Table II;

miRNAs conserved across phyla

NameSequence1Homologues2
miR-1UGGAAUGUAAAGAAGUAUGGAGC, D, H
miR-2UAUCACAGCCAGCUUUGA(G/U)G(U/A)GC3C, D
miR-7UGGAAGACUAGUGAUUUUGUUGUD, H
miR-34AGGCAGUGUGGUUAGCUGGUUGC, D, H
miR-60UAUUAUGCACAUUUUCUAGUUCAC, D, H
miR-79AUAAAGCUAGGUUACCAAAGCUC, D
miR-84UGAGGUAGUAUGUAAUAUUGUAC, D, H
miR-87GUGAGCAAAGUUUCAGG(U/A)GU3C, D, H
  • 1 RNA sequences are deduced from cDNA sequencing; no RNAs have yet been sequenced.

  • 2 C, C. elegans; D, D. melanogaster; H, H. sapiens.

  • 3 Letters in parentheses indicate variations in otherwise identical miRNAs from different organisms or variant genes within one organism.