Table I

Primers Used to Amplify PKC cDNA

PrimerSequence
AF1GGAAGATCTGGACCATGGCTGACGTTTTC
AR1CGCGTCGACTCATACTGCACTCTGTAAGAT
AR2CGCGTCGACCATACTGCACTCTGTAAGATG
AR3AACGTCGACGCAGGGCCAAGTTTGGCTTT
B2F1GGAAGATCTGCAAGATGGCTGACCCGGCT
B2R1CGCGTCGACTTAGCTCTTGACTTCGGGTTT
B2R2CGCGTCGACAAGCTCTTGACTTCGGGTTTTA
B2R3AACGTCGACTGACTGATCTTGGCCCTCTC
DF1CGCCTCGAGCCCACCATGGCGCCGTTCCTGCGCATC
DF2GGAAGATCTGCAACGGGAGCCCCACTGCA
DR1CGCGAATTCAATCTTCCAGGAGGTGCTCG
DR2CGCGAATTCGATCTTCCAGGAGGTGCTCGAATT
DR3CGGAATTCTACCCTGATATATCCCAACA
EF1GGAAGATCTCGACCATGGTAGTGTTCAAT
EF2CGCAGATCTCGACCATGGGTGAAGCCCCTAAAGACAAT
EF3CGCAGATCTCGACCATGGGCCACAAGTTCATGGCCACC
EF4GCGACGCGTACCCCCGACCAGGTGGGCTCC
EF5GCGACGCGTGCCAAAGTACTGGCCGACCTG
ER1CGCGTCGACTCAGGGCATCAGGTCTTCACC
ER2CGCGTCGACCAGGGCATCAGGTCTTCACCA
ER3AACGTCGACTCTCCTCGGTTGTCAAATGA
ER4CGCGTCGACATTCCTCTGGCATCCACTCC
ER5CGCGTCGACCGAAGATAGGTGGCCATGAA
ER6CGCGTCGACACACGCTCTTCATTGTCTT
ER7CGCGTCGACACCTGGTCGGGGGTCTCCTG
ER8GCGACGCGTGGCCATGAACTTGTGGCCGTT
ER9GCGACGCGTGATACCGAACTTGTGGGGCAT
HF1GCAAGATCTGCATGTCGTCTGGCACCATG
HR1GCAGTCGACCCAATCCCATTTCCTTC
QF1GCAGGATCCCCATGTCGCCATTTCTTCG
QR1GCTGTCGACCAGGAAATGCCCTGAGGCTC