Table S1. Nucleotide sequences of oligonucleotide primers
Name Sequence (5' to 3')
P1F ATGTTTGATGCATGTAAAATAAATAGTAATTGCGCT
P1R CTTATCTTGATTACAAAAGTAATTACAACATTTATC
P7F ACACAGAAAGAGAATATGTTGCTATAACAGC
P7R TCATGGCTCAACTCAGTTCTATAATAAGG
P13F-KpnI GGTACCGTTAGAGTTTGTGATTTC
P13R-HindIII AAGCTTCTGGAACCTCCACAAC
P14F-XbaI TCTAGAGGATATCTACAGATAC
P14R-NotI GCGGCCGCTAAGAATGTGTATAC
P22F-BamHI GGATCCGAATATGGAAATTTATATCCTTAT
P23R-XhoI CTCGAGTAAATTCGTTCTTTGATGGTTTAT