, E.S. Alnemri, et al. 1999. Ordering the cytochrome c–initiated caspase cascade: hierarchical activation of caspases-2, -3, -6, -7, -8, and -10 in a caspase-9–dependent manner. J. Cell Biol. 144:281–292.
Stegh, A.H., H. Herrmann, S. Lampel, D. Weisenberger, K. Andra, M. Seper, G. Wiche, P.H. Krammer, and M.E. Peter. 2000. Identification of the cytolinker plectin as a major early in vivo substrate for caspase 8 during CD95- and tumor necrosis factor receptor-mediated apoptosis. Mol. Cell. Biol. 20:5665–5679.
Stegh, A.H., B.C. Barnhart, J. Volkland, A. Algeciras-Schimnich, N. Ke, J.C. Reed, and M.E. Peter. 2002. Inactivation of caspase-8 on mitochondria of Bcl-xL-expressing MCF7-Fas cells: role for the bifunctional apoptosis regulator protein. J. Biol. Chem. 277:4351–4360.
Stupack, D.G., T. Teitz, M.D. Potter, D. Mikolon, P.J. Houghton, V.J. Kidd, J.M. Lahti, and D.A. Cheresh. 2006. Potentiation of neuroblastoma metastasis by loss of caspase-8. Nature. 439:95–99.[CrossRef][Medline]
Tinel, A., and J. Tschopp. 2004. The PIDDosome, a protein complex implicated in activation of caspase-2 in response to genotoxic stress. Science. 304:843–846.
Tu, S., G.P. McStay, L.M. Boucher, T. Mak, H.M. Beere, and D.R. Green. 2006. In situ trapping of activated initiator caspases reveals a role for caspase-2 in heat shock-induced apoptosis. Nat. Cell Biol. 8:72–77.[CrossRef][Medline]
Valianpour, F., R.J. Wanders, H. Overmars, P. Vreken, A.H. Van Gennip, F. Baas, B. Plecko, R. Santer, K. Becker, and P.G. Barth. 2002. Cardiolipin deficiency in X-linked cardioskeletal myopathy and neutropenia (Barth syndrome, MIM 302060): a study in cultured skin fibroblasts. J. Pediatr. 141:729–733.[CrossRef][Medline]
Valianpour, F., V. Mitsakos, D. Schlemmer, J.A. Towbin, J.M. Taylor, P.G. Ekert, D.R. Thorburn, A. Munnich, R.J. Wanders, P.G. Barth, and F.M. Vaz. 2005. Monolysocardiolipins accumulate in Barth syndrome but do not lead to enhanced apoptosis. J. Lipid Res. 46:1182–1195.
van Loo, G., X. Saelens, M. van Gurp, M. MacFarlane, S.J. Martin, and P. Vandenabeele. 2002. The role of mitochondrial factors in apoptosis: a Russian roulette with more than one bullet. Cell Death Differ. 9:1031–1042.[CrossRef][Medline]
Varfolomeev, E.E., M. Schuchmann, V. Luria, N. Chiannilkulchai, J.S. Beckmann, I.L. Mett, D. Rebrikov, V.M. Brodianski, O.C. Kemper, O. Kollet, et al. 1998. Targeted disruption of the mouse caspase 8 gene ablates cell death induction by the TNF receptors, Fas/Apo1, and DR3 and is lethal prenatally. Immunity. 9:267–276.[CrossRef][Medline]
Vreken, P., F. Valianpour, L.G. Nijtmans, L.A. Grivell, B. Plecko, R.J. Wanders, and P.G. Barth. 2000. Defective remodeling of cardiolipin and phosphatidylglycerol in Barth syndrome. Biochem. Biophys. Res. Commun. 279:378–382.[CrossRef][Medline]
Wang, X. 2001. The expanding role of mitochondria in apoptosis. Genes Dev. 15:2922–2933.
Wilson, K.S., H. Roberts, R. Leek, A.L. Harris, and J. Geradts. 2002. Differential gene expression patterns in HER2/neu-positive and -negative breast cancer cell lines and tissues. Am. J. Pathol. 161:1171–1185.
Xu, Y., A. Malhotra, M. Ren, and M. Schlame. 2006. The enzymatic function of tafazzin. J. Biol. Chem. 281:39217–39224.
Zhang, X., L. Li, J. Choe, S. Krajewski, J.C. Reed, C. Thompson, and Y.S. Choi. 1996. Up-regulation of Bcl-xL expression protects CD40-activated human B cells from Fas-mediated apoptosis. Cell. Immunol. 173:149–154.[CrossRef][Medline]
Zhang, H., Q. Xu, S. Krajewski, M. Krajewska, Z. Xie, S. Fuess, S. Kitada, K. Pawlowski, A. Godzik, and J.C. Reed. 2000. BAR: An apoptosis regulator at the intersection of caspases and Bcl-2 family proteins. Proc. Natl. Acad. Sci. USA. 97:2597–2602.
Zou, H., Y. Li, X. Liu, and X. Wang. 1999. An APAF-1.cytochrome c multimeric complex is a functional apoptosome that activates procaspase-9. J. Biol. Chem. 274:11549–11556.
Related Article
Related In this Issue article
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|